ID: 1119974504

View in Genome Browser
Species Human (GRCh38)
Location 14:79010485-79010507
Sequence GTTTTTCACTGAAATATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119974500_1119974504 23 Left 1119974500 14:79010439-79010461 CCATATGAGTGTAACTCATACCT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1119974504 14:79010485-79010507 GTTTTTCACTGAAATATATCAGG 0: 1
1: 0
2: 1
3: 21
4: 284
1119974502_1119974504 3 Left 1119974502 14:79010459-79010481 CCTAGGCTGATAACAAAATCTGA 0: 1
1: 0
2: 1
3: 21
4: 293
Right 1119974504 14:79010485-79010507 GTTTTTCACTGAAATATATCAGG 0: 1
1: 0
2: 1
3: 21
4: 284
1119974499_1119974504 30 Left 1119974499 14:79010432-79010454 CCAGCATCCATATGAGTGTAACT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1119974504 14:79010485-79010507 GTTTTTCACTGAAATATATCAGG 0: 1
1: 0
2: 1
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119974504 Original CRISPR GTTTTTCACTGAAATATATC AGG Intronic
901422603 1:9161314-9161336 GTTCTTCACTGAAACAGACCTGG + Intergenic
906785398 1:48611126-48611148 GTTTTTCACAAACAGATATCAGG - Intronic
907977247 1:59444015-59444037 GTTTCTCACTCAATTATTTCAGG - Intronic
908066978 1:60416604-60416626 GTTTTTCACTGTTATCTTTCTGG - Intergenic
908330933 1:63070600-63070622 GTTTTTCACTGACTTATTTCAGG - Intergenic
909255073 1:73409770-73409792 ATTTTTCACTTAAATGTATATGG - Intergenic
911944595 1:104091117-104091139 GCATTTCACTGAAGTATATAAGG - Intergenic
912709686 1:111941468-111941490 TTTTATCACAGAAATAAATCAGG + Intronic
913385924 1:118258313-118258335 GTTTTTCATTTAATTATATTAGG - Intergenic
913401285 1:118436985-118437007 GTTTTTGATTATAATATATCTGG + Intergenic
914984625 1:152445801-152445823 GTTTTGAAGTGAAATAAATCTGG - Intergenic
915030374 1:152874928-152874950 GTTGTTTACTGATATATCTCAGG - Intergenic
915200442 1:154222819-154222841 TTTTTTCAGTGAAATTTCTCTGG + Intronic
915678890 1:157560460-157560482 CTTTATTCCTGAAATATATCTGG + Intergenic
915946391 1:160155212-160155234 GCTCCTCATTGAAATATATCTGG - Exonic
917994967 1:180427479-180427501 GTATTTTGGTGAAATATATCTGG - Intronic
918029103 1:180786238-180786260 GTTTTTCTTTAAAATATCTCTGG + Intronic
918749071 1:188247911-188247933 ATTTTTGAATGAAATATATTTGG + Intergenic
919454882 1:197809599-197809621 GTTGTTCACTAGAATATATCAGG - Intergenic
920418677 1:205814844-205814866 TTTTTTAATTGAAATATACCAGG + Intergenic
921646550 1:217625297-217625319 GTTTTTCTTTCAAATATTTCTGG + Intronic
924171506 1:241346590-241346612 GTTTTTCACTGCAGTGTCTCAGG - Intronic
1063033046 10:2255417-2255439 GTTTGTAACTGCAATATATTTGG - Intergenic
1064041052 10:11964317-11964339 GTCTTTCACAGAAAGATATGTGG + Intronic
1064266518 10:13829862-13829884 GTGTTTCACCAAAATAAATCGGG + Intronic
1064879602 10:20036057-20036079 GTTTTTGAAAGTAATATATCTGG + Intronic
1066045339 10:31589664-31589686 GTTTTTCAATGAAATTTCTAGGG - Intergenic
1069039683 10:63682728-63682750 ATTTTTCACATAAAAATATCTGG + Intergenic
1069223823 10:65916231-65916253 CTTTTTAACTGAAATATTTCTGG + Exonic
1073642366 10:105265796-105265818 GTTTTTCATTCACATATATATGG + Intergenic
1074788025 10:116858887-116858909 GTTATTTATTGAAATATATGGGG + Intronic
1075055250 10:119213584-119213606 AATTTTCACTGAAATATAACAGG - Intronic
1077829116 11:5844831-5844853 GGTTTTCATAGAATTATATCTGG + Intronic
1078930444 11:15908426-15908448 GTTTTTCACTCAATAATATATGG + Intergenic
1080160616 11:29170890-29170912 TTTTTACAATGAAATATAGCTGG - Intergenic
1080610061 11:33896201-33896223 GCTTTTCACTGAGATATCTGGGG + Intergenic
1082195525 11:49299686-49299708 ATTTTTCACTTAAATATATGGGG + Intergenic
1083230542 11:61315269-61315291 ATTTATCACTGAAATAAAACAGG + Intronic
1086202416 11:84219601-84219623 TTTTTTCACTGAACTATTTGCGG + Intronic
1086376838 11:86209601-86209623 TTTTTTCCCTGAAATATTCCAGG + Intergenic
1086660411 11:89409877-89409899 ATTTTTCACTTAAATATATGGGG - Intronic
1087511983 11:99107381-99107403 CTTTTTCACTGAAAAATGTATGG + Intronic
1087906069 11:103699521-103699543 TTTTTTCAATGAAATCTCTCTGG + Intergenic
1088061249 11:105653664-105653686 GTTTTTCAGAAAAATATTTCTGG + Intronic
1088405756 11:109476485-109476507 TTTTTTCATTTAATTATATCTGG - Intergenic
1088708660 11:112486343-112486365 ACTTTACACTGAAATATTTCAGG - Intergenic
1092676806 12:10929968-10929990 GTATTTCAATGAAATATTTGGGG - Intronic
1093042546 12:14400642-14400664 GTTTTACAAAGGAATATATCAGG - Intronic
1093212545 12:16325200-16325222 GATTTTTACTCAAATAAATCAGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1094300056 12:28954260-28954282 TTTTTTCATTTAAAAATATCAGG - Intergenic
1094338862 12:29388458-29388480 TTTTTGCACTGAAAGATATTGGG - Intergenic
1095082281 12:38018069-38018091 GTTTTTCATTGCAAGATATTTGG - Intergenic
1095250865 12:39978048-39978070 CTTTCTCACTGCAGTATATCTGG + Intronic
1095402991 12:41836614-41836636 GTTTTTTTCTGTAATCTATCTGG - Intergenic
1095599322 12:43997177-43997199 GTTTTGGAGTCAAATATATCTGG - Intronic
1096708868 12:53441105-53441127 TTTTGTCTCTCAAATATATCTGG - Intergenic
1097118255 12:56715068-56715090 TTTTTTCACTTAAGTGTATCTGG - Intronic
1098561891 12:71883150-71883172 GTTTTTCTGTGAAATATTTTTGG + Intronic
1098970333 12:76848057-76848079 TTTTTTCACTGAGATATAATAGG + Intronic
1099601704 12:84747726-84747748 GTTTTCTACTGGAAAATATCTGG - Intergenic
1099796318 12:87405145-87405167 ATTTTTCACTGTAAAATATTTGG + Intergenic
1099977052 12:89557011-89557033 GTTTTTCTCTTACATTTATCTGG + Intergenic
1100001287 12:89839002-89839024 GTTATTCATTGAGATATATGGGG + Intergenic
1100004887 12:89882804-89882826 GTGATTCAATGAAATATATTTGG - Intergenic
1100342192 12:93690017-93690039 GAATTTCTCTGAAATATATTGGG + Intronic
1102333197 12:112053545-112053567 GTTTTTCACTTACATCTTTCTGG + Exonic
1103430646 12:120882424-120882446 GTATTTTACTGCAATATAACAGG + Intronic
1105564852 13:21534640-21534662 GGGATTCACTGAAATAGATCAGG + Intronic
1106061340 13:26295604-26295626 GTTTTTCAGATAAATATATTTGG + Intronic
1107251952 13:38374534-38374556 GTTTTTCAGTTTAATATATGAGG + Intergenic
1107590128 13:41895169-41895191 GTTTATAACTGATACATATCAGG + Intronic
1107827866 13:44346513-44346535 GTTTGTCAATAAAGTATATCAGG + Intergenic
1109444172 13:62411525-62411547 GTTTTTCTATGAAATATAAAAGG - Intergenic
1109874127 13:68376359-68376381 GTTTTTGAGTGAAATATATTAGG - Intergenic
1110610257 13:77480068-77480090 TTTTTTCACTGAACAATTTCAGG + Intergenic
1114065493 14:19055681-19055703 GTTTTTTCCTAAAATATATGGGG + Intergenic
1114096768 14:19344320-19344342 GTTTTTTCCTAAAATATATGGGG - Intergenic
1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG + Intergenic
1118704047 14:68463292-68463314 TTTTTTTCCTGAAATATATTGGG + Intronic
1119974504 14:79010485-79010507 GTTTTTCACTGAAATATATCAGG + Intronic
1120254247 14:82097699-82097721 GTTTTTCACATAAATTTATAAGG + Intergenic
1120900706 14:89573215-89573237 TTATTTCAGTGAAATATCTCTGG - Intronic
1120945350 14:89989860-89989882 GGTTTTCACTTAACTATATAAGG + Intronic
1121615932 14:95313822-95313844 ATTTTTCACTGAAATAGCTGAGG - Intronic
1123489467 15:20769668-20769690 GTTTTTCCCTAAAATACATGGGG - Intergenic
1123545966 15:21338755-21338777 GTTTTTCCCTAAAATATATGGGG - Intergenic
1123830261 15:24128876-24128898 AATTTTCTCTGAAATATCTCTGG + Intergenic
1123845170 15:24292812-24292834 AATTTTCTCTGAAATATCTCTGG + Intergenic
1123863953 15:24498112-24498134 AATTTTCTCTGAAATATCTCTGG + Intergenic
1124870976 15:33542230-33542252 TTTCTTAACTGAAATCTATCAGG - Intronic
1126863939 15:52916827-52916849 GTTTTACACTTATATATAGCAGG - Intergenic
1127603718 15:60564702-60564724 GTTTATCACTCAGATATATTTGG + Intronic
1129568115 15:76646423-76646445 GTTTTTCACTGTATAATAGCTGG - Intronic
1131544824 15:93307414-93307436 GTTTTTCAGGGAAATATAAGAGG + Intergenic
1202954309 15_KI270727v1_random:66027-66049 GTTTTTCCCTAAAATATATGGGG - Intergenic
1137226625 16:46518053-46518075 TTGTTTCACTGAAATATTTATGG - Intergenic
1137816492 16:51402757-51402779 GTTTTTCCATGAAATATAAAGGG + Intergenic
1137887386 16:52119969-52119991 CTTTTTCAGTGAAATGTATTTGG - Intergenic
1137994467 16:53194866-53194888 TTTTCTTAATGAAATATATCTGG + Intronic
1138996309 16:62457417-62457439 ATTTTTCACAGAAATAGATAAGG - Intergenic
1139016311 16:62693059-62693081 TTTTTTCACTTAAATAAAACTGG + Intergenic
1139094827 16:63692826-63692848 GTATTACACTGAAAAATATTTGG - Intergenic
1139111475 16:63896743-63896765 ATTATTTACTGAAATAGATCTGG + Intergenic
1139146809 16:64335016-64335038 GTTAATCTCTGAAATATATAAGG + Intergenic
1139219627 16:65167716-65167738 GTTTATCAATGAAATAAAACAGG - Intergenic
1139304221 16:65969363-65969385 GTTTCTCACTGTAAAATATTAGG + Intergenic
1140251816 16:73301017-73301039 ATTTCTCACTGAAAGAAATCTGG + Intergenic
1140818064 16:78638914-78638936 GTTTTACACTGATATCTCTCAGG - Intronic
1149079475 17:52636965-52636987 GTTTTTTACAGGAATATATATGG + Intergenic
1149206952 17:54258831-54258853 GTTTTTTAATAAAATATATATGG - Intergenic
1150316012 17:64169601-64169623 GTTGTCCACTGAAATATTGCTGG + Intronic
1150538201 17:66066943-66066965 GTTTTAGAATTAAATATATCAGG - Intronic
1150662113 17:67091705-67091727 ATTTTTCACTGAAATATCATAGG + Intronic
1152974564 18:201826-201848 GTTTTTCAAGAAAGTATATCTGG - Intronic
1153150640 18:2088793-2088815 GTTTTTCTCTGAAATTGTTCAGG + Intergenic
1153332155 18:3884694-3884716 GTTTTTTACTAAAATTTAACTGG + Intronic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1156850529 18:41720483-41720505 GTTTTTCACTGCAATCCATCCGG + Intergenic
1156964351 18:43072532-43072554 GTTTTTCACTGAAACATTACAGG - Intronic
1158287610 18:55901915-55901937 TTTTTCAACTGAAAAATATCAGG - Intergenic
1158597663 18:58830237-58830259 TTTTTTCACTTATATATCTCTGG + Intergenic
1159319879 18:66832927-66832949 CATGTTCAGTGAAATATATCAGG + Intergenic
1159480302 18:68981596-68981618 TTTTTTCACTGCCCTATATCTGG - Intronic
1159624244 18:70673301-70673323 GTTTCTCAGTGGAATATATGGGG + Intergenic
1160228616 18:77029615-77029637 GTTGATCTCTGAAATAAATCAGG - Intronic
1166456035 19:42940023-42940045 GTGTTTCAATGAAAGACATCAGG - Intronic
1168167528 19:54561357-54561379 GGTTGTCACAGAAATATTTCTGG - Intergenic
1168537393 19:57182458-57182480 ATTTTTCACTAACATATATTCGG - Intergenic
925187312 2:1857769-1857791 GTTTTTCACCTAAACAGATCTGG + Intronic
925332084 2:3066390-3066412 GTCATTCACTGCAATATAACAGG + Intergenic
925597804 2:5573405-5573427 GTTTTTCTCTAACATATTTCTGG + Intergenic
925842031 2:8001487-8001509 CTTTTTCACTTAAATGTCTCTGG + Intergenic
926481015 2:13394863-13394885 GTGTTTCACTTTTATATATCAGG - Intergenic
926562095 2:14429000-14429022 GATTTTCACTCAAATATTTATGG + Intergenic
926620733 2:15044821-15044843 ATTTTTCACTGAAAGGCATCAGG + Intergenic
928195721 2:29215300-29215322 GTTTTTCTCTGCCATAGATCAGG + Intronic
929496889 2:42452639-42452661 TTTTTTCAGTGAAATAAATCAGG - Intronic
930927838 2:56841709-56841731 GTTTTTCACTGGAATAAAGCTGG + Intergenic
931466629 2:62493535-62493557 GTTTTTCAGGGAAAAACATCTGG - Intergenic
932642011 2:73458260-73458282 TTTTTTAACTTAAATATATTAGG + Intronic
932944789 2:76215471-76215493 TTTTATCTCTGTAATATATCTGG - Intergenic
933435064 2:82238695-82238717 CTTTTTCACTGAAACATACAGGG - Intergenic
933446641 2:82388084-82388106 TATGTTCAGTGAAATATATCAGG + Intergenic
936783014 2:116056566-116056588 TTTTTTCAATGATGTATATCAGG + Intergenic
937387435 2:121448735-121448757 GTTTTTCAGTTAAATGTATACGG - Intronic
938482915 2:131676045-131676067 GTTTTTTCCTAAAATATATGGGG + Intergenic
939106103 2:137950507-137950529 GTTATTCCTTGAAATATTTCAGG - Intergenic
940537561 2:154965806-154965828 GTTTTTCACAGAACCATCTCCGG + Intergenic
941238639 2:163009629-163009651 TATTTTCACTGTATTATATCTGG - Intergenic
943476613 2:188365470-188365492 GTTTTGCTGTGAAATATACCTGG + Intronic
943723350 2:191228286-191228308 TTTTTTCACTAAACTATATAAGG - Intergenic
943802039 2:192072591-192072613 TTTTTTCCCTGAAAAATATGTGG + Intronic
944076291 2:195734716-195734738 GTATTTGACTAAAATACATCTGG + Intronic
944398639 2:199299638-199299660 TTTTTTCACTGTTATATATGTGG + Intronic
945659288 2:212665954-212665976 GTTTATCACGGAAGCATATCAGG - Intergenic
947158575 2:227188698-227188720 CTTTTTCACTGACATGTATATGG + Intronic
947558016 2:231115286-231115308 GGATTTCAGTGAAAAATATCTGG + Intronic
947802775 2:232941766-232941788 GTTTTTCCCCCAAATAAATCTGG - Intronic
1170028785 20:11921976-11921998 GTCTTTTAATTAAATATATCTGG + Intronic
1174706790 20:52664381-52664403 TTTCTTCACTGTAATATTTCTGG + Intergenic
1176448925 21:6845436-6845458 GTTTTTTCCTAAAATATATGGGG + Intergenic
1176827094 21:13710459-13710481 GTTTTTTCCTAAAATATATGGGG + Intergenic
1177624581 21:23644229-23644251 GTTTTTCTCTAAAATGTCTCAGG + Intergenic
1178698179 21:34811866-34811888 ATTTTTCACAGACATATTTCTGG + Intronic
1179041850 21:37810188-37810210 CCTTTTCACTTAACTATATCTGG + Intronic
1179671860 21:42954904-42954926 GATTTTCAGTGCAATATTTCAGG - Intergenic
1180483976 22:15778274-15778296 GTTTTTTCCTAAAATATATGGGG + Intergenic
1180683130 22:17642949-17642971 ATTTTTCTCTGGTATATATCTGG + Intronic
1181872936 22:25915731-25915753 GTTTATCTGGGAAATATATCAGG - Intronic
1182172129 22:28241888-28241910 GTTATACACTAAAAAATATCAGG + Intronic
1182869467 22:33633472-33633494 GTTTTTCACAGATAAATATGGGG + Intronic
949177795 3:1087226-1087248 GTATTTCACTGGAAAGTATCAGG + Intergenic
949514844 3:4797840-4797862 GTTATACACTGAAATATTTATGG - Intronic
949553278 3:5130453-5130475 GGATTATACTGAAATATATCAGG - Intronic
954993798 3:54863941-54863963 CTTTTTCTCTGCAGTATATCTGG + Intronic
956604740 3:71063191-71063213 ACTTTTCACTGAAATGTGTCAGG + Intronic
957506875 3:81133399-81133421 TTCTTTCACTGATATATCTCTGG - Intergenic
957693553 3:83602592-83602614 GTCATTCATTGAAATATGTCAGG - Intergenic
957933776 3:86915743-86915765 GTTTTTCATTCATATATGTCTGG + Intergenic
958456588 3:94339256-94339278 CTTGTTCACTGTATTATATCTGG + Intergenic
959384326 3:105683116-105683138 ATTTTTAAATGAACTATATCTGG - Intronic
960274971 3:115718376-115718398 GGACTTCACTGAAATAAATCTGG + Intronic
960335546 3:116413270-116413292 GTATTTCATTAAAATAAATCAGG + Intronic
960428638 3:117541404-117541426 CTTTTTCACTGTAATTCATCTGG - Intergenic
963137013 3:141915569-141915591 GTTCTTCACAAAACTATATCAGG - Intronic
963231081 3:142909374-142909396 GTTTTTAACTAAAATATCTGTGG - Intergenic
963535981 3:146528978-146529000 ATTTTTCAATGAAATATCTGTGG + Intronic
964501621 3:157354405-157354427 GCTTTCCTTTGAAATATATCTGG + Intronic
965712549 3:171570293-171570315 GTTTTCCACTGATTTATATAGGG + Intergenic
965722670 3:171678847-171678869 GTGTTTCACTGTATTATAACAGG + Intronic
965934748 3:174093978-174094000 GTTTTCCACTGAAATTAATTTGG + Intronic
966890397 3:184403545-184403567 GTTTTTCACTGGATCCTATCAGG + Intronic
966954380 3:184858921-184858943 GTTTTTCAAAGAAATGTTTCAGG + Intronic
970043611 4:11824386-11824408 GTTATTTACTGAAATAGCTCTGG + Intergenic
971319142 4:25591289-25591311 GGTTTTAACTGAAATAGATGTGG + Intergenic
971658503 4:29381391-29381413 GTTTTTCAATGAAATTTTTATGG - Intergenic
971701961 4:29989427-29989449 CTTTTTCTCTGAACTTTATCAGG - Intergenic
973138380 4:46734670-46734692 TTTATTCACTGAAAGATACCTGG + Intergenic
973233062 4:47864853-47864875 GTTTTTCTCTGAGATTTATGAGG + Intronic
974928267 4:68328571-68328593 GTTTGTCTCTTAAATATATGTGG - Intronic
977465209 4:97375428-97375450 GTTTTTTACTGAAAAAAATATGG - Intronic
978881546 4:113709352-113709374 AATATTCACTGAATTATATCAGG + Intronic
979415006 4:120426381-120426403 GTTAGTCACTGAAATGTCTCTGG - Intergenic
979612684 4:122705790-122705812 GTTTTGGACTGCAACATATCAGG - Intergenic
981197303 4:141936460-141936482 ATTTTTAATTCAAATATATCTGG - Intergenic
982315631 4:154028620-154028642 GTTAGTCTCTGAAATATATAAGG + Intergenic
983318131 4:166158545-166158567 GATTTTCACTGAAATAAAAGTGG + Intergenic
983918959 4:173324690-173324712 GTTTTCCATTGAATTATATATGG - Intergenic
984211785 4:176858657-176858679 ATTTAGCACTGAAATATATGTGG + Intergenic
984263132 4:177465610-177465632 GTTTTTCAGTGAAAAAAATGAGG + Intergenic
984300757 4:177914028-177914050 GTTCTTTAGTGAAATATAGCAGG - Intronic
984379381 4:178970955-178970977 GTTATTGGCTGAAAGATATCTGG - Intergenic
984618483 4:181926282-181926304 ATTTTTAGATGAAATATATCAGG + Intergenic
984978221 4:185250497-185250519 GTTTTTTATTTTAATATATCAGG - Intronic
986042742 5:4009717-4009739 TTTTTTCAAAGAAATTTATCTGG - Intergenic
988049662 5:26010344-26010366 GATTATCACTGCAATATATACGG + Intergenic
988313889 5:29598656-29598678 GATTTTCTCTGAAAGATATATGG + Intergenic
991210623 5:64100346-64100368 CTTTTCCACAGAAATACATCAGG - Intergenic
992272017 5:75074504-75074526 GTTTTCCACTCACATATATAGGG - Intronic
993299339 5:86188098-86188120 GTTTTTCACCTAAATATAGGAGG + Intergenic
993477914 5:88387965-88387987 ATTTTTCACTGATATATTTTGGG - Intergenic
994242312 5:97438783-97438805 GTTTTATACTGAAATTTATTTGG - Intergenic
996266871 5:121551895-121551917 CCTTTTCCCTGAAATATATCAGG - Intergenic
996283137 5:121756664-121756686 ATACTTCACAGAAATATATCTGG - Intergenic
996992952 5:129658506-129658528 GTTTTACAATTAAATATATCTGG + Intronic
998187795 5:139996236-139996258 GTTGTTCATTGAAAAAAATCAGG - Intronic
999900632 5:156082728-156082750 TTATTTCTCTGAAATACATCAGG + Intronic
1000748714 5:165068256-165068278 TTTTTTCAATCAAATATACCAGG - Intergenic
1003564570 6:7212249-7212271 CTTTTTTATTGAAACATATCAGG - Intronic
1004554311 6:16680679-16680701 GTTTTTCACTGTTATATACAAGG + Intronic
1005098322 6:22142778-22142800 GCCTTTTACTAAAATATATCTGG + Intergenic
1007825494 6:44596958-44596980 GTTTTTCACTGACAGACATTTGG + Intergenic
1007990666 6:46251947-46251969 GTTTTTCACTGGATCATATGGGG + Intronic
1008161778 6:48086520-48086542 ATTTTTCATTGATATATATTAGG - Intergenic
1008772678 6:54998465-54998487 GTTTATTACTGAAATGTAGCTGG + Intergenic
1008887107 6:56443600-56443622 TTTTTGCACTTAAAAATATCTGG - Intergenic
1009275024 6:61664797-61664819 CTGTTTCACTGAAATATATTTGG + Intergenic
1010532647 6:76988293-76988315 GTTTTGCACAGAAATACATCTGG - Intergenic
1010834225 6:80567042-80567064 AATATTCACTGAATTATATCTGG - Intergenic
1010932889 6:81823858-81823880 GTTAATAACTGAAATATATAAGG - Intergenic
1010955154 6:82081869-82081891 GTTTTTAATTGAAATATAAAAGG + Intergenic
1011345120 6:86360979-86361001 TTCTTTCTCTGGAATATATCCGG - Intergenic
1011991167 6:93519366-93519388 GTTTTTGACTTAAATATTTGGGG + Intergenic
1012049432 6:94321956-94321978 ATTTTTCACTGAAATATGAAGGG + Intergenic
1012183048 6:96178716-96178738 CTTTTTAACTGAAATATAAATGG + Intronic
1012343829 6:98162052-98162074 GTTTTCCAGTGAAATAAACCAGG + Intergenic
1012545904 6:100419258-100419280 GTTGTACACTGAAAAACATCTGG + Intronic
1012734241 6:102918675-102918697 TTTTTTCATTGAAAAATATTAGG + Intergenic
1013665898 6:112348000-112348022 GGTTTTCACTTAAATATACTTGG + Intronic
1013837884 6:114354320-114354342 TTTATTCACTTAAATATATATGG - Intergenic
1014250125 6:119106845-119106867 GATATTCACTGAAAAAAATCTGG + Intronic
1014267795 6:119300925-119300947 GTTTTTAATTGAAATAGATGGGG + Intronic
1014372912 6:120635386-120635408 TTTTTTCCCTGAAATATTTTAGG + Intergenic
1015014141 6:128389766-128389788 CTTTTCCCCTGAAATATATTAGG + Intronic
1018409581 6:163530314-163530336 TTTTCTCACTTAAATACATCAGG - Intronic
1018966094 6:168490308-168490330 GTTTTAGAATGAAATATATCGGG + Intronic
1020807329 7:12806769-12806791 GTTTTACAATCAAATATATATGG + Intergenic
1021476761 7:21070486-21070508 CTTTATCACTAAAATATACCTGG + Intergenic
1021941593 7:25684594-25684616 GTTTCTCCTAGAAATATATCTGG - Intergenic
1023740161 7:43273571-43273593 ATGTTTCACTCAAATCTATCAGG - Intronic
1024878345 7:54053986-54054008 GTTTTCCAAAGAAATATATGTGG + Intergenic
1025219724 7:57096559-57096581 TTTCTTCTCTGAAAAATATCAGG - Intergenic
1025630512 7:63268105-63268127 TTTCTTCTCTGAAAAATATCAGG - Intergenic
1028429263 7:90728531-90728553 GTTATTCATTGAAATAGAACAGG - Intronic
1029898533 7:104013692-104013714 GCTTTCCACTGACATTTATCAGG - Intergenic
1030842103 7:114367933-114367955 TTTGTACACTGAAAAATATCTGG + Intronic
1030939274 7:115625672-115625694 GTTTTCCTCTGAAATATTTTTGG - Intergenic
1031522835 7:122787437-122787459 GCTTTGCAGTGAAATATGTCTGG - Intronic
1033764859 7:144477441-144477463 TTTTTTAACTCAAATATATGAGG - Intronic
1033858868 7:145599929-145599951 GTATTTCAATGGAATAGATCTGG - Intergenic
1036988884 8:13569245-13569267 CTTTTTCACTGAGATAATTCAGG - Intergenic
1037312742 8:17573901-17573923 TTTTTTCACAAAAATCTATCAGG - Intergenic
1037528803 8:19754354-19754376 GTTTTTCAAGGAATTTTATCTGG - Intronic
1038377216 8:27053387-27053409 GTTATTTACTGAAGTACATCTGG - Intergenic
1038972577 8:32653211-32653233 GTTTTCCACTGTCATATAACCGG - Intronic
1039017650 8:33170131-33170153 GTATTTCAATCAAATATATAGGG - Intergenic
1041307597 8:56478722-56478744 GTCATTCACTGAAGGATATCTGG - Intergenic
1042401679 8:68356132-68356154 GTTTATGAATGAAAAATATCAGG + Intronic
1042585090 8:70328281-70328303 TTCTTTCACTGAAATATAGCAGG - Intronic
1043964612 8:86459949-86459971 ATTCTTCACTGAAATATTTTGGG + Intronic
1045608678 8:103809402-103809424 GTTTTTATCTGTAATATAGCAGG - Intronic
1046165211 8:110424813-110424835 GTTTCTCACTGAGAAGTATCTGG + Intergenic
1050066599 9:1766502-1766524 ATTTTTCACTTAAACCTATCAGG + Intergenic
1050401491 9:5260635-5260657 ATCATTCACTAAAATATATCAGG + Intergenic
1050955965 9:11660150-11660172 TTTTTCCACTGAAAAATTTCAGG - Intergenic
1051512807 9:17898011-17898033 GTTTGGCACTGTAATTTATCAGG + Intergenic
1052109476 9:24563190-24563212 TTATTTCACTGAAATATTTTGGG - Intergenic
1056541705 9:87577090-87577112 GTTTGTCCCTCAAATATATACGG + Intronic
1058350876 9:104022423-104022445 GGTTTTCACTAAAAAATAGCTGG - Intergenic
1058381203 9:104378926-104378948 GTTTTGCAGTGGAATATCTCAGG + Intergenic
1060886456 9:127156072-127156094 GTTTTTAAGTGAAAAACATCAGG - Intronic
1203520264 Un_GL000213v1:39081-39103 GTTTTTTCCTAAAATATATGGGG - Intergenic
1187060223 X:15779678-15779700 GTTTTTACATGTAATATATCTGG - Intronic
1188395614 X:29679420-29679442 GTTTTTGACTGAAATATTTGGGG + Intronic
1188543612 X:31277338-31277360 CTTTTTTACTGAAATATATTAGG - Intronic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1193565621 X:83072873-83072895 GTTCTTCAAAGAAATATGTCAGG + Intergenic
1193890497 X:87039765-87039787 GTTTTTCACTAAAATATACCAGG - Intergenic
1194479562 X:94403768-94403790 GTTTTTAAATTAAATATAACAGG - Intergenic
1195135650 X:101905306-101905328 GTTTCTCACTGTAATAAATAAGG + Intronic
1196541228 X:116910763-116910785 TTTTCTCACTGAATTATATTGGG + Intergenic
1197002227 X:121452517-121452539 CTATTTCACTAAAATATATAGGG + Intergenic
1198731444 X:139734551-139734573 GTAAATCAATGAAATATATCTGG - Intronic
1200904598 Y:8468903-8468925 CTTTTTGACTGACATATCTCTGG + Intergenic
1201405525 Y:13645992-13646014 GTTTTGCACAGAAAAATCTCAGG - Intergenic
1201621995 Y:15969762-15969784 GTTTTTCACAGCAATATAGAAGG + Intergenic