ID: 1119980574

View in Genome Browser
Species Human (GRCh38)
Location 14:79076384-79076406
Sequence CTCGGTTGCAGCCTTATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119980574_1119980582 10 Left 1119980574 14:79076384-79076406 CCCTCCATAAGGCTGCAACCGAG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1119980582 14:79076417-79076439 GGGCTTCAGTCACCTCAACTTGG 0: 1
1: 0
2: 0
3: 19
4: 146
1119980574_1119980583 11 Left 1119980574 14:79076384-79076406 CCCTCCATAAGGCTGCAACCGAG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1119980583 14:79076418-79076440 GGCTTCAGTCACCTCAACTTGGG 0: 1
1: 0
2: 0
3: 7
4: 128
1119980574_1119980579 -10 Left 1119980574 14:79076384-79076406 CCCTCCATAAGGCTGCAACCGAG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1119980579 14:79076397-79076419 TGCAACCGAGGTGACAGCCAGGG 0: 1
1: 0
2: 1
3: 27
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119980574 Original CRISPR CTCGGTTGCAGCCTTATGGA GGG (reversed) Intronic
903655401 1:24946278-24946300 CTGGGTGGCAGGATTATGGATGG - Intronic
905521585 1:38604625-38604647 CTTGGATGCAGCCATATGCATGG - Intergenic
907826069 1:58017892-58017914 CTGGGCTGCAGCCTCAAGGAGGG - Intronic
912771515 1:112468111-112468133 CTCATTTGCAGCCATAAGGATGG - Intronic
915859611 1:159430204-159430226 CTGGGTACCAGCCTTAAGGAAGG + Intergenic
1074646688 10:115461306-115461328 CTTGGTTCCAGCATTATGTATGG + Intronic
1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG + Intronic
1079410596 11:20183919-20183941 CTCCGTTGCAGCCTTCTTTAAGG - Intergenic
1091547657 12:1513680-1513702 GTCATTTGCAGCCATATGGATGG + Intergenic
1092040888 12:5383183-5383205 CTATCTTGCAGCCTTATGAAAGG + Intergenic
1095461250 12:42446453-42446475 CTCAGTAACAGCCATATGGAAGG + Intronic
1098059373 12:66544012-66544034 CACGGGTACAGCCTTATGGGAGG + Intronic
1099674647 12:85742976-85742998 CTCTGCTGGGGCCTTATGGAAGG - Intergenic
1101530881 12:105572717-105572739 CTCTATTGCAACCTTATAGAGGG - Intergenic
1103965753 12:124638336-124638358 CTCGTTTTCCGGCTTATGGATGG - Intergenic
1107612679 13:42132068-42132090 CTCTGCTGGAGCCTCATGGAGGG + Intronic
1110159348 13:72357184-72357206 CTTGGCTCCACCCTTATGGAAGG - Intergenic
1119980574 14:79076384-79076406 CTCGGTTGCAGCCTTATGGAGGG - Intronic
1123629839 15:22254024-22254046 CTTGACTGCAGCCCTATGGAAGG + Intergenic
1125580587 15:40782761-40782783 CCCGGTGGCTGCCTCATGGATGG - Intronic
1126768608 15:52033344-52033366 CTCGGTGGCAGCCAATTGGATGG - Intronic
1127529518 15:59829900-59829922 CTAGGTTACAGCCTTCTGCAAGG + Intergenic
1129717970 15:77862874-77862896 CCCGGCTGCAGCCTGATGGCAGG - Intergenic
1144695647 17:17302278-17302300 GTCTTTTGCAGCCATATGGATGG + Intergenic
1146471372 17:33127696-33127718 CTCGGTTGCAGGCTGAAGGTAGG - Intronic
1147192609 17:38746846-38746868 CTCTGTTGCAGCTTTTTGGTGGG - Intronic
1149812440 17:59690355-59690377 CTAGGATGCAGCCTGAGGGAGGG - Intronic
1151726884 17:75890599-75890621 CACTGTTGCAGCCTTTTTGAAGG - Exonic
1152094754 17:78266621-78266643 CTGGGTTTCAGGCTCATGGAGGG + Intergenic
1160791216 19:924691-924713 CCCGGTTGCAGTTTTGTGGAGGG + Intergenic
926857614 2:17273800-17273822 CTGTGTTGCAGCCTTATGCTGGG + Intergenic
931920449 2:67009551-67009573 CTCAGTTGCAGTCATAGGGATGG - Intergenic
940535072 2:154930858-154930880 CTCCTTTGCAGCATCATGGATGG - Intergenic
943965991 2:194333352-194333374 CTGGGTTGAAGCCTTAGAGATGG + Intergenic
1170022501 20:11851840-11851862 TTAGGTTGCAGACTTATGAAAGG - Intergenic
1178547831 21:33508108-33508130 GTCGTTTGCAGCAATATGGATGG - Intronic
950492474 3:13314425-13314447 CTCCATTGCAGCCTTATGGCAGG - Intergenic
950658640 3:14452892-14452914 CACGGCTCCAGCCTGATGGAGGG - Intronic
962357532 3:134707825-134707847 CTGGGTTGAAGCCCTATTGAAGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
964858076 3:161169145-161169167 CTAGGTTTCAGTCTTATAGAAGG + Intronic
965698214 3:171431819-171431841 CTGGGTGGCAGCCTTTTGGTGGG - Intronic
972574024 4:40335351-40335373 CACCGCTGCAGCCTTATGGCGGG - Exonic
974362026 4:60893846-60893868 TTCAGTGGCAGCCTTTTGGATGG - Intergenic
982152563 4:152477157-152477179 CTCAGTTGTAGTTTTATGGATGG - Intronic
984626618 4:182014683-182014705 ATAGGTTGCAGCAGTATGGATGG + Intergenic
994309775 5:98255529-98255551 GTAGGTTGCAGCATTATGTATGG + Intergenic
997165899 5:131660001-131660023 CTCGGGTGCCCCATTATGGAGGG + Intronic
1000612477 5:163389282-163389304 CTCATTTGCAGCCACATGGATGG - Intergenic
1006558514 6:34889355-34889377 CTCGGCTGCAGCCTCGGGGAGGG + Exonic
1019777773 7:2922742-2922764 CTCGGATGCAGCCTTCTAGCTGG + Exonic
1044143449 8:88683775-88683797 CTCATTTGCAGCATCATGGATGG - Intergenic
1045014162 8:97984586-97984608 CTGGGAAGAAGCCTTATGGAGGG + Intronic
1050482052 9:6097500-6097522 CTCAGATGCAGCCATATTGAGGG + Intergenic
1053155974 9:35779600-35779622 TTCAGTGGCAGCCTTTTGGATGG - Intergenic
1189072129 X:37874961-37874983 CTGGGATGCAGTCTTATGGCGGG + Intronic
1194528265 X:95008126-95008148 CTCTGCTTCAGTCTTATGGATGG + Intergenic
1198706542 X:139454986-139455008 CTCTGTTGCAGGCTGCTGGATGG + Intergenic
1202119788 Y:21510371-21510393 CTCTGTTGGAGCCTCAAGGAGGG - Intergenic
1202122239 Y:21533912-21533934 CTCTGTTGGAGCCTCAAGGAGGG - Intronic
1202156766 Y:21895471-21895493 CTCTGTTGGAGCCTCAAGGAGGG + Intronic
1202159214 Y:21919012-21919034 CTCTGTTGGAGCCTCAAGGAGGG + Intergenic
1202185663 Y:22183927-22183949 CTCTGTTGGAGCCTCAAGGAGGG + Intergenic
1202205697 Y:22402469-22402491 CTCTGTTGGAGCCTCAAGGAGGG - Intronic
1202364143 Y:24144158-24144180 CTTGCTTGCAGTCTTATGAATGG + Intergenic
1202506637 Y:25525964-25525986 CTTGCTTGCAGTCTTATGAATGG - Intergenic