ID: 1119978687

View in Genome Browser
Species Human (GRCh38)
Location 14:79054962-79054984
Sequence ATGTAAATACAGTGGTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119978684_1119978687 17 Left 1119978684 14:79054922-79054944 CCATTTGTGAGCTGCAGGGTTCA 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119978687 Original CRISPR ATGTAAATACAGTGGTAGCT TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
906542707 1:46600150-46600172 ATGTAAACAAAGTGGGAGTTTGG - Intronic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
908655486 1:66383513-66383535 ATGTATGTACAGTGTTAGCAGGG - Intergenic
910361431 1:86416464-86416486 CTGTATATACAGTGTTAGCAAGG + Intergenic
910370880 1:86513863-86513885 ATGGAATTACAGTGTTGGCTGGG + Intergenic
910485802 1:87711979-87712001 AGGTAAATAGAGTGGGAGGTGGG + Intergenic
911257098 1:95645646-95645668 AGGTAATTACAGTGTTGGCTGGG - Intergenic
911438579 1:97896005-97896027 ATGTAATTACAGTGTAAGATTGG - Intronic
916385069 1:164257887-164257909 ATGTAAAGGAAGTGGCAGCTTGG + Intergenic
916948149 1:169750312-169750334 TTGTATATACAGTGGTCTCTGGG - Intronic
917072850 1:171171093-171171115 ATGAGAAAACAGTGGAAGCTTGG - Intergenic
918758510 1:188369999-188370021 CTATAAATACAATGGTAGCCTGG - Intergenic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
921000983 1:211042646-211042668 ATGTAAATTCTGTGGTTGTTGGG - Intronic
923566928 1:235083340-235083362 ATTTAGACACAGTGGCAGCTGGG + Intergenic
924127542 1:240870938-240870960 ATGGAAATACTGTGGAAGGTAGG - Intronic
924853264 1:247852203-247852225 ATGCAAATACAGTTGGATCTGGG + Intergenic
1063066950 10:2619888-2619910 ATGTATATACTGAGGTTGCTAGG - Intergenic
1063763832 10:9114054-9114076 ACCTAAATATAATGGTAGCTGGG + Intergenic
1065195182 10:23257469-23257491 ATGTGACTAGAGTGGGAGCTGGG - Intergenic
1065745301 10:28835492-28835514 ATGTAAATGCTGTGGGTGCTAGG + Intergenic
1067897355 10:50198430-50198452 ATGTAAAAATAGTGGTGCCTTGG - Intronic
1067951616 10:50743590-50743612 ATGTAAAAATAGTGGTGCCTTGG + Intronic
1068935471 10:62631575-62631597 ATGTAAATACAATGGTATTGGGG + Intronic
1070346641 10:75549419-75549441 ATTTAAATACAGTGGTCTGTTGG - Intronic
1070558924 10:77551125-77551147 ATATAAAAATAGTGGTAGCTGGG - Intronic
1072101797 10:92236445-92236467 ATTCAAATACAGTGATTGCTAGG + Intronic
1072303210 10:94082388-94082410 ATGAAAATAGAATGGTTGCTAGG + Intronic
1073994570 10:109300885-109300907 ATGTAACTGAAGTGGTAGCCGGG + Intergenic
1074175124 10:110992037-110992059 AAGTAAATACAGTGATTTCTGGG - Intronic
1076077394 10:127545472-127545494 ATTTAACTATAGTGGGAGCTGGG - Intergenic
1077662704 11:4083766-4083788 AGGTAGATAGAGTGGTAGTTAGG - Intronic
1077845325 11:6016470-6016492 ATGTAACTATAGTGTTAGTTGGG - Intergenic
1079854460 11:25583715-25583737 ATGTAAATAACGTGGTATGTAGG + Intergenic
1082197126 11:49320063-49320085 ATGTAAATAAATTTGTAGTTTGG - Intergenic
1082936434 11:58661527-58661549 ATGTAAATGAAGTGGTGGCCTGG + Intronic
1083244729 11:61417762-61417784 ATGTGACAACAGTAGTAGCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086658696 11:89388057-89388079 ATGTAAATAAATTTGTAGTTTGG + Intronic
1087727791 11:101741904-101741926 TTTTAAATACTGTGTTAGCTGGG - Intronic
1090620545 11:128556927-128556949 CTTTAAATACATTGGTTGCTAGG + Intronic
1091440321 12:507782-507804 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440327 12:507818-507840 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440344 12:507890-507912 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440352 12:507926-507948 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440360 12:507962-507984 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091646023 12:2273055-2273077 ATCTAAATACAGTTGTCCCTTGG + Intronic
1092922299 12:13243422-13243444 ATGTAATTACAGTGCCAGGTAGG - Intergenic
1093655593 12:21690435-21690457 ATGTATATTCAGTTGTTGCTGGG - Intronic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1097234584 12:57530506-57530528 ATGAATACAGAGTGGTAGCTAGG - Exonic
1101894661 12:108746955-108746977 ATGTTAATACAGAGGTAACTGGG + Intergenic
1103391918 12:120580665-120580687 ATGTAAATACAGGATGAGCTAGG - Intronic
1107957070 13:45525365-45525387 ATGAAAATACTGTGGTTGATAGG + Intronic
1108226970 13:48300032-48300054 ATGGAAATAGTGTGGTAGCTTGG + Intergenic
1108527888 13:51301257-51301279 ATGTAAACACTGTGGAATCTGGG - Intergenic
1110497191 13:76182344-76182366 ATGTATATTCTGTGGTGGCTGGG + Intergenic
1110590333 13:77249688-77249710 ATTAAAATTCAGTGTTAGCTGGG - Intronic
1110976463 13:81842015-81842037 AAGTAAATATAGCTGTAGCTGGG + Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1114272035 14:21106630-21106652 AGGCAGATACAGTGGTTGCTGGG - Intergenic
1114692728 14:24600377-24600399 GTGTATCTACAGTGGTGGCTGGG + Intergenic
1114758017 14:25282191-25282213 AGGGAAATACAGTGTTTGCTGGG - Intergenic
1115287882 14:31737374-31737396 ACTTAATTACAGTGGTATCTTGG + Intronic
1119784737 14:77304273-77304295 AGGTAAATGCAGAAGTAGCTGGG - Intronic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1125234310 15:37494583-37494605 ATGTAAATAAAGGGATATCTTGG + Intergenic
1126083235 15:44986223-44986245 ATAGAAATACAGTGGTCTCTTGG - Intergenic
1126450043 15:48797330-48797352 ATTTAATTACATTGGTTGCTTGG + Exonic
1128407782 15:67360789-67360811 ATGTAAATACAGCTCTATCTAGG - Intronic
1128879398 15:71229330-71229352 ATTTAAATACAGTTGTCCCTTGG + Intronic
1130627565 15:85531236-85531258 ATCTAAATACAGTGCAATCTGGG - Intronic
1132693893 16:1193706-1193728 ATGTAATTACATTGGTGGCCTGG + Intronic
1133539800 16:6738757-6738779 ATGTAAAGACAGTGAAATCTTGG + Intronic
1133622665 16:7541581-7541603 ACATGAATACAGTGGTATCTGGG - Intronic
1133802898 16:9098398-9098420 AAGTAAATACATAAGTAGCTAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135039877 16:19110096-19110118 AAATAAAGACAGAGGTAGCTGGG + Intergenic
1138070928 16:53992292-53992314 ATGGAAATAGAGTGGTATATGGG + Intronic
1138272964 16:55709517-55709539 GTGAAAACACAGTGGTAGCTGGG - Intergenic
1139026665 16:62826215-62826237 ATATAAATACAGTTGTCTCTTGG - Intergenic
1141344992 16:83236627-83236649 CTGTTAACATAGTGGTAGCTAGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1150104015 17:62448428-62448450 TTATAAATGCAGTGGTGGCTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151110498 17:71670867-71670889 ATTTAATTACAGTTGTAGTTGGG - Intergenic
1154373821 18:13792034-13792056 ATGGAAATACAGTAGTCCCTTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155608312 18:27633460-27633482 AAGAAAATAAAGTGGTAGATGGG + Intergenic
1158146171 18:54315427-54315449 ATGTATATTCTGTGGTTGCTGGG + Intronic
1158535017 18:58300464-58300486 TTGCAAATGCAGTAGTAGCTGGG + Intronic
1159719328 18:71866791-71866813 ATGTATATTCTGTGGTTGCTGGG + Intergenic
1159906821 18:74100093-74100115 ATGTATATTCTGTGGTTGCTGGG - Intronic
1165410023 19:35653997-35654019 ATCTAAACACGGTGGTAGCCGGG - Intronic
925490988 2:4392532-4392554 ATCCAAATACAGTAGTACCTGGG - Intergenic
928281812 2:29953160-29953182 GAGTAAATACAATGGAAGCTAGG + Intergenic
928959893 2:36913291-36913313 ATGTAGATAGAGAGTTAGCTGGG - Intronic
929327108 2:40628394-40628416 ATTGACATACAGTAGTAGCTCGG + Intergenic
929432711 2:41902003-41902025 AGGAAAATACAGTGATATCTGGG - Intergenic
931930340 2:67126191-67126213 GTGTAAATACAGTAGGAGATTGG + Intergenic
933347241 2:81103878-81103900 ATATTAATACATTGGTAGGTAGG - Intergenic
937900179 2:127013975-127013997 ATGAAATTAAAGTGGTAGGTTGG + Intergenic
938251315 2:129817686-129817708 ATGTTAATACAGTTGTCTCTTGG + Intergenic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
939605365 2:144247984-144248006 TAGAAAATACAGTGGTGGCTGGG - Intronic
943481255 2:188420848-188420870 TTGTATCTAGAGTGGTAGCTCGG + Intronic
945822056 2:214676074-214676096 ATTAAAATACAGTGGGGGCTGGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946895048 2:224315266-224315288 ATGTAATTACTGTTGTAGTTGGG + Intergenic
1170695913 20:18658628-18658650 ATGTAAACACACAGGTAACTTGG + Intronic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1178201445 21:30410982-30411004 ATGTATATTCTGTGGTAGATGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184984631 22:48121295-48121317 ATGTAAGTTCTGTGGTAACTGGG + Intergenic
950969800 3:17174885-17174907 ATGTAAAAACAGTTCTGGCTGGG - Intronic
952828605 3:37544732-37544754 ATTTGGATACAGTGGTTGCTTGG + Intronic
955002123 3:54937349-54937371 ATGCAAATACAGTTGTCCCTCGG + Intronic
956058964 3:65330706-65330728 ATGTAAATTCCATGGTCGCTTGG + Intergenic
956723769 3:72140231-72140253 ATGTAGAATCAGTGGGAGCTTGG + Intergenic
957883685 3:86255257-86255279 AGAAAAATAAAGTGGTAGCTTGG - Intergenic
959389215 3:105753060-105753082 ATGTAAGGACAATGCTAGCTGGG + Intronic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
959673228 3:109002983-109003005 ATGTAATTACATTGGTAGAAGGG - Intronic
960319591 3:116218449-116218471 ATGGAAATTCAGTGGTGGCGAGG - Intronic
960952629 3:123009465-123009487 CTTTAAATACAGTGGTGGGTGGG - Intronic
962347542 3:134629422-134629444 ATGCAAAATCAGCGGTAGCTGGG + Intronic
962678949 3:137779109-137779131 ATGGAAAAGCAGTGTTAGCTAGG - Intergenic
964583807 3:158272616-158272638 ATTTAAGTACAGTAGTAACTGGG + Intronic
964951832 3:162304991-162305013 GTATAAATACTGTGGTAGCTGGG - Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
967160454 3:186732950-186732972 ATATAAATACAATAGCAGCTGGG + Intronic
967902494 3:194470233-194470255 ATGTAAATACAGTCTTGGTTTGG - Intronic
970005298 4:11405208-11405230 AAGTAAATGGAGGGGTAGCTGGG - Intronic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
972044162 4:34642200-34642222 ATGTATATTCAGTGGTTGATGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974118353 4:57608242-57608264 ATGTAAATAGAGTGGTGGAGTGG + Intergenic
975188295 4:71429361-71429383 ATGCTAATACTGTGATAGCTGGG + Intronic
979342979 4:119550063-119550085 ATGTACCTACAGTTGTAGCATGG - Intronic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
980952911 4:139399418-139399440 ATGTAAAAACAGTGGCAGATGGG - Intronic
981244639 4:142520630-142520652 ATTTAAATACAATGGTAAATTGG + Intronic
984210601 4:176842545-176842567 ATGTACATACAGTTGTCCCTCGG - Intergenic
984500245 4:180549743-180549765 ATACAAATACAGTGGTCTCTTGG + Intergenic
984540276 4:181029740-181029762 ATTTAAATTCATTGGTAGCTTGG + Intergenic
987448802 5:18055579-18055601 ATGTAAGTACAGTGTTAGTGGGG - Intergenic
987649066 5:20717083-20717105 ATGTATATTCTGTGGTTGCTGGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
988746499 5:34144457-34144479 ATGTATATTCTGTGGTTGCTGGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989219530 5:38941197-38941219 AACTAAATGCAGTGGTAGGTGGG - Exonic
990735754 5:58859943-58859965 ATACAAATAGATTGGTAGCTGGG - Intergenic
991118814 5:62986677-62986699 ATGTATATTCTGTGGTTGCTAGG - Intergenic
992181271 5:74200622-74200644 CTGTACATACAGTGGTGGCGAGG + Intergenic
993118014 5:83740946-83740968 TTTAAAATACTGTGGTAGCTAGG - Intergenic
994512779 5:100726592-100726614 ATGTAACTACAGAGGTATATTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
997275027 5:132578409-132578431 ATGGAAAGACAATGGTAGCTTGG - Intronic
998361219 5:141589619-141589641 ATGTCAAAACAGTGGTTACTTGG + Intronic
998924733 5:147109834-147109856 ATATAAATACAATTTTAGCTGGG + Intergenic
998933414 5:147206575-147206597 ATATCAAGACAGTGGTAGGTTGG - Intergenic
1000466996 5:161591880-161591902 ATGTATATTCTGTGGTAGTTGGG + Intronic
1001095902 5:168775331-168775353 ATGAAAATGCAGTGGTAGGCCGG - Intronic
1001184629 5:169557056-169557078 CTGAAATTACAGTGTTAGCTGGG - Intergenic
1001704368 5:173731091-173731113 ATGTTAGTGCAGTGGTAGCTAGG - Intergenic
1003847652 6:10189992-10190014 ATGTAAAACCTCTGGTAGCTGGG - Intronic
1004440382 6:15644458-15644480 ATGTATATTCTGTGGTAGTTAGG - Intronic
1005544645 6:26852692-26852714 ATGTATATTCTGTGGTTGCTGGG - Intergenic
1007358376 6:41336779-41336801 ATGTAGAGCCAGTGGTATCTGGG + Intronic
1007744656 6:44036166-44036188 ATGTCCATAGAGTGGGAGCTGGG + Intergenic
1009015435 6:57894321-57894343 ATGTATATTCTGTGGTTGCTGGG - Intergenic
1009316840 6:62229948-62229970 ATATAAATAAACTGGGAGCTGGG - Intronic
1009502431 6:64431714-64431736 ATGAAAATGCAGTGGTAGTCAGG - Intronic
1010620848 6:78072213-78072235 TTGAAAATACAGTAGTTGCTAGG - Intergenic
1010639670 6:78308970-78308992 ATGTACATACAGAGGCAGGTAGG - Intergenic
1011459240 6:87586384-87586406 AAGTAAATAGAGTGAGAGCTTGG - Intronic
1011568965 6:88713393-88713415 ATCTAAATACAGTGTCAGATTGG - Intronic
1012635573 6:101535446-101535468 ATGTAAATAAAGTAGAGGCTAGG + Intronic
1013452376 6:110296835-110296857 ATGTACAGACAGTGGTAAATAGG - Intronic
1013941473 6:115668088-115668110 TTATAAATACAGTGATAACTGGG - Intergenic
1014188890 6:118468809-118468831 ATGTGAATAGAGTGGTAGTTAGG - Intronic
1014585303 6:123190812-123190834 ATGTAATTACATTTGTAGATAGG + Intergenic
1014642351 6:123927907-123927929 ATCTACCTACAGTGGTGGCTGGG + Intronic
1015098367 6:129445262-129445284 ATTTAAATACAGTTCTGGCTTGG + Intronic
1016001705 6:139048535-139048557 ATCTAAATACTCTGGCAGCTGGG + Intergenic
1016121287 6:140344737-140344759 AAGTAACTAAAATGGTAGCTTGG + Intergenic
1017060312 6:150477964-150477986 ATGTATATTCAGTGGTTGTTAGG - Intergenic
1020893595 7:13911280-13911302 ATATAAATGGAGTGGCAGCTAGG + Exonic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026544443 7:71309566-71309588 ATGTAAATAAAAGGATAGCTTGG - Intronic
1027541468 7:79472044-79472066 ATTTAATTTTAGTGGTAGCTAGG + Intergenic
1029099683 7:98118609-98118631 ATGAAAATACTGTGGATGCTGGG - Intronic
1029893440 7:103956130-103956152 ATGTAGATAAAGCAGTAGCTAGG - Intronic
1030584817 7:111404317-111404339 TTGTAATTACAGTGACAGCTGGG - Intronic
1031224595 7:119019937-119019959 TTGTAAATATAGTTGTATCTAGG + Intergenic
1032033194 7:128501616-128501638 TTATAAATGCAGTGGTGGCTTGG - Intronic
1034860829 7:154593170-154593192 ATGTAAATACGGTCGTTGGTAGG - Intronic
1036206978 8:6812743-6812765 CTGTCAATACAGTGGTTGATGGG + Intronic
1041306916 8:56471086-56471108 CTGAAAATACAGTGTTAGCCGGG + Intergenic
1042507326 8:69574507-69574529 ATGTGAATACAGCAGTAGCAGGG - Intronic
1044096981 8:88078965-88078987 AGTGAAATACAGTGGCAGCTTGG - Intronic
1044577878 8:93791177-93791199 ATAAAAATACATTTGTAGCTGGG - Intronic
1044949097 8:97418256-97418278 ATAGATATACAGTGGTAGCCCGG + Intergenic
1047651705 8:126929945-126929967 GTGAAACTACAGTGGTAGCAGGG + Intergenic
1047879968 8:129182282-129182304 CTGTGAATACAGTGGTGTCTTGG + Intergenic
1050062337 9:1722639-1722661 ATGTAGATGCAATGGTTGCTGGG + Intergenic
1050577977 9:7018675-7018697 ATGCAAAGACAATGGTACCTTGG - Intronic
1050840921 9:10147927-10147949 ATGTGAATATTGTGGTAGCAAGG + Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1052409077 9:28099571-28099593 AAGTAGATACAGTGGTGGCTTGG - Intronic
1055000126 9:71439548-71439570 ATGTTAATACAGTCTTAGATCGG + Intronic
1056471401 9:86907618-86907640 ATGAAATCACAGTGGCAGCTTGG - Intergenic
1056760809 9:89413391-89413413 ATGTATGCACAGTGGTTGCTGGG - Intronic
1059030827 9:110693915-110693937 ATGTAAATACAGTACTGGCCAGG - Intronic
1059951910 9:119474088-119474110 ATATAAATACACAGATAGCTTGG + Intergenic
1186045102 X:5527282-5527304 ATGTAAAAACAATGGTAGTAAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1187975896 X:24704571-24704593 ATCTAAAAACAATGGTAGTTAGG - Intronic
1188767199 X:34108897-34108919 ATCTCAATACAGTAATAGCTTGG - Intergenic
1192603365 X:72487964-72487986 ATGATAATACAGAGGTAGCCAGG + Intronic
1193226993 X:78995352-78995374 ATGTAATTACATTGGTTGCTTGG - Intergenic
1195632727 X:107076020-107076042 ATATAAATACAATGGGGGCTGGG + Intronic
1195704607 X:107729764-107729786 ATGAAAATACACTGCTGGCTGGG - Intronic
1196037508 X:111162191-111162213 ATGTTAATACAGTGGTAAAATGG - Intronic
1197594216 X:128447984-128448006 ATGTATCTACAGTGTTAGTTTGG + Intergenic
1197650537 X:129058942-129058964 TTGTAAGTACACTGGTATCTGGG - Intergenic
1199133005 X:144216548-144216570 ATGTATATTCTGTGGTTGCTGGG + Intergenic
1201918800 Y:19212250-19212272 GTGTCAATACAATGGTAGGTGGG + Intergenic
1201920260 Y:19226345-19226367 ATGAAAACACAGTGGGAGCCTGG - Intergenic