ID: 1119976599

View in Genome Browser
Species Human (GRCh38)
Location 14:79031029-79031051
Sequence AAAGAAAGGCAGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4042
Summary {0: 1, 1: 3, 2: 42, 3: 542, 4: 3454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119976599_1119976605 -5 Left 1119976599 14:79031029-79031051 CCTTCCCCTTTCTGCCTTTCTTT 0: 1
1: 3
2: 42
3: 542
4: 3454
Right 1119976605 14:79031047-79031069 TCTTTTGAAAATGGCCCATCTGG 0: 1
1: 0
2: 4
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119976599 Original CRISPR AAAGAAAGGCAGAAAGGGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr