ID: 1119972495

View in Genome Browser
Species Human (GRCh38)
Location 14:78987220-78987242
Sequence GTTCTCAGACGACCACAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119972495_1119972496 -3 Left 1119972495 14:78987220-78987242 CCAGGTTGTGGTCGTCTGAGAAC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1119972496 14:78987240-78987262 AACTACACATTGAGAACCACTGG 0: 1
1: 2
2: 28
3: 138
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119972495 Original CRISPR GTTCTCAGACGACCACAACC TGG (reversed) Intronic
902755023 1:18543272-18543294 ATTCTCAGCCTACCACAGCCAGG - Intergenic
904898558 1:33837231-33837253 GTTCTCTGACTCTCACAACCTGG - Intronic
907832448 1:58077880-58077902 GTTCTGAGACGAGCAGCACCAGG + Intronic
909843463 1:80359592-80359614 TTTTTCAGTCTACCACAACCTGG - Intergenic
918006382 1:180545440-180545462 CTTCTCAGAAGACACCAACCAGG - Intergenic
918616958 1:186555750-186555772 GTTCACAGAAGACAGCAACCTGG - Intergenic
1067071041 10:43132243-43132265 GCCCTCAGACGGCCACTACCTGG - Intergenic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1077882702 11:6363710-6363732 TTTCTCAGACCCCCACGACCAGG + Intergenic
1078100264 11:8326212-8326234 CTGCTCAGACCACCTCAACCAGG + Intergenic
1083103428 11:60334147-60334169 GTTCTCAGAGGCCCCCAACATGG - Intergenic
1087385434 11:97463431-97463453 CTTCTGAGACCACCTCAACCTGG - Intergenic
1097379185 12:58874879-58874901 GGTCCCAGATGACCAGAACCAGG + Intronic
1111784017 13:92764598-92764620 GTTCTCAGTCGATCCCAACTGGG + Intronic
1112552015 13:100430198-100430220 GATCTCAGCTCACCACAACCCGG - Intronic
1116091028 14:40307337-40307359 CATCTGAGACGACCTCAACCTGG - Intergenic
1117954159 14:61109904-61109926 TTTCTCAGCCCACAACAACCAGG + Intergenic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1122716575 14:103699988-103700010 GTACTCAGACCACCCAAACCTGG + Intronic
1123989858 15:25675421-25675443 GTTCTCACACAACGTCAACCTGG - Intergenic
1124154080 15:27209826-27209848 GGTCTCAGAAGACACCAACCTGG - Intronic
1125687776 15:41573590-41573612 GCTCTGAGACAAGCACAACCTGG - Intronic
1130705240 15:86226801-86226823 TTTCTCTGACTACCACAACTTGG + Intronic
1131066630 15:89438878-89438900 GTGCTCAGCCGACCAGCACCAGG - Intergenic
1132835502 16:1950999-1951021 GTGCTCAGAAGCCCCCAACCGGG + Intronic
1140207643 16:72946817-72946839 TTTCTCAGAGGACTACACCCTGG - Intronic
1149578008 17:57727618-57727640 GTTCTCACACGTCTACACCCTGG + Intergenic
1153443512 18:5147253-5147275 GTTCTCAGATGCCCACCTCCAGG + Intronic
1157094633 18:44676804-44676826 TTTCTCAGACGATCACAAAGTGG + Intergenic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
925740016 2:6996919-6996941 GTTCTGCGATGACCACAACAAGG + Exonic
935626066 2:105173206-105173228 CATCTCAGACCACCTCAACCTGG + Intergenic
935859416 2:107311842-107311864 GTTCCCAGACCAGCACCACCTGG - Intergenic
936795073 2:116194916-116194938 CATCTCAGACCACCTCAACCTGG + Intergenic
938685083 2:133730276-133730298 GTTCTTAGCAGAACACAACCAGG + Intergenic
946665204 2:222042247-222042269 TTTATCAGACAACCAAAACCAGG - Intergenic
947736223 2:232456816-232456838 GATCCCAGAGGACCAGAACCAGG + Intronic
1172228004 20:33318058-33318080 GTTCTCAGAGCACTACACCCTGG + Intergenic
1180658041 22:17441021-17441043 GATCTCAGCTTACCACAACCCGG + Intronic
1181843824 22:25689798-25689820 GTTCTCAGAAGCCCAGAAGCTGG + Intronic
1182395050 22:30029230-30029252 GTTCTGAGATGAAGACAACCTGG - Intronic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
950656892 3:14442095-14442117 CTTGTCACACGACCACACCCTGG - Intronic
952358163 3:32603711-32603733 GTTCCCAGACCACCTCCACCAGG - Intergenic
961440284 3:126948681-126948703 GTTGTCAGAAGAAGACAACCTGG - Intronic
969612539 4:8235453-8235475 GTACACAGGCGACCCCAACCTGG + Exonic
972265716 4:37457315-37457337 GTTTTCAGTTGACCACAACATGG + Intronic
974795219 4:66740355-66740377 TTTATCAGAGGACCACAATCTGG - Intergenic
979591764 4:122489224-122489246 GTTCCCAGACAAGCACAAGCTGG - Intergenic
983458533 4:167996929-167996951 TTTCCCAGACCACCACAACTGGG + Intergenic
985233482 4:187847514-187847536 GATCTCAGAGAACCACAACTGGG - Intergenic
1000030583 5:157397863-157397885 CTTCTCAGACCACCTCAGCCTGG + Intronic
1000347549 5:160327545-160327567 GCTCTCAGGCAAGCACAACCTGG + Intronic
1005655351 6:27929773-27929795 CATCTGAGACCACCACAACCTGG + Intergenic
1006269818 6:32955583-32955605 CTTCTCAGCCCACCACAATCTGG - Intronic
1012663918 6:101942528-101942550 CGTCTCAGACGACCTCAGCCTGG - Intronic
1016126229 6:140407774-140407796 TATCTCAGACCACCACAACCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1020154220 7:5709167-5709189 GTCCTCAGAGGTCCCCAACCTGG + Intronic
1020326443 7:6978172-6978194 GTTCTCAGGGGACCAGAACAAGG - Intergenic
1020782786 7:12536888-12536910 CTTCTGAGACGACCTCAGCCTGG + Intergenic
1022186750 7:27976667-27976689 GCTCTCAGAAGACCATAAACAGG + Intronic
1027378710 7:77581227-77581249 ATTTTCAGACAACCACCACCTGG - Intronic
1028860974 7:95650074-95650096 GTGTTCAGTCCACCACAACCAGG + Intergenic
1035182537 7:157099704-157099726 GTACTCAGACACCCACACCCAGG - Intergenic
1038137322 8:24801884-24801906 CTTCTCAGACTATCACAGCCAGG + Intergenic
1038851277 8:31279442-31279464 GTTCTCAGAGGTGCACAATCAGG - Intergenic
1040563258 8:48543401-48543423 GTTCTGAGACGTCTACCACCAGG - Intergenic
1042222319 8:66485933-66485955 CTTCTCAGAGGCCCACAGCCCGG + Intronic
1049241620 8:141540293-141540315 GTTCTCAGCCGACAAGGACCTGG - Intergenic
1055780618 9:79817647-79817669 GGTTTCAGACAACCATAACCGGG + Intergenic
1055858632 9:80722874-80722896 CTTCTGAGACCACCACAGCCTGG + Intergenic
1056591785 9:87970421-87970443 GTGCTCAGAATACCCCAACCAGG + Intronic
1185669294 X:1792919-1792941 GTTCTCAGAGGACCCCATCCAGG - Intergenic