ID: 1119968858

View in Genome Browser
Species Human (GRCh38)
Location 14:78947171-78947193
Sequence GAGGTAGCTGCCACACAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119968858_1119968864 27 Left 1119968858 14:78947171-78947193 CCATTCTGTGTGGCAGCTACCTC 0: 1
1: 0
2: 0
3: 22
4: 247
Right 1119968864 14:78947221-78947243 CATCAAGCTCATAAGCTGATAGG 0: 1
1: 0
2: 0
3: 10
4: 109
1119968858_1119968860 -10 Left 1119968858 14:78947171-78947193 CCATTCTGTGTGGCAGCTACCTC 0: 1
1: 0
2: 0
3: 22
4: 247
Right 1119968860 14:78947184-78947206 CAGCTACCTCTGTCCACAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119968858 Original CRISPR GAGGTAGCTGCCACACAGAA TGG (reversed) Intronic
901969238 1:12894352-12894374 GGGGTAGATGCCACAGAGAGAGG - Intronic
902015934 1:13307428-13307450 GGGGTAGATGCCACAGAGAGAGG + Intronic
902249121 1:15141747-15141769 GGGGCAGCTGCCACACAGTGAGG + Intergenic
902677467 1:18018718-18018740 GAGGAAGCTGAGACTCAGAAAGG - Intergenic
902875356 1:19337707-19337729 AAGGTGCCTGGCACACAGAAGGG - Intergenic
902875377 1:19337789-19337811 AAGGTGCCTGGCACACAGAAGGG - Intergenic
903582519 1:24382451-24382473 GAGGCAACTGGGACACAGAAGGG + Intronic
904083331 1:27885793-27885815 GAGGAAACTGCCCTACAGAAGGG + Intronic
904524301 1:31121042-31121064 GAGGCAGCTGAGACCCAGAAAGG - Intergenic
906264374 1:44417542-44417564 GAGGCAGCCGCCGCACAGAGCGG - Intronic
907732701 1:57083183-57083205 GAGGTACCTGAGACACAGAAGGG + Intronic
908227354 1:62069305-62069327 GAGGTAACTGCGGCACAGAGAGG - Intronic
908498039 1:64714622-64714644 GAGGAAGCTGAGACACAGAAAGG + Intergenic
908512764 1:64862438-64862460 GAAGTACCTGACACACAGTAAGG + Intronic
910035111 1:82779313-82779335 GAGGTAGCTGGCAGGGAGAAGGG + Intergenic
910252674 1:85214220-85214242 GAGATAGCTGAGACCCAGAAGGG + Intergenic
911521055 1:98931405-98931427 GAGGTAACTGAGACACAGAAAGG + Intronic
911851087 1:102822270-102822292 GAGGCTGCTGCCACACACAAAGG + Intergenic
915523067 1:156459418-156459440 GAGGTAGGTGCTATAAAGAAGGG + Intergenic
916161420 1:161919658-161919680 CAGGTACCTGGCACACAGAAGGG - Intronic
918378877 1:183935240-183935262 CAGGTGGCTGCCAAACAGGATGG - Intronic
919433176 1:197522846-197522868 GAGGTAGCTGCCATATAAACAGG + Intronic
920494775 1:206446977-206446999 GAAGTAGCTGCAACCCAGAAAGG + Intronic
920689206 1:208132870-208132892 GAGGTAACTGAAGCACAGAAAGG + Intronic
920735545 1:208529912-208529934 TAGCCAGCTGGCACACAGAAGGG + Intergenic
923031177 1:230250113-230250135 AAGGAAACTGACACACAGAAAGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923205680 1:231756928-231756950 TGGGTAGCTGGCACACTGAAAGG - Intronic
924428170 1:243972874-243972896 GAGGAAACTGAGACACAGAAAGG + Intergenic
924892878 1:248303791-248303813 GAGGTATCTGACATACACAATGG - Intergenic
1065992848 10:31030001-31030023 GAGGCAACTGACACACAGAAAGG - Intronic
1066458612 10:35594164-35594186 CCTGTAGCTGCCTCACAGAATGG + Intergenic
1067738313 10:48876489-48876511 GAAGTATCTGGCACAGAGAAAGG + Intronic
1068969331 10:62946406-62946428 GAGGTAGCTGCAAAAAAGGAGGG - Intergenic
1069059051 10:63874373-63874395 AAGGAAGCCGCCACAGAGAAGGG + Intergenic
1069792177 10:71029922-71029944 GAGGTTCCTGCCACAGAGAAGGG + Intergenic
1069899874 10:71701256-71701278 GAGGGAGCTTCCCCACAGAGCGG + Intronic
1073792533 10:106954990-106955012 CAGGCAGCTGCCCCACACAACGG + Intronic
1074577511 10:114684387-114684409 TAGGCATCTGGCACACAGAAAGG + Intronic
1074973988 10:118565881-118565903 GGGGTAGGTGCCACACTGAGGGG - Intergenic
1077863046 11:6199904-6199926 TAGGTAGCTGCAGCACAGCATGG - Exonic
1077878180 11:6325183-6325205 GAGTTAGCTGCCACAAACCAAGG + Intergenic
1078527787 11:12113233-12113255 GAGGAAGCTGAGACCCAGAAAGG + Intronic
1078929097 11:15899679-15899701 GAGGGACCTGAAACACAGAAAGG - Intergenic
1079393475 11:20042162-20042184 GAGGTAGTTGGGACAAAGAATGG + Intronic
1080908846 11:36574858-36574880 GAGGTGGCTGCCACTCAAAGTGG - Exonic
1081691480 11:45081254-45081276 GAGGAACCTGCCACAGAGATTGG + Intergenic
1083653763 11:64219423-64219445 GAGGTAGCCCCCACTCAGGAAGG - Intronic
1083730618 11:64650632-64650654 GATGTACCTGCCCCACAGTAGGG + Exonic
1084359240 11:68658946-68658968 GAGCTGGCCTCCACACAGAAGGG + Intergenic
1087753162 11:102027832-102027854 TAAGTAGCTGGCACACAGGAGGG - Intergenic
1089072853 11:115714738-115714760 GAGGAAACTGACACTCAGAAAGG + Intergenic
1094215595 12:27938686-27938708 GATGTGGCTGCCGCAAAGAATGG + Intergenic
1097695562 12:62772002-62772024 GAGGTAACTGGGGCACAGAATGG + Intronic
1099295998 12:80828647-80828669 GAGGAAACTGAGACACAGAAAGG + Intronic
1102042168 12:109808100-109808122 GAGGTAGCTGAGGCACAGAGAGG + Intronic
1102200526 12:111054959-111054981 GAGGAAGCTGAGGCACAGAAAGG + Intronic
1102204790 12:111083074-111083096 GAGGCAACTGCCACTTAGAAGGG - Intronic
1103454296 12:121052885-121052907 GTGGTTCCAGCCACACAGAAAGG + Intergenic
1103958907 12:124595214-124595236 GAGGAAGCTGTCTCACAGAGAGG - Intergenic
1105775574 13:23656801-23656823 GAAATAGCAGCCACAGAGAAGGG - Intronic
1107442339 13:40439524-40439546 GAGGAAGCTGAGACACAGTAAGG + Intergenic
1107446356 13:40473250-40473272 GAGGAAACTGAGACACAGAAAGG + Intergenic
1109067753 13:57721653-57721675 GGGAAAGCTGCCACAAAGAAAGG - Intronic
1113796810 13:113063189-113063211 GAGGCAGCTGAGACACAGAGTGG + Intronic
1114639036 14:24206726-24206748 GAGGGCGCTGCCACCCAGACTGG + Intronic
1114891957 14:26936182-26936204 GAGCTAGCTGTCACATAAAATGG + Intergenic
1115513484 14:34161345-34161367 AAGGTTACTGCCACAAAGAAGGG + Intronic
1117987941 14:61407042-61407064 GATGTATCTGCTACTCAGAAAGG + Intronic
1118177832 14:63460261-63460283 GAGGAAACTGACACCCAGAAAGG + Intronic
1119087381 14:71750781-71750803 GAGGAAGCTGCAGCTCAGAAGGG + Intergenic
1119103560 14:71903217-71903239 CAGATGGCTGCCACATAGAAAGG - Intergenic
1119325702 14:73758777-73758799 GAGGTACCTGCCACAGAAAGTGG - Intronic
1119449175 14:74693627-74693649 GAGGAAACTGGGACACAGAAAGG + Intronic
1119968858 14:78947171-78947193 GAGGTAGCTGCCACACAGAATGG - Intronic
1124694115 15:31849119-31849141 CAGGTAGCAGCCAGAGAGAAAGG - Intronic
1125006083 15:34819694-34819716 GAGCTAGCTGCCACGATGAAAGG + Intergenic
1126705244 15:51399741-51399763 GAAGTAGCAGCCCCAGAGAATGG - Intronic
1128562455 15:68677765-68677787 GAGGCAGGAGACACACAGAATGG - Intronic
1131322542 15:91408683-91408705 GAGGAAACTGCAACTCAGAAAGG + Intergenic
1131575852 15:93590287-93590309 GAAGTCTCTACCACACAGAAAGG + Intergenic
1132335506 15:101045965-101045987 GAGGTAGCTGAAACACACCAAGG - Exonic
1133335082 16:5001739-5001761 GAGGAAGCTGCTGCTCAGAAAGG - Intronic
1134107728 16:11495796-11495818 CAGGAAGCTGAGACACAGAAAGG + Intronic
1135043666 16:19136787-19136809 GAGGTAGCAGTCATACAGTATGG + Intronic
1137845092 16:51679511-51679533 GAGCTAGCTGTCACATAGCATGG - Intergenic
1139286740 16:65821978-65822000 GAGGTGGCTGCCCCAGGGAAAGG + Intergenic
1139425156 16:66874639-66874661 GAGCTAGCTGCCCCACAGGGAGG + Intergenic
1140084660 16:71784265-71784287 GAGGAAACTGAGACACAGAAAGG + Intronic
1140506858 16:75479022-75479044 GCGGTAGCGGCCGCGCAGAAAGG + Exonic
1141083243 16:81072065-81072087 GAGTTAGCGGCACCACAGAATGG + Intronic
1141275413 16:82583364-82583386 TAGGTGGCTTCCAAACAGAAAGG + Intergenic
1141300643 16:82812451-82812473 GAGGGAGCAGCCACAAAGATAGG + Intronic
1141671577 16:85494867-85494889 GTGGCAGCCCCCACACAGAAAGG + Intergenic
1141694964 16:85614791-85614813 GGGGTAGCGGCCACACAGGTTGG + Intronic
1142424345 16:89993040-89993062 GATGTTGCTGCAACACAGAGAGG + Intergenic
1142982283 17:3679195-3679217 GAGGAAGCTGAGGCACAGAAAGG - Intronic
1143327268 17:6107625-6107647 GAGGTACCTGAGACACAGATGGG + Intronic
1143467803 17:7149577-7149599 GAGGTTGCTGCTACACAGTGGGG + Intergenic
1145058086 17:19716195-19716217 CAGGCAGCCCCCACACAGAAGGG - Intronic
1149208674 17:54278569-54278591 AAGGTAGATGGAACACAGAAGGG - Intergenic
1150313674 17:64150392-64150414 GTGGTACCTGGCACACAGAAGGG + Intronic
1152198081 17:78929250-78929272 GAGGGGGCTGCCACCCATAAGGG + Intergenic
1152351737 17:79787361-79787383 GAAGTAGCTGGTAAACAGAAAGG - Exonic
1154417066 18:14183353-14183375 GAGGAAGTTGAGACACAGAAAGG + Intergenic
1157407808 18:47438187-47438209 CAGATGGCTCCCACACAGAAAGG + Intergenic
1158502251 18:58013139-58013161 GAGGAAGCTGCTACCCAGAGAGG - Intergenic
1158791148 18:60782051-60782073 GATGGAACTGCCATACAGAATGG + Intergenic
1160964690 19:1741918-1741940 GAGGGATCTGCCACACAGAGAGG + Intergenic
1161201409 19:3017070-3017092 TGGGTATCTCCCACACAGAAAGG + Intronic
1161243114 19:3233966-3233988 GAGGTAGCTGGAAGACAGAGTGG + Intronic
1161647374 19:5461859-5461881 GAGGAAGCTGGCATACAGACAGG + Intergenic
1161678727 19:5668024-5668046 GAGGCTGCTGCCACTCAGGAGGG + Intronic
1163786594 19:19277892-19277914 GAGGTAGCTGTCACCCACCAGGG + Intronic
1166989015 19:46679583-46679605 GCGGTAGCTGGCAGACAGTATGG + Intronic
1168089994 19:54076124-54076146 GAGGTGACAGCCACACAGGATGG - Intronic
1168459753 19:56544095-56544117 GAGGTACCTGGCACATAGTAAGG + Intronic
925101427 2:1249867-1249889 GAGGTCGCTGCCACTCACACTGG + Intronic
926336635 2:11867719-11867741 AAGGCAGCTGACACACAGTAAGG - Intergenic
928365087 2:30694328-30694350 CAGGCAGCTGCCAGCCAGAAGGG - Intergenic
929877934 2:45812530-45812552 GAGGTCACTGAGACACAGAAGGG - Intronic
930242887 2:48954492-48954514 GAAAGAGCTGCCACACAGAGAGG + Intergenic
935580042 2:104748838-104748860 GAAGTTTCTGCCACAAAGAAGGG + Intergenic
936842187 2:116784524-116784546 GATGTATGGGCCACACAGAAAGG + Intergenic
938115968 2:128603121-128603143 GAGGATGCAGCCACACAGCAGGG + Intergenic
938950308 2:136249181-136249203 GAGGCAGATGACACACTGAAAGG + Intergenic
939589939 2:144052531-144052553 GAGGAAACTGAGACACAGAAAGG + Intronic
939871008 2:147525879-147525901 GAGGTAGCTGGCAAGCAGACAGG + Intergenic
940188575 2:151014317-151014339 GAGGAAGCTGAAACACAGACAGG + Intronic
941012889 2:160321263-160321285 GGAGTACCTGCCACAGAGAAGGG - Intronic
941039748 2:160607836-160607858 GAGGCAGCTGACACGAAGAAAGG + Intergenic
942378512 2:175361954-175361976 GACTTTGCTCCCACACAGAATGG - Intergenic
944233221 2:197416501-197416523 GAGCTTGCTGGCACAGAGAAAGG + Intronic
944346696 2:198674796-198674818 GAGGAAGCTGAGGCACAGAAAGG - Intergenic
946018612 2:216623806-216623828 GAGGAAACTGACACACAGAGAGG + Intergenic
946615840 2:221508734-221508756 TGGGTAGCTGCCAAAGAGAAAGG + Intronic
947356229 2:229299014-229299036 CAAGTATCTGGCACACAGAAGGG - Intergenic
1169204127 20:3730614-3730636 GAGGGAGCTTCCAAACAGGAAGG + Intergenic
1169636853 20:7702025-7702047 GAGGGAGATGGAACACAGAATGG - Intergenic
1169893574 20:10478839-10478861 GAGGTAGCTGCCACTCCCAAGGG + Intronic
1171289440 20:23973153-23973175 GAGGAAACTGAGACACAGAAAGG - Intergenic
1171396118 20:24834508-24834530 GAGGAAACTGGCACACAGAGAGG - Intergenic
1171891397 20:30720609-30720631 GAGGAAGTTGAGACACAGAAAGG - Intronic
1172038292 20:32025856-32025878 GTGAGAGCTGCCACACAGATGGG + Intronic
1172166613 20:32903413-32903435 GAGGAAGTGGACACACAGAAGGG - Intronic
1172276001 20:33679731-33679753 TAGGTACCGGCCACACAGGAGGG - Intronic
1172841865 20:37906814-37906836 GAGGAACCAGCCACTCAGAAAGG + Intronic
1173867922 20:46324269-46324291 GAGGTCACTGCCACACCGACAGG - Intergenic
1173895569 20:46548200-46548222 GAGACAGCTGAGACACAGAAAGG - Intronic
1174195024 20:48766851-48766873 GAGGAACCTGCCCCAGAGAAAGG - Intronic
1174374715 20:50118385-50118407 GAGGAAACTGAGACACAGAACGG + Intronic
1176117859 20:63440838-63440860 AAGGAGGCTGCCACACAGAGTGG + Intronic
1176265116 20:64205215-64205237 GAGGTCGCTGCCTCGCAGAAGGG - Intronic
1179365691 21:40756819-40756841 GAGGAAGCTGAGGCACAGAAAGG + Intronic
1179528189 21:41997907-41997929 GAGGGATCTGCCACACCGAGAGG - Intronic
1181928375 22:26378674-26378696 GAAGAAGATGCCAGACAGAAGGG + Intronic
1183204053 22:36406259-36406281 GAGGTCACTGACACACAGAGAGG + Intergenic
1183749678 22:39712746-39712768 GATGGAGCTGGCAGACAGAAAGG - Intergenic
949537270 3:5005614-5005636 GCAGTGGCTGCCACACAGCAAGG + Intergenic
949783116 3:7712126-7712148 GAGGGAAGTGCCAGACAGAAGGG + Intronic
949908678 3:8881923-8881945 GAGGTGGCTGCCATACAAACAGG + Intronic
951243925 3:20317980-20318002 GAGGTATCTGCCACAAAGTCAGG + Intergenic
954888136 3:53895259-53895281 GAGGTAGCTGTCATTCAGAATGG - Intergenic
955117330 3:56018543-56018565 GAGGGAGCAGGCACACAGAGTGG + Intronic
955693639 3:61614353-61614375 GAGGAAACTGGGACACAGAAAGG - Intronic
956238794 3:67106133-67106155 GTGGTACCTGGCACACAGAGAGG + Intergenic
956338728 3:68195497-68195519 GGGGTAACTGCCCCACCGAAAGG + Intronic
956532656 3:70237867-70237889 TAGGAAGCTACCACAAAGAAAGG + Intergenic
958807383 3:98828259-98828281 GAGAAAGATGGCACACAGAATGG + Intronic
962627700 3:137243016-137243038 TAGGGAGCAGCCGCACAGAAAGG + Intergenic
964147307 3:153480408-153480430 GAGGTAGCTGAAGCACAGAATGG + Intergenic
966486809 3:180480026-180480048 GAGGTAGCAGCTGAACAGAAGGG + Intergenic
967991205 3:195132182-195132204 GAGGAAGCTGAGGCACAGAAAGG - Intronic
968565570 4:1310853-1310875 GAGGAAGGAGCCACACAGCAGGG - Intronic
968721764 4:2211965-2211987 GAGGCATCTTCCACAGAGAAGGG - Intronic
968833596 4:2946800-2946822 GCTGCAGCTGCCACACAGAGTGG - Intronic
973691852 4:53443151-53443173 AAGGCTACTGCCACACAGAATGG - Intronic
974066034 4:57078264-57078286 GAGGAAACTGAGACACAGAAAGG + Intronic
975323319 4:73032981-73033003 GAGGTTGGTGCAACCCAGAAGGG + Intergenic
976082381 4:81369872-81369894 CAGGTAGATACCACAAAGAAAGG - Intergenic
976418736 4:84812470-84812492 GAGGGAACTGTGACACAGAAAGG - Intronic
977265864 4:94853277-94853299 GAGGTAGCAATCACACATAAAGG - Intronic
978546145 4:109874549-109874571 GAGGTACCTACCACAAAGGAAGG + Intergenic
979396808 4:120198453-120198475 GAGGAACCTGCCACCCTGAAGGG + Intergenic
984206728 4:176793985-176794007 GAGTGAACAGCCACACAGAATGG - Intergenic
988943650 5:36171868-36171890 GAGGTAGCTGCTAATCAGAATGG + Intronic
989583183 5:43052619-43052641 TGGCCAGCTGCCACACAGAAAGG - Intergenic
992852231 5:80822736-80822758 GAGGCACCACCCACACAGAATGG + Intronic
993413493 5:87599377-87599399 AAGGCAGCAGCCACAGAGAAAGG - Intergenic
993459594 5:88166738-88166760 GACATAGTTGCCACACAGTATGG - Intergenic
993609610 5:90038069-90038091 GAGGCAGTTGCTACACTGAATGG + Intergenic
994177080 5:96722630-96722652 GAGGAAGCTGACACCTAGAAAGG - Exonic
995408799 5:111831824-111831846 AAGATAGCTGCCAGACAAAAAGG + Intronic
997228485 5:132227154-132227176 GCGGTTTCTGGCACACAGAAGGG + Exonic
999392132 5:151201058-151201080 GAGCTCCCTGCCACACAAAATGG - Intronic
999619457 5:153457758-153457780 AAGGAAACCGCCACACAGAAAGG + Intergenic
1000296687 5:159918277-159918299 GAGGCAGCTCGTACACAGAAAGG + Intronic
1001007939 5:168071144-168071166 GAGGTAACTGAGGCACAGAAAGG - Intronic
1001080994 5:168667302-168667324 GAGGTAGATGCTATAAAGAAAGG + Intronic
1001423986 5:171611570-171611592 GAGAAAGCTACCACTCAGAAAGG - Intergenic
1002001682 5:176199701-176199723 GCGGTAGCTGCCAGACAGGCGGG + Intergenic
1002252657 5:177939282-177939304 GCGGTAGCTGCCAGACAGGCGGG - Intergenic
1002402389 5:178998163-178998185 GTGGCAGCTGCCAAACAGTAGGG + Intergenic
1002459821 5:179367767-179367789 AAGGTGCCTGCCACACAGAGGGG + Intergenic
1004469959 6:15920374-15920396 GAGTTAGCTGACACAAAAAAAGG - Intergenic
1004511531 6:16287779-16287801 GAGGTTGCTGCCACTTAGGAAGG + Intronic
1005764536 6:28998131-28998153 GCAGTAACTGACACACAGAAGGG + Intronic
1006075187 6:31528076-31528098 GTGGCTGCTGCCAGACAGAAAGG - Intergenic
1007258701 6:40546784-40546806 GAGGAAACTGAGACACAGAAAGG + Intronic
1007501598 6:42302265-42302287 GAGCTAGCTGTCACAGACAAAGG - Intronic
1007826791 6:44606862-44606884 GAGGAAACTGCCATACAGAATGG + Intergenic
1009581345 6:65538020-65538042 GAGGAAATTGACACACAGAAAGG - Intronic
1012936746 6:105376105-105376127 GAGGTAAGTGCTACACAGAGAGG - Exonic
1014840258 6:126211081-126211103 GAGGTGGCAGCCACATAGGAGGG + Intergenic
1014899942 6:126950897-126950919 AAGGAAGCTGGGACACAGAAAGG - Intergenic
1016979702 6:149843118-149843140 GAGGCACCTGCCACACAGATGGG + Exonic
1017402374 6:154078970-154078992 GATGTTCCTGCCACACAGAGAGG + Intronic
1017413453 6:154194433-154194455 GAGGAATCTTCCACTCAGAAAGG - Intronic
1017503515 6:155046805-155046827 GGGGCAGCTGCCACACAGACAGG - Intronic
1018578109 6:165280799-165280821 GAGGCAGCAGCCACACTCAAAGG + Intronic
1020531754 7:9346813-9346835 GAGTGAGCTGTCACCCAGAAGGG + Intergenic
1020918300 7:14227068-14227090 GAGAAAGCTGCCATCCAGAAAGG + Intronic
1021248242 7:18291391-18291413 GAGGAAACTGAGACACAGAAAGG - Intronic
1022499207 7:30872068-30872090 GAGGAGGCTCCCACCCAGAAGGG - Intronic
1022499472 7:30873425-30873447 GAGGAAACTGACACACAGGAGGG - Intronic
1022849834 7:34248767-34248789 GAGGAAGCTGAGGCACAGAAAGG - Intergenic
1028530831 7:91836957-91836979 GAGGAAACTGCAACACAGAGGGG + Intronic
1030066488 7:105663297-105663319 GAGTTACCTGCCACACAGCTGGG - Intronic
1030083473 7:105797651-105797673 GAAGAGGCTGGCACACAGAAGGG + Intronic
1031554841 7:123161545-123161567 CAGCTAGCTGCGATACAGAATGG + Intronic
1031934303 7:127720243-127720265 GGGTCAGCTGCCACACAGCAAGG - Intronic
1032266084 7:130370965-130370987 GAGGTGGCTGCCACAGAGGGAGG + Intergenic
1032563045 7:132912521-132912543 GAGGAAACTGACACACAGAGAGG - Intronic
1033592849 7:142828136-142828158 AAGGTAGCTGGCAACCAGAATGG - Intergenic
1033619856 7:143052408-143052430 GAGGAAGGGGCCATACAGAAGGG - Exonic
1033887617 7:145967465-145967487 GAGGGACCTGACAAACAGAAAGG + Intergenic
1034266963 7:149785738-149785760 GAGGTGGCTGCAACATTGAAGGG + Intergenic
1034560021 7:151873866-151873888 CATGTGGCTGCCACACAAAATGG + Intronic
1035994118 8:4526562-4526584 AAGGTAGCTGACACACACATTGG + Intronic
1036686690 8:10916330-10916352 GGTGAAGCTGCCACCCAGAAAGG - Intronic
1037665909 8:20969970-20969992 GAGGTAGCTGTGGCACAGGAAGG - Intergenic
1041320416 8:56606663-56606685 GTGGTAGCTGTCAGAGAGAATGG + Intergenic
1042806702 8:72778332-72778354 GAGGTAACTGCTGCACCGAAAGG - Intronic
1043402727 8:79899786-79899808 AAGCTAGCTGCCACACAGTAAGG - Intergenic
1043542432 8:81279617-81279639 GAGGAAGTTGCCACACAGGCTGG - Intergenic
1043882070 8:85555348-85555370 GAGGAAACTGAGACACAGAAAGG + Intergenic
1044934625 8:97281059-97281081 GAGGTTACTGCCACACAAAATGG + Intergenic
1045557543 8:103229155-103229177 GAGGTAGCTGACACAGAAAAAGG + Exonic
1046009410 8:108528211-108528233 GAGGTAGCTGTCTCTCTGAATGG - Intergenic
1047543859 8:125796968-125796990 TGGGTAGCTGCCCCACACAACGG - Intergenic
1049698586 8:143995891-143995913 GAGGCAGCAGCCACTCAGACTGG - Intronic
1050395703 9:5193435-5193457 GGGGTAGCTGTCACTGAGAAAGG - Intergenic
1051579715 9:18657896-18657918 GAGGTATCTGCCTTACAGGAGGG - Intronic
1057449571 9:95144682-95144704 AAGGGAGCTGCCACAGTGAAAGG + Intronic
1060110794 9:120904981-120905003 GAGGGAGCTCCAACTCAGAAGGG - Exonic
1060629245 9:125141790-125141812 GAGGGAACTGCGACACAGAGAGG - Intronic
1061536751 9:131255065-131255087 GAGGACGCTGCCCCACAGAAGGG - Intergenic
1062093158 9:134689148-134689170 GAGGTGGCTGCCAGAGACAATGG - Intronic
1203561017 Un_KI270744v1:58406-58428 GAGGAAGTTGAGACACAGAAAGG - Intergenic
1186382530 X:9075860-9075882 CTGGTGGCTGCCACACCGAACGG + Intronic
1186402212 X:9270377-9270399 CAGGAACCTGCCACACACAAGGG + Intergenic
1186770467 X:12812906-12812928 AAGGTATCTGCCAGACACAAAGG - Intronic
1186781550 X:12916954-12916976 GAGGTAGCGGCCCCACAACAAGG - Intronic
1189643946 X:43105936-43105958 GAGAAAGCTCCCACACAGACAGG - Intergenic
1189748905 X:44198631-44198653 GAGGTAGCTGACAGCCAGAGAGG + Intronic
1190817507 X:53941170-53941192 GAGGTAGCTGAGATTCAGAAAGG - Intronic
1195377003 X:104237736-104237758 GAGGTAACTGCGACTCAGACAGG + Intergenic
1196058632 X:111383974-111383996 GAGGTAACTGAGACACAGAGGGG + Intronic
1196970495 X:121102817-121102839 AAGTTAATTGCCACACAGAATGG + Intergenic
1199627812 X:149757329-149757351 GGGGTAATTGCCACAGAGAAAGG + Intergenic