ID: 1119974933

View in Genome Browser
Species Human (GRCh38)
Location 14:79015026-79015048
Sequence CTGAGCAAATCTCAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119974933_1119974937 12 Left 1119974933 14:79015026-79015048 CCTTCCCTCTGAGATTTGCTCAG 0: 1
1: 0
2: 2
3: 22
4: 242
Right 1119974937 14:79015061-79015083 TTCGCAATGTCCCCATCTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119974933 Original CRISPR CTGAGCAAATCTCAGAGGGA AGG (reversed) Intronic
900782397 1:4626648-4626670 CTCAGCAAGTCTCAGGGTGAGGG + Intergenic
900857789 1:5199930-5199952 GTTGGCCAATCTCAGAGGGAGGG + Intergenic
900917415 1:5648588-5648610 CTGGGTAAAACTCACAGGGACGG - Intergenic
901439711 1:9270486-9270508 CCCAGCACATCTCAGAGAGATGG - Exonic
901666203 1:10827693-10827715 CTGACCCCATCTCAGAGAGACGG - Intergenic
902713589 1:18257072-18257094 CCTAGCAACTCTGAGAGGGAAGG - Intronic
903448155 1:23435741-23435763 CTGAGCAGATGTCAGAGGTGGGG + Intronic
903678899 1:25083913-25083935 CAGAGCTAATCTCAGAGGCAGGG - Intergenic
905107603 1:35573688-35573710 CTAACGAAATCTCGGAGGGAGGG + Intronic
905856987 1:41320774-41320796 CTGAGCAAATGTCTCTGGGAAGG + Intergenic
906511866 1:46414573-46414595 TTGAGGACATCTCAGAGAGAAGG + Intergenic
907397691 1:54203068-54203090 CTTAGCTACTCTCAGTGGGATGG - Intronic
907603386 1:55792270-55792292 CTGGGTAAATCTCACAGGCATGG + Intergenic
908432733 1:64074509-64074531 CTGTGCAAGGCACAGAGGGAGGG + Intronic
910466094 1:87501651-87501673 CTGATGAAATATCAGAGGAATGG - Intergenic
910507079 1:87961382-87961404 TGAAGCAGATCTCAGAGGGAGGG + Intergenic
910957894 1:92727357-92727379 ATGAGCAAATCTAGCAGGGATGG - Intronic
912209404 1:107542351-107542373 ATGAGCAAGTCCCAGGGGGAAGG - Intergenic
915038443 1:152947780-152947802 GAAAGCAAACCTCAGAGGGAAGG - Intergenic
915107711 1:153544846-153544868 CTGAACACATCTCTGAGGGGTGG - Intronic
916292132 1:163178389-163178411 CTGAGAAAATGTCAGAGGACAGG + Intronic
918072578 1:181143739-181143761 CTGAGCACACCACAGAGTGAGGG - Intergenic
919003883 1:191870735-191870757 CTGAGCAAATCTCTTTAGGAAGG - Intergenic
919971733 1:202584882-202584904 CTGATGATATCTCTGAGGGAAGG - Exonic
920366835 1:205452385-205452407 CAGAGAAAGTCACAGAGGGAAGG + Intronic
920749887 1:208663906-208663928 AAAAGCAAATCTCAGAGAGAAGG - Intergenic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
920825610 1:209421907-209421929 AAAAGCAAATCTCAGAGTGAAGG + Intergenic
924194700 1:241593672-241593694 ATGAGCAAATCTCAAAGAGCTGG + Exonic
1063093009 10:2884783-2884805 AGGAGCAAATCTGATAGGGAGGG + Intergenic
1064535929 10:16357973-16357995 CTCAGCAAAATTCTGAGGGAGGG + Intergenic
1064866697 10:19888743-19888765 CTCTGCACATCTCATAGGGATGG - Intronic
1066445946 10:35483457-35483479 CTCAGTAAATCTCAGACGGACGG + Exonic
1066705962 10:38177954-38177976 CTGAGAAAATCTCAAATAGATGG + Intergenic
1066984338 10:42451608-42451630 CTGAGAAAATCTCAAACAGATGG - Intergenic
1067312233 10:45124854-45124876 ATGAGCAAAATTCAGAGAGAGGG + Intergenic
1069732173 10:70624154-70624176 ATGAGTAAATCTCAAAGAGATGG - Intergenic
1072235065 10:93446582-93446604 CCCAGCAAATGTCAGGGGGATGG + Intronic
1074144208 10:110702080-110702102 GGGAGCACATTTCAGAGGGAAGG - Intronic
1074683256 10:115932296-115932318 CTTAGCAAACATCAGAGGAAAGG + Intronic
1075609420 10:123839927-123839949 ATGGGAACATCTCAGAGGGAAGG - Intronic
1075730513 10:124632816-124632838 CTGAGCACAGCCCAGAGTGATGG - Intronic
1075960969 10:126567525-126567547 CTGAGCAAATCTCCCGGGGGTGG - Intronic
1078280570 11:9896894-9896916 GTCAGGAAATCTCAGTGGGAAGG + Intronic
1078729212 11:13960730-13960752 CTGATCTTATCTCAGAGGGCAGG - Intergenic
1079224699 11:18595345-18595367 CTCAGCAAATCTGGGAGGTATGG + Intergenic
1079325296 11:19486124-19486146 CTGGGCAAACATCAGAGGAAGGG - Intronic
1080483141 11:32673969-32673991 CTGAAGTTATCTCAGAGGGAAGG + Intronic
1081705370 11:45179899-45179921 CTGAGGAACTCTCACTGGGATGG - Intronic
1081744804 11:45465326-45465348 CTAAGGGAGTCTCAGAGGGAGGG - Intergenic
1082837805 11:57664287-57664309 CATAGCAAAACTCAGAAGGAGGG - Intergenic
1083830511 11:65229483-65229505 CTGAGCTAATGTCAGAGTGTGGG - Intergenic
1084856335 11:71990065-71990087 CTGAGACAATCTCAGAAAGAGGG + Intronic
1089699634 11:120236759-120236781 GTGAGCAAGTCTGAGAGAGAAGG + Intronic
1090227387 11:125079833-125079855 CTGATGTAATTTCAGAGGGAAGG + Intronic
1090401687 11:126453292-126453314 CTGAGAGACTCTCAGAGGAAAGG + Intronic
1095992293 12:48044034-48044056 CTGAGGAGCTCTCAGAGGGTGGG + Exonic
1096465230 12:51844964-51844986 CTCAGCACATCAGAGAGGGATGG + Intergenic
1097245823 12:57607140-57607162 CTGAAGAAAGCTCAGAGGCAGGG + Exonic
1098384679 12:69906404-69906426 CTGAGCAAAACTAGGGGGGAAGG + Intronic
1098452969 12:70641207-70641229 CTGTGCAAATGCCAGAGGAAGGG - Intronic
1100731846 12:97479595-97479617 ATGGGCAACTTTCAGAGGGAGGG - Intergenic
1101275719 12:103198718-103198740 CTGAGCAAATCTCAGGGAAGGGG - Intergenic
1104121645 12:125805544-125805566 CTGAGCAACTCACAGGTGGAGGG + Intergenic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1105331342 13:19419302-19419324 CTGAGCAAATCTAAGCAGAAGGG + Intergenic
1106137454 13:26984388-26984410 TTTAGCAAATCACAGAGTGAGGG - Intergenic
1106342757 13:28847015-28847037 CTGAGCAAAGTACAGAGGGCTGG + Intronic
1111843975 13:93486248-93486270 GTGAGCAAATGTCACAGTGAAGG + Intronic
1112382806 13:98908958-98908980 TTGAGCACTTCTCAGAGTGATGG + Intronic
1113398327 13:109969290-109969312 TTGAGCAATTCTGAGAGGGGAGG + Intergenic
1113466295 13:110515652-110515674 CTGAGTATTTCTCAGGGGGAAGG - Intergenic
1113520562 13:110937635-110937657 CTGAGCATTCCTCACAGGGAAGG - Intergenic
1115116495 14:29886411-29886433 ATGAGAAAATCTCAGATGAAAGG + Intronic
1116606049 14:46996890-46996912 CTGAGCAAATCTAACAGCAAGGG + Intronic
1117166008 14:53034337-53034359 CTCAGCAAATCTCAGATAAACGG + Intergenic
1118137286 14:63044715-63044737 CTGAGTTAATCTCAGTGGAAAGG - Intronic
1118729413 14:68655996-68656018 CTCAGCAGATATCAGATGGATGG - Intronic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1122035707 14:98947885-98947907 CAGAACAAATCTCATGGGGATGG - Intergenic
1122540484 14:102495352-102495374 TTAAGCTAAGCTCAGAGGGAAGG - Intronic
1122782908 14:104151111-104151133 CAGAGCAAAGCTCACTGGGAGGG - Intronic
1125544547 15:40493032-40493054 CTGAGCATATATTAAAGGGAAGG - Intergenic
1127238662 15:57086068-57086090 CTGAACAAATGACAAAGGGAGGG - Intronic
1127572881 15:60261476-60261498 CTGAGCAAGTCTCCAAGGCAAGG - Intergenic
1129329577 15:74820200-74820222 CTGAGCAGAGCTCAGAGGCCAGG - Intronic
1131066554 15:89438492-89438514 CATATGAAATCTCAGAGGGAGGG - Intergenic
1132111016 15:99102506-99102528 CAGAGGCAAACTCAGAGGGAAGG - Intronic
1133135729 16:3710202-3710224 ATGAGCAAAGCTCAGGGTGAGGG - Intronic
1133908109 16:10039748-10039770 CTGAGCAAATGTGCAAGGGAGGG + Intronic
1134463110 16:14446937-14446959 CAGAGCCCCTCTCAGAGGGAAGG - Exonic
1135551069 16:23398728-23398750 CTCATCAGAACTCAGAGGGATGG + Intronic
1136415671 16:30102011-30102033 CTAAGGAAAGCTCAGAGGGAAGG + Intergenic
1137444775 16:48525029-48525051 GTGAGCATCTCACAGAGGGAGGG - Intergenic
1137501111 16:49012523-49012545 CTGAGGAACTCAAAGAGGGAGGG - Intergenic
1140014777 16:71171213-71171235 CCGTGCAAATATCTGAGGGAAGG - Intronic
1140121931 16:72091371-72091393 ATGAGCAAAGGTCAGAGGGAGGG - Intronic
1140566623 16:76049686-76049708 CTAAGCAGACTTCAGAGGGAAGG - Intergenic
1141270298 16:82533656-82533678 CTGAAAAAAACTCAGTGGGAAGG - Intergenic
1141984549 16:87571320-87571342 CTGAGCAAATAAAGGAGGGAAGG - Intergenic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1144300101 17:13915442-13915464 GTGAGCAGATCTCAGAAAGAGGG - Intergenic
1144728702 17:17514643-17514665 CTGAGCCAATCCCAGAGGCTCGG - Intronic
1145037941 17:19554213-19554235 CTGAGCAGATCTGTGAGTGAGGG + Intronic
1145376349 17:22352317-22352339 ATGAGCATATCTCAAGGGGAAGG - Intergenic
1146697093 17:34917721-34917743 TTGAGAAAGTCTCAGAAGGAAGG + Intergenic
1148825763 17:50392745-50392767 CTGAGCAAAGCTGACAGGCAAGG + Exonic
1152125875 17:78446338-78446360 ATGAGCAGCTCTCAGAGGCAAGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152939044 17:83156302-83156324 CTGAGCAAAACTCAAAGGAAAGG + Intergenic
1153969772 18:10215637-10215659 CTGGGCAAAGCTCAGAGAGGAGG - Intergenic
1157979595 18:52365580-52365602 CTGAGCAAAGCTGAGAGGGGAGG + Intronic
1158261128 18:55606970-55606992 GTCTGCACATCTCAGAGGGAAGG + Intronic
1158324272 18:56297357-56297379 CTGAGCAAATCTGTGAGGTAGGG - Intergenic
1161219066 19:3109642-3109664 CTGAGCAAAGCTCTGGGGAAGGG + Intronic
1162804385 19:13129451-13129473 TTGGGCCAATCACAGAGGGATGG + Intronic
1163221105 19:15921902-15921924 CGGTGCAAATCTCAGAGGCAGGG - Intronic
1165722938 19:38092631-38092653 CTGAGCAAATGTCTGTGGAATGG - Intronic
1165942826 19:39423775-39423797 CTGGGCACATGTCAGTGGGAAGG - Exonic
1166315587 19:41987842-41987864 CTGTGAAAAGCTTAGAGGGATGG + Intronic
1168048292 19:53809851-53809873 CAAAGCAAAGCTCAGAGCGACGG - Exonic
927303188 2:21539524-21539546 AACAGCAACTCTCAGAGGGAGGG - Intergenic
928164348 2:28958921-28958943 CTCAGCCAATCCCAGAGGGCTGG - Intronic
929608759 2:43254082-43254104 CTGAACTAATCTCAGAGGCCAGG + Intronic
930002653 2:46871413-46871435 CTGAGGATATCTCAAAGGGAAGG + Intergenic
930049694 2:47205494-47205516 CTCAGCAAAGCTCAAAGGGTGGG + Intergenic
931046929 2:58364383-58364405 CTGGGCAAAGCTCAGAGAGGAGG + Intergenic
932624896 2:73289712-73289734 GTGAGCATATCTTAGAGTGAAGG + Intergenic
934716563 2:96548085-96548107 CTGTGCAGACCTCAGAAGGAAGG - Intronic
937769084 2:125697434-125697456 CAGAGCAAAGCTCTGAGGAATGG - Intergenic
937973910 2:127569676-127569698 CTGAGCCAGTCTGACAGGGATGG - Intronic
938600930 2:132838234-132838256 TTGAGCAAATAGCAAAGGGAAGG - Intronic
943330679 2:186555318-186555340 CTGAGCATATCTCACATAGATGG + Intergenic
943335233 2:186605388-186605410 CTGAGCAATTCTCAAAATGATGG - Intronic
943496646 2:188629160-188629182 CTGGGAAAATCTGAGAGGGAAGG + Intergenic
945246756 2:207724853-207724875 CTGAGCAAATCTCAAACGGATGG + Exonic
945758034 2:213874766-213874788 TTGGCCAAAGCTCAGAGGGAGGG + Intronic
946679044 2:222194264-222194286 CAGAGGAAACCTCAAAGGGAGGG - Intergenic
948167941 2:235877746-235877768 CTGAGCAAATTTGAGATGCAAGG - Intronic
948911926 2:241009222-241009244 CTGTCCACACCTCAGAGGGAGGG - Intronic
1168973163 20:1944878-1944900 CCCAGCAAATATTAGAGGGATGG + Intergenic
1169471083 20:5886124-5886146 ATGACCACATCACAGAGGGAAGG + Intergenic
1170182806 20:13552003-13552025 ATGAGCAAAACTCAGATTGAAGG + Intronic
1170591753 20:17776794-17776816 ATGAACAAGTCTTAGAGGGAGGG + Intergenic
1170897473 20:20428796-20428818 CTTAGTAAATATCAGATGGAAGG - Intronic
1171070480 20:22063250-22063272 ATGTGCAAATCTCCGAGGAATGG + Intergenic
1172592406 20:36127131-36127153 CTGAGCTCATCTCAGATGGGAGG - Intronic
1172694648 20:36814009-36814031 CTGACCAGAGGTCAGAGGGATGG - Intronic
1173935724 20:46861595-46861617 TTTAGCAAATCTCAGAAGTATGG + Intergenic
1174177015 20:48651607-48651629 CTGAGCAGAGATCAGAGGGAGGG + Intronic
1175224768 20:57438772-57438794 AGGAGCAAATCCCAGAGAGATGG - Intergenic
1175571252 20:60024369-60024391 GTGAGCAAATCCCAGTGGGCAGG - Intronic
1176243185 20:64084361-64084383 CTGGGCAAAGCTCAGAGGCTGGG - Intronic
1178094031 21:29194897-29194919 ATGAGCAAATCTCAAAGACATGG + Intronic
1178117297 21:29430396-29430418 ATGAGCTATACTCAGAGGGAGGG + Intronic
1178383252 21:32129148-32129170 CTCAGCCAACCTCAGATGGATGG + Intergenic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1179882021 21:44296846-44296868 GCAAGCAAATCTTAGAGGGACGG - Intronic
1180035837 21:45248728-45248750 CTTGGGAAATCTGAGAGGGAGGG + Intergenic
1183252849 22:36742699-36742721 CTGAGCACATCTAAGCGGGAGGG + Intergenic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1185228494 22:49667489-49667511 CTGGGCTGCTCTCAGAGGGATGG - Intergenic
949603667 3:5631072-5631094 CTGAGAAATTATCAGATGGAGGG + Intergenic
951448429 3:22809481-22809503 ATGAGTACATTTCAGAGGGATGG + Intergenic
951701452 3:25501359-25501381 GTGAGCAAATCACAGAGATAAGG - Intronic
952114564 3:30163179-30163201 CTGACCAAATTTCACAGAGATGG - Intergenic
952836008 3:37602798-37602820 CTTAGCAAAAATCAGAGGAATGG - Intronic
953478080 3:43222895-43222917 CTGAGCAAAACACACATGGAGGG + Intergenic
956371656 3:68570370-68570392 CTTAGCAGATTTCAGAGGGAAGG + Intergenic
957040046 3:75329537-75329559 GAGAGCAAATCCCTGAGGGAGGG + Intergenic
957887885 3:86314048-86314070 CTGAGTAAAACTGAGAGAGAAGG - Intergenic
959635919 3:108569824-108569846 CTGTGAGAACCTCAGAGGGAAGG + Intronic
962196168 3:133365514-133365536 CTAAGCAAATCTCAGAGGCAAGG + Intronic
962829594 3:139128443-139128465 CTGATGAAATCTCCAAGGGATGG + Intronic
964307283 3:155355293-155355315 CCGAGCAGATCTCTGAGGGTAGG - Intergenic
964479107 3:157124335-157124357 CTGTGGCACTCTCAGAGGGAGGG + Intergenic
964993649 3:162846390-162846412 CTGTGGAAATAACAGAGGGATGG - Intergenic
965282511 3:166771517-166771539 CTGCTCAAATCTCTGAGGGGAGG - Intergenic
968251727 3:197222778-197222800 GTGAGAGAATCCCAGAGGGAAGG - Intronic
969128125 4:4969159-4969181 CTGAGAAGAACTCAGAGGGAAGG - Intergenic
969313430 4:6367515-6367537 CTAAGCAAGTCTCAGTGGGGTGG - Intronic
971691261 4:29839757-29839779 CTCAGCTAATCTCAAAAGGAAGG + Intergenic
972148067 4:36053777-36053799 CTAATCAAATCCCAGAGGGCCGG + Intronic
976260884 4:83143780-83143802 GTGACCAAATGTCAGAGGGTGGG - Intergenic
981395436 4:144242611-144242633 CTCAGCAAATTTGAAAGGGAAGG - Intergenic
981645355 4:146992078-146992100 CTGAGCCATCTTCAGAGGGAAGG - Intergenic
982454642 4:155594331-155594353 CTGAGAAGAGATCAGAGGGATGG - Intergenic
982759725 4:159266912-159266934 TTAAGCAAGTCTCAGAGGGATGG - Intronic
985589387 5:756827-756849 CTGAGCAAGTCTCGGGGAGAGGG - Intronic
987109502 5:14672168-14672190 CTGAGCAAATCACAGATGTATGG + Intronic
987133396 5:14879874-14879896 CAGAGCAACTCCCTGAGGGAGGG + Intergenic
988431440 5:31123542-31123564 CTCTGGAACTCTCAGAGGGAAGG + Intergenic
988689406 5:33557432-33557454 ATTAGCGAAGCTCAGAGGGAAGG + Intronic
988807615 5:34754945-34754967 ATGATCAAATCTCAGAGGACAGG - Intronic
990980194 5:61595555-61595577 CTCAGCAAATTACAGAAGGATGG + Intergenic
991028190 5:62052874-62052896 CTGAACAGGTCTCAGAAGGAAGG - Intergenic
993411327 5:87576727-87576749 ATTAGCAATTTTCAGAGGGAAGG - Intergenic
994765088 5:103905394-103905416 CTCAGCAAATCACACAGGAATGG + Intergenic
995002553 5:107152192-107152214 CTGAGCAAACCTCAGATGTATGG + Intergenic
995576342 5:113539474-113539496 CACAGCATATCTCATAGGGAAGG + Intronic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
996894570 5:128464784-128464806 CTGGACACATCTCACAGGGATGG + Exonic
997093118 5:130879487-130879509 CTGATCACATCTTAGATGGATGG - Intergenic
1000163978 5:158629291-158629313 CAGAGCACATGTCAGTGGGAGGG - Intergenic
1000388179 5:160695370-160695392 GTGAGCACATTACAGAGGGATGG + Intronic
1000762243 5:165240758-165240780 CTGAAGAAATATCAAAGGGAAGG + Intergenic
1001061379 5:168492503-168492525 CTTAGCAAATCCCAGATTGAGGG + Intronic
1002334487 5:178468550-178468572 CTGAGGTCAGCTCAGAGGGACGG - Intronic
1003017869 6:2482504-2482526 CTGAGAATATCACAGAGAGATGG + Intergenic
1003680046 6:8244006-8244028 CTGAGCAACTGACATAGGGAAGG + Intergenic
1003778842 6:9399385-9399407 CAGACCAAATCTCAGAGGATGGG + Intergenic
1004380743 6:15130096-15130118 GTGAGCAAATGTCAGAGTGCCGG - Intergenic
1004498667 6:16189224-16189246 TTGATCAAATCTCTGAGGGCAGG - Intergenic
1005279737 6:24260624-24260646 CTGAGCAAGCCTCAGACAGAAGG - Intronic
1006047794 6:31312409-31312431 CTGAACACAGCTCAGAGAGACGG - Intronic
1006652643 6:35564320-35564342 CCAAGAAAAGCTCAGAGGGAAGG - Intergenic
1006831056 6:36968631-36968653 CTCAGCAAATCTGCGAGGTATGG + Exonic
1006884536 6:37369924-37369946 CTAAGCAAATGACTGAGGGATGG - Intronic
1009915389 6:69988958-69988980 CTGTGCAAAGCCCAGAAGGATGG - Intronic
1017182744 6:151569502-151569524 CAGAGGAAATCACAGAGGGCAGG - Intronic
1018412638 6:163568106-163568128 ATGAGCACGTCTCATAGGGATGG + Intronic
1022473180 7:30694224-30694246 CAGAGCAAAGTTCAGAGAGAAGG - Intronic
1024788579 7:52936118-52936140 CAGAGCAGATCTCAGAGAGAAGG - Intergenic
1026391780 7:69910267-69910289 ATGAGCAATACTCAGAGAGAAGG - Intronic
1026434553 7:70384180-70384202 CTGAGCAAATGGCAGAGCCATGG - Intronic
1028420144 7:90623708-90623730 CTAATCAAACCTCTGAGGGATGG - Intronic
1032564608 7:132928803-132928825 CTGAGCAAATTTAAAAGGGAGGG - Intronic
1032718993 7:134535519-134535541 AGGAGCAAAGCTCAGAGGCAGGG - Intronic
1032723963 7:134574282-134574304 AGGAGCAAAGCTCAGAGGCAGGG - Intronic
1032741466 7:134743448-134743470 CTGAGCAAATCTAAGGGGGGTGG + Intergenic
1033786040 7:144731773-144731795 CTGAGCCAATCTCAGTGGCCAGG + Intronic
1034903165 7:154920510-154920532 CTTAGCCAATCCCAGAAGGAGGG + Intergenic
1035367475 7:158358333-158358355 CTCAGCCATTCTCAGAAGGATGG + Intronic
1036208739 8:6825066-6825088 CAGAGGAAATCTCGAAGGGAGGG + Intronic
1036656012 8:10677974-10677996 CTGAGCAGATTTCAGGAGGAAGG - Intronic
1036691546 8:10947786-10947808 CTGAGCAAAGCCCAGAGCAAAGG - Intronic
1037987796 8:23300403-23300425 CTGTGCAGAGCTCAGAGGCAGGG - Intronic
1038908236 8:31931802-31931824 CTGAGCAAATGGCAGAAGCAAGG - Intronic
1040987506 8:53312503-53312525 CTTAGAAAATAGCAGAGGGATGG - Intergenic
1041192954 8:55372007-55372029 CTCACCACACCTCAGAGGGAAGG - Intronic
1042831674 8:73036127-73036149 CTGAGGAAAACTCAGAGCCAAGG + Intronic
1046922901 8:119752449-119752471 GTGACCATATCCCAGAGGGAAGG - Intronic
1048829690 8:138464216-138464238 CTGAGCAAATGTCAGCCCGATGG + Intronic
1049083573 8:140460617-140460639 CTCAGCAAATCTGTGGGGGAAGG + Intergenic
1049815916 8:144599964-144599986 CAGAGCAACTCTCTGTGGGAGGG + Intronic
1050016370 9:1238334-1238356 CAGAGCAAATCTCATAGACAGGG - Intergenic
1051448479 9:17167908-17167930 CTGAGGAAAACTCACAGAGAGGG + Intronic
1052064757 9:24004460-24004482 CTGATCAAACCTCAGATGGTTGG - Intergenic
1052943003 9:34145265-34145287 CTCAGCTAAACTCAGGGGGAGGG - Intergenic
1055110280 9:72552394-72552416 CTGTGGAAAACTAAGAGGGAGGG + Intronic
1057342211 9:94212938-94212960 CAGAGCCAGTCCCAGAGGGATGG - Intergenic
1057705169 9:97390607-97390629 GTGAGCAACACTCACAGGGAAGG + Intergenic
1057733920 9:97635233-97635255 CTGAGCATAACTAAGATGGAGGG + Intronic
1059744110 9:117183691-117183713 CTGAACATATCTGAGAGGGAAGG - Intronic
1061398959 9:130358066-130358088 CTGAGCAAATCCCAGCAGGCTGG + Intronic
1062067009 9:134533992-134534014 CTGAGACAACCTCACAGGGAGGG - Intergenic
1185945518 X:4371512-4371534 CAGAGCAATTCTAGGAGGGAAGG - Intergenic
1187017393 X:15343648-15343670 CTGAGCAAATCTCAGAAGCTTGG - Intergenic
1187372871 X:18725155-18725177 ATGAGCTCATCTCAGAGGGGTGG - Intronic
1189586206 X:42464557-42464579 CTGACCCACTCTCAGTGGGAAGG + Intergenic
1192139000 X:68631579-68631601 ATGAGGAAATCTCATACGGAGGG - Intergenic
1193794214 X:85853328-85853350 CTGAGCATAGCTCAGAGGATAGG - Intergenic
1194094791 X:89625870-89625892 CTGAGCAAATCTAATAAGAAAGG - Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1197362178 X:125518283-125518305 CAGAACAAATCCCATAGGGAGGG + Intergenic
1199202725 X:145111770-145111792 CTAATCACAGCTCAGAGGGAGGG - Intergenic
1200447427 Y:3282024-3282046 CTGAGCAAATCTAATAAGAAAGG - Intergenic