ID: 1119976599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:79031029-79031051 |
| Sequence | AAAGAAAGGCAGAAAGGGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4042 | |||
| Summary | {0: 1, 1: 3, 2: 42, 3: 542, 4: 3454} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1119976599_1119976605 | -5 | Left | 1119976599 | 14:79031029-79031051 | CCTTCCCCTTTCTGCCTTTCTTT | 0: 1 1: 3 2: 42 3: 542 4: 3454 |
||
| Right | 1119976605 | 14:79031047-79031069 | TCTTTTGAAAATGGCCCATCTGG | 0: 1 1: 0 2: 4 3: 16 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1119976599 | Original CRISPR | AAAGAAAGGCAGAAAGGGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||