ID: 1119981774

View in Genome Browser
Species Human (GRCh38)
Location 14:79089757-79089779
Sequence GTGCAGAAGAAGAAAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119981774_1119981777 27 Left 1119981774 14:79089757-79089779 CCAAGATCTTTCTTCTTCTGCAC 0: 1
1: 0
2: 3
3: 33
4: 358
Right 1119981777 14:79089807-79089829 AAGAAACACAGAAAATTCCATGG 0: 1
1: 1
2: 11
3: 99
4: 1022
1119981774_1119981776 -2 Left 1119981774 14:79089757-79089779 CCAAGATCTTTCTTCTTCTGCAC 0: 1
1: 0
2: 3
3: 33
4: 358
Right 1119981776 14:79089778-79089800 ACATTTTTGGCATCATTCAGTGG 0: 1
1: 0
2: 1
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119981774 Original CRISPR GTGCAGAAGAAGAAAGATCT TGG (reversed) Intronic