ID: 1119981774

View in Genome Browser
Species Human (GRCh38)
Location 14:79089757-79089779
Sequence GTGCAGAAGAAGAAAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119981774_1119981776 -2 Left 1119981774 14:79089757-79089779 CCAAGATCTTTCTTCTTCTGCAC 0: 1
1: 0
2: 3
3: 33
4: 358
Right 1119981776 14:79089778-79089800 ACATTTTTGGCATCATTCAGTGG 0: 1
1: 0
2: 1
3: 24
4: 235
1119981774_1119981777 27 Left 1119981774 14:79089757-79089779 CCAAGATCTTTCTTCTTCTGCAC 0: 1
1: 0
2: 3
3: 33
4: 358
Right 1119981777 14:79089807-79089829 AAGAAACACAGAAAATTCCATGG 0: 1
1: 1
2: 11
3: 99
4: 1022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119981774 Original CRISPR GTGCAGAAGAAGAAAGATCT TGG (reversed) Intronic
900509282 1:3050919-3050941 GGGCACAAGAACAGAGATCTGGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900832624 1:4976077-4976099 GTCCAGAAGTAGACAGAACTGGG + Intergenic
901032689 1:6317041-6317063 GTGGAGAAGAAAACAGAACTTGG + Intronic
901371294 1:8800139-8800161 TGGGAGAAGAAGAAATATCTTGG - Intronic
903396136 1:23003120-23003142 GAGAAAAAGAAGAAAGATTTGGG + Intergenic
904009483 1:27381717-27381739 GTGCAGGGGAAGACAGCTCTGGG - Intronic
904420277 1:30386686-30386708 GTGCAGAACAAGGAAGATGGGGG + Intergenic
904739582 1:32662931-32662953 GTGCAGTAGTAGCACGATCTCGG - Intronic
904810294 1:33159389-33159411 GTGCAGGAGAGAAAGGATCTGGG - Intronic
904993090 1:34609716-34609738 GTCCAGAAGAATATTGATCTTGG - Intergenic
905698254 1:39991977-39991999 TGGCAGAAGAAGAATTATCTTGG + Intergenic
905822085 1:41000776-41000798 GTGCAGAAAGAGAGAGATTTGGG + Intronic
906084974 1:43124420-43124442 CTTCAGAAGGAGACAGATCTAGG + Intergenic
906141881 1:43538678-43538700 GAGAAGCAGAAGAAAGATCCTGG - Intronic
907517527 1:55002027-55002049 ATCCAGAAGAAGGAAGGTCTGGG + Intronic
907593426 1:55697710-55697732 GTGCAGAAGAATAATGATCTTGG - Intergenic
907671623 1:56479028-56479050 GTGCAGAAGAGAAGAGCTCTGGG - Intergenic
909342999 1:74552359-74552381 GTGCAGGGGCAGCAAGATCTCGG - Intergenic
909507883 1:76415109-76415131 TAGCAGAAAAAGAAAGATCATGG - Intronic
909609232 1:77535559-77535581 GTGCAGAAGAAGACAGACAGTGG + Intronic
910092591 1:83482844-83482866 GAACAGAAAAAGAAAGAGCTGGG + Intergenic
910818663 1:91321089-91321111 GTGCTGAAGAGGGAAGACCTAGG + Intronic
910836264 1:91515616-91515638 AAACAGAAGAAGAAAAATCTAGG + Intronic
911564168 1:99442802-99442824 GAGCATAAGAAGAAAGCTATAGG - Intergenic
911646639 1:100344025-100344047 GAGAAGAGGAAGAAAGATCTTGG - Intergenic
913155335 1:116091944-116091966 TCCCAGAAGCAGAAAGATCTGGG + Intergenic
913310483 1:117486020-117486042 GTGCTTAAGAATAAAGTTCTGGG - Intronic
914679038 1:149926217-149926239 GTGGTGAAGAAGAAAGTTGTTGG - Intronic
915726659 1:158022908-158022930 GTGCAAATGAAGAGAGACCTGGG + Intronic
916376356 1:164157824-164157846 AGGCAGAAGAAGAAAGATCAGGG + Intergenic
916471037 1:165122671-165122693 GTGCAGAAGATGAAAATTGTTGG + Intergenic
920427443 1:205889414-205889436 GAGCTAAAGAAGAAAGATTTGGG + Intergenic
921924028 1:220697074-220697096 GTGCAGCAGAACAGTGATCTTGG + Exonic
923335111 1:232961695-232961717 ATGCAGAAGAAGAAATATATAGG - Intronic
924028494 1:239863692-239863714 GTGCAGAAAAAGAAAGAAGGTGG + Intronic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1062883886 10:1001376-1001398 GTGAAGGAGAAGGAGGATCTTGG + Intronic
1063026662 10:2185688-2185710 GTGCAGCATAAGAAATATCTTGG - Intergenic
1063795723 10:9512215-9512237 GTCTAGAAGAAGACAGATGTTGG + Intergenic
1063825174 10:9889050-9889072 GTGTGGAAGAATAAATATCTTGG - Intergenic
1065751022 10:28887377-28887399 ATGCATAAAAACAAAGATCTGGG - Intergenic
1065852512 10:29802600-29802622 GTGGAAAAGAAGAAAAACCTGGG - Intergenic
1066054240 10:31665656-31665678 TTGCAGAAGAAAAAGGATTTGGG + Intergenic
1066661968 10:37745648-37745670 CTGCAGAAGAAAAAAGATTATGG + Intergenic
1067269652 10:44779392-44779414 ATGCAGGAGAAGAAAGATTCAGG - Intergenic
1068419949 10:56778655-56778677 ATGAAGAAAAAGAGAGATCTGGG + Intergenic
1068602719 10:58972646-58972668 GTACATAATAAGAAAGATCCTGG + Intergenic
1069759461 10:70798632-70798654 GTTCAGAAGAAAAATGATTTGGG - Intergenic
1071866459 10:89739561-89739583 GTGCAGAAAAAGAAAGAAATTGG - Intronic
1074050897 10:109880572-109880594 ATGCTGATGAAGAAAGATTTTGG - Intronic
1074249131 10:111726222-111726244 GTTCAGAATCAGACAGATCTGGG + Intergenic
1074930172 10:118117008-118117030 GTTCAGAAGAAGAAAGCTATGGG + Intergenic
1074937929 10:118204572-118204594 TTGCAGGAGCAGAAAGATCTAGG - Intergenic
1075602406 10:123779828-123779850 TTGAAGAAGAAAAAGGATCTAGG - Intronic
1078870065 11:15335209-15335231 GTGGAGAAGAGGAAAGATATTGG + Intergenic
1079161872 11:18002517-18002539 GTGCAAAAGAAGAACATTCTAGG - Intronic
1079835766 11:25330200-25330222 GTGAAGAAGAAAATAGATTTAGG + Intergenic
1080032924 11:27680976-27680998 GTCCAGAAGATGAAAGATTAAGG + Intronic
1080129883 11:28781593-28781615 GCTCAGAAGAAAAAAGATGTGGG - Intergenic
1081018293 11:37909491-37909513 GTGCAATAGTAGAAAGAACTGGG + Intergenic
1085585863 11:77705132-77705154 GTGTAGAGGAAGGAAGAACTAGG + Intronic
1086383168 11:86280327-86280349 GTGCAGATAATGAAAGATCCAGG + Intergenic
1087664703 11:101030877-101030899 ATTCAGAAGAAGGAAGATGTAGG + Exonic
1088372365 11:109106064-109106086 GTACATCAGAGGAAAGATCTAGG + Intergenic
1088407718 11:109499556-109499578 GTGCAGAAGAAGATGGATCTTGG - Intergenic
1089315222 11:117586874-117586896 GTGCAGAGCAAGCCAGATCTAGG - Intronic
1089528084 11:119109803-119109825 GAGAAGAAGAAGGAAGCTCTTGG + Intronic
1089906312 11:122043431-122043453 GAGGAGAAGTAGAAAGATCCAGG + Intergenic
1090170296 11:124596267-124596289 GTGCAGCAGAAGGAAGTTCCAGG - Intergenic
1091001356 11:131912416-131912438 GAGGAGAAGAAGAAGAATCTTGG + Intronic
1092243357 12:6849235-6849257 GTTCAGAAGAGGGAAGATCTGGG + Intronic
1092322314 12:7489227-7489249 ATGCAGAAGAAGAAATATGCTGG - Intronic
1094309705 12:29066073-29066095 AGGCAGAAGAAGAAAAATGTTGG + Intergenic
1094638954 12:32254578-32254600 GAACAGAGGAGGAAAGATCTTGG - Intronic
1095584157 12:43832522-43832544 GTGGTGAAGAAGGAAGATCTGGG + Intergenic
1096738716 12:53676469-53676491 ATGCAGCAGGAGGAAGATCTTGG + Intronic
1096830165 12:54307511-54307533 GTGGAGTAGACGAGAGATCTGGG + Intronic
1097464698 12:59907951-59907973 GTCCAGAAGAAGAAAAGTCCTGG - Intergenic
1098770421 12:74545578-74545600 GTGCGTTAGAAGAAAGACCTGGG - Intergenic
1099679530 12:85807202-85807224 GAGCAGAAGTATAAGGATCTAGG + Intronic
1100814162 12:98369533-98369555 GTGCTTCAGAAGAAAGGTCTTGG - Intergenic
1100891007 12:99125787-99125809 GTGGATAAGAAGAAGAATCTGGG + Intronic
1101298314 12:103450279-103450301 GTGCAGAAAAGGAAAGTTATAGG - Intronic
1105438515 13:20397117-20397139 GTGGACATGCAGAAAGATCTTGG + Intergenic
1106650496 13:31685149-31685171 ATTCAGAATAAGAAAGGTCTGGG - Intergenic
1107113384 13:36721790-36721812 ATACAGAAGAAGGAAAATCTGGG - Intergenic
1107929095 13:45291758-45291780 GTGCAGCAGTAGAAATATATGGG + Intergenic
1107963399 13:45578352-45578374 TTGCAGGAGGAGAAAGAGCTTGG - Intronic
1110621544 13:77601355-77601377 GGGAAGAAGAAAAAAGAACTAGG - Intronic
1111172483 13:84545773-84545795 GGGTAGAAGAAGAGAGATATTGG + Intergenic
1111899927 13:94188277-94188299 GTGCAGAAGGGGAAAGTGCTTGG - Intronic
1112779094 13:102878461-102878483 GCGCAAAAGAAGAAACATCAGGG - Intergenic
1112946087 13:104928803-104928825 GAGCAGAAAAAGAAAGTTCCAGG + Intergenic
1114080686 14:19199835-19199857 GTCCACCAGGAGAAAGATCTCGG + Intergenic
1114441670 14:22753113-22753135 GTGGAGAAAATGAAAGATTTTGG - Intergenic
1115640425 14:35332331-35332353 GGGCAGAAGAGGGATGATCTGGG + Intergenic
1115641810 14:35340073-35340095 CTGCAGAAGAACAAACCTCTAGG + Intergenic
1116395750 14:44447002-44447024 GTGCAAAATAAATAAGATCTAGG - Intergenic
1117239866 14:53819383-53819405 TTGCTGAAGAATAAAGAGCTGGG - Intergenic
1117648109 14:57873779-57873801 ATGCTGGAGAATAAAGATCTGGG - Intronic
1119981774 14:79089757-79089779 GTGCAGAAGAAGAAAGATCTTGG - Intronic
1120583481 14:86282554-86282576 GTGAAGAAGGAGCAAGAGCTTGG + Intergenic
1120914509 14:89698986-89699008 GAGCAAAAGTAGAGAGATCTGGG + Intergenic
1122171633 14:99880710-99880732 CTGCAGTAAAAGAAAGATCTGGG + Intronic
1122572844 14:102719228-102719250 AAGAAGAAGAAGAAATATCTAGG - Intronic
1125296442 15:38208416-38208438 GTGTGGAAGAAGCAACATCTGGG + Intergenic
1126361516 15:47851315-47851337 GAGCAGAAGAAGACAGATGAAGG + Intergenic
1127958479 15:63873138-63873160 GTGCAGAAGAAGGATTATATAGG - Intergenic
1130032993 15:80332817-80332839 ATGGAGCAGAAGCAAGATCTAGG - Intergenic
1130602279 15:85284340-85284362 GTCCAGTAGAGGACAGATCTGGG + Intergenic
1130622398 15:85477323-85477345 TTGGGGAAGAAGAATGATCTGGG + Intronic
1130766729 15:86878655-86878677 GTCCAGTAGAGGACAGATCTGGG - Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133894946 16:9917826-9917848 GTGCAGAAGGAGCAATCTCTAGG - Intronic
1134370069 16:13615082-13615104 TTGCAGAAAAAGAAAAACCTGGG - Intergenic
1134810081 16:17160095-17160117 GGGCAGAAACAGAAAGATCTGGG + Intronic
1134810445 16:17162615-17162637 GTGCAGAAGAAAAAAAATACAGG + Intronic
1135849532 16:25950648-25950670 CTGAAGAAGGATAAAGATCTAGG + Intronic
1135866043 16:26102965-26102987 GTGCAGAAGTGGAAAGAACATGG + Intronic
1136514500 16:30759810-30759832 CTTCAGAAGCAGACAGATCTGGG + Exonic
1137030800 16:35522429-35522451 GTGCAGAAGCAAAAACATATTGG + Intergenic
1138181485 16:54943258-54943280 GTACAGATGAAGAAAAAGCTTGG + Intergenic
1139142371 16:64282218-64282240 GTGCAGAAAAATAAAGAAATTGG + Intergenic
1140233419 16:73137245-73137267 GTGCAGAAAAAGAAAGGGGTAGG - Intronic
1140437540 16:74959890-74959912 ATGCAGAAGAGAAAAAATCTTGG + Intronic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1141657547 16:85424092-85424114 GTTCAGAAGAAGAGTGTTCTGGG + Intergenic
1141916212 16:87098964-87098986 TTCCAGAAGAAGACAGACCTGGG + Intronic
1143295059 17:5864849-5864871 GGGCAGGAGAAGAAAGATCAAGG - Intronic
1143615142 17:8045215-8045237 CTGCAGAAGAAAGGAGATCTGGG - Intronic
1143714081 17:8754721-8754743 GTGCAGAAGCTGGAAGATCAGGG + Intronic
1143897561 17:10148258-10148280 ATGCAGGTGAAGAAAGGTCTAGG - Intronic
1144544220 17:16177612-16177634 GGGCAAAGGAAGAAAAATCTTGG + Intronic
1149251388 17:54774009-54774031 CTGCAGTAGATGAAAGATCAGGG - Intergenic
1149385822 17:56142490-56142512 GTGCAGATGATTAAAGTTCTTGG - Intronic
1149426988 17:56564778-56564800 GTGCAGAAGACAGACGATCTTGG + Intergenic
1152272557 17:79333620-79333642 GTGCAGGAGAGGAAAGTCCTGGG + Intronic
1153888181 18:9486341-9486363 GTGCAGTAGTAGCACGATCTTGG + Intronic
1154476405 18:14763920-14763942 GGCCAGCAAAAGAAAGATCTAGG + Exonic
1156239020 18:35233498-35233520 GGTCAGAAGAAGGAAGATGTTGG + Intergenic
1156251673 18:35358096-35358118 GTGAAGAAGAAAATAGATTTTGG + Intergenic
1156634488 18:39011127-39011149 ATGCAGAAGAGGAAGGATCAAGG - Intergenic
1156637151 18:39045376-39045398 CTGGAGAAGAACCAAGATCTTGG - Intergenic
1156903753 18:42330828-42330850 GTGGAGAAGAAAAAACATTTTGG + Intergenic
1157167246 18:45369268-45369290 GTGCATAGGTAGAAAGATATGGG - Intronic
1158281181 18:55829729-55829751 GTTCAGAAGGAAAAAGATGTGGG - Intergenic
1158837503 18:61346626-61346648 TTGCAAAAAAAGAAAAATCTAGG + Intronic
1159545097 18:69830868-69830890 GTGCAGAAGAAGTCAGACCTAGG - Intronic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1160406079 18:78647131-78647153 GTGGAGAAGAAGAGACATCAGGG + Intergenic
1160705741 19:529447-529469 GTACGGAAGAAGAGAGATCTTGG + Intergenic
1165127589 19:33611361-33611383 GTAAAGAAGAAGAGAGATGTAGG - Intergenic
1165954012 19:39490350-39490372 GTTCAAAAGAAGCAAGAACTTGG + Exonic
1166528998 19:43531286-43531308 GTGCAAAAAAAGAAAGAGGTGGG + Intronic
1166890244 19:45987366-45987388 GTGCAGAGTAGGAAAGAGCTGGG - Intergenic
1168463606 19:56583675-56583697 GTGTAGATTAAGAAAAATCTAGG + Intronic
925436346 2:3841454-3841476 GTGCAGAATTAAAAAGATTTAGG - Intronic
925583551 2:5439297-5439319 ATGGATAAGAAGATAGATCTAGG + Intergenic
927286578 2:21363159-21363181 GTGTACAATAAGAAAGAACTAGG - Intergenic
927645054 2:24872324-24872346 AGGCAGAAGAGGAGAGATCTGGG + Intronic
927671395 2:25071561-25071583 GTGCAGAAAAGAAAAGAGCTTGG - Intronic
927804211 2:26131208-26131230 GTGGAGAAGAAGAATTGTCTTGG + Intronic
927904107 2:26845120-26845142 CTGCAGAGGAAGGAACATCTGGG + Intergenic
928508285 2:31977051-31977073 GTTCAGAAGAAGGAAAATGTTGG + Intronic
928770594 2:34699086-34699108 GTGAAGAAGAAAATAGATTTTGG + Intergenic
928794107 2:34995775-34995797 CTTCAGAAAAAGAAAGAGCTGGG + Intergenic
928986822 2:37190267-37190289 AAGCATAAGAAGAAAGATGTGGG - Intronic
929658131 2:43754816-43754838 GAACTGAAGAAAAAAGATCTGGG - Intronic
929859293 2:45662403-45662425 GTCCTGAAGAAGTGAGATCTAGG - Intronic
930216304 2:48700877-48700899 GTTAGGAAGCAGAAAGATCTAGG + Intronic
931033942 2:58215647-58215669 GGGCAAGAGAAGAAGGATCTGGG + Intronic
931774687 2:65530437-65530459 ATGCAGGAGAAGAAACATTTAGG - Intergenic
931972757 2:67607865-67607887 ATTCAGAAGAAGACAGATCATGG + Intergenic
931973541 2:67616968-67616990 CTGCAGAATAAGATATATCTGGG + Intergenic
933083087 2:78018528-78018550 ATGCAGAAGATGAAACATCCTGG - Intergenic
933269948 2:80222586-80222608 GTGAAGAAGAAAAAAGTGCTTGG - Intronic
937051447 2:118894626-118894648 GTGCAGAAGCAGCAAGCTCTTGG - Intergenic
937647393 2:124280959-124280981 TGGCAGTAGAAGAAATATCTTGG - Intronic
938176419 2:129135304-129135326 GTGCTGAAGACAAAAGATCATGG + Intergenic
939388782 2:141538688-141538710 GTGCAGCAGCACAATGATCTTGG + Intronic
939503487 2:143014675-143014697 GTGGAGAAGAAGAAAGTTACGGG + Intronic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
941006813 2:160256633-160256655 ATTCAGAAGAAGCAAGATCAAGG - Intronic
942587144 2:177493520-177493542 GAGAAGAAGAAGAGACATCTAGG - Intronic
942861580 2:180619250-180619272 GTGCAGGAACAGAAAGATATGGG + Intergenic
943325228 2:186489647-186489669 GTACAGAAGAGGAAAGAGGTAGG - Intronic
944666316 2:201962388-201962410 GTGCTCCAGAAGGAAGATCTTGG + Intergenic
944860465 2:203811064-203811086 GTGCAGCAGAAGACAGACGTGGG - Intergenic
944976529 2:205059402-205059424 TTCCAGCAGAAGAAACATCTGGG - Intronic
945578888 2:211567536-211567558 GTAAAGTAGAAGAAAGATTTTGG + Intronic
946063801 2:216968673-216968695 CTGCAGAACAAGGCAGATCTAGG + Intergenic
1170136203 20:13076020-13076042 ATTCAGAAGGAGAAAGAACTTGG - Intronic
1170226947 20:14001444-14001466 GTGCAGTTGAGGAAATATCTTGG + Intronic
1170404714 20:16023934-16023956 GTGGAGAAGTAGAAAAATGTAGG + Intronic
1170854136 20:20034113-20034135 GTGAAGAGGAGAAAAGATCTAGG - Intergenic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1172613628 20:36268945-36268967 AGGCAGAAGAAGAAACATTTGGG + Intronic
1173302713 20:41818092-41818114 GGGCAGAAGCAGAAGGATCTCGG - Intergenic
1173558839 20:43987532-43987554 GTGTAAAAAAAGAAAGATCAAGG + Intronic
1176594332 21:8677870-8677892 GTGCAACAAAAAAAAGATCTAGG - Intergenic
1177027777 21:15941912-15941934 GAGCTGAAGAAGAAGGATCATGG - Intergenic
1178122781 21:29485865-29485887 GTGGAGAAGAAGAAAGGTGCAGG - Intronic
1179061668 21:37984896-37984918 GTGCAGAAGGAGGAAGCACTTGG + Intronic
1179470494 21:41606885-41606907 GTGCAGATGAGGAAGGACCTGGG - Intergenic
1180277185 22:10655004-10655026 GTGCAACAAAAAAAAGATCTAGG - Intergenic
1180500087 22:15922850-15922872 GTCCACCAGGAGAAAGATCTCGG - Intergenic
1182252610 22:29013208-29013230 GAGCTGAAAAAGAAACATCTTGG - Intronic
1183146600 22:35998316-35998338 GTGCAGGAAATGTAAGATCTAGG - Intronic
1183756322 22:39769589-39769611 GTGGAGAAGAAGAGAGATACAGG + Intronic
1184055020 22:42040523-42040545 TTTAAAAAGAAGAAAGATCTCGG - Intronic
1184445193 22:44542939-44542961 CTGCAGAGGAAGACTGATCTGGG + Intergenic
949831892 3:8223660-8223682 CGACAGAAGAAGAAAGATATTGG + Intergenic
950654226 3:14426814-14426836 GTGAGGAAGAAGAAACTTCTGGG + Intronic
951536937 3:23748909-23748931 CTGCACCAGAAGAAATATCTTGG - Intergenic
951808034 3:26668344-26668366 GTGCAGGATCAGAAAGATTTGGG + Intronic
952585374 3:34886458-34886480 AAGCAGAACATGAAAGATCTGGG + Intergenic
952591512 3:34960741-34960763 GAGCAGCAGAAGCATGATCTGGG - Intergenic
952692925 3:36230975-36230997 AAGCATAAGAAGAAAGATCCAGG + Intergenic
954161908 3:48728881-48728903 GAGAAAAAGAAGAAAGATTTGGG + Intronic
955684689 3:61538119-61538141 GGGCAGAAGCACAGAGATCTTGG + Intergenic
955726640 3:61940468-61940490 GTGAAGGAGAAAAAAAATCTTGG - Intronic
955778652 3:62461039-62461061 CTGCAGAGGAATAAAGATGTAGG - Intronic
955823219 3:62918480-62918502 ATTTAGAAGAAGCAAGATCTGGG - Intergenic
956652188 3:71514380-71514402 GTGCAGGAGAAGAAAAACCAGGG - Intronic
956887565 3:73575626-73575648 GTTCAGAAGAAGAAAGAGAAGGG + Intronic
959248531 3:103907445-103907467 GTGTATAAAAAGATAGATCTTGG + Intergenic
959297215 3:104551785-104551807 TTGCAGAAGATTAAGGATCTAGG - Intergenic
959507302 3:107170566-107170588 GGTCAGAAAAAGAAAGATGTGGG + Intergenic
959900397 3:111654559-111654581 GTGCAGAACAGGAAAGAGTTTGG - Intronic
960680583 3:120243477-120243499 GTTGAGAAGGGGAAAGATCTAGG - Intronic
960868937 3:122230386-122230408 GTGCTGGAGCAGAAAGATCTAGG - Intronic
961513406 3:127418340-127418362 GTGAAGAAAAAGAAAGATATGGG + Intergenic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
963367354 3:144353367-144353389 GTGCAGCAGAGGAAAGATGTGGG - Intergenic
963548774 3:146695230-146695252 GTGCAGAGAAAGATGGATCTTGG - Intergenic
964176204 3:153827796-153827818 GAGAGAAAGAAGAAAGATCTGGG + Intergenic
965342747 3:167510823-167510845 GTGCACAGGAAGAAAGATGAAGG - Intronic
966388765 3:179429498-179429520 GTTCAGAAGAAAAAAGATGAGGG + Intronic
968076351 3:195817742-195817764 CTGCAGAGGAGGAAAGATTTTGG - Intergenic
968613348 4:1566888-1566910 GTGGAGAAGAAGAGAGACCTGGG - Intergenic
969070414 4:4533536-4533558 GTGCAGAAGAATACAGATTTTGG - Intronic
972155617 4:36157309-36157331 GATCAGAAGATGAAAGTTCTTGG - Intronic
972748863 4:41968929-41968951 GCGCAGAAGAACTGAGATCTGGG + Intergenic
973163358 4:47046637-47046659 ATGCAGGAGAAGAATAATCTAGG + Intronic
973758342 4:54096185-54096207 GTGGAAAAGAACAAAGATCCAGG - Intronic
975523707 4:75326995-75327017 CTGCAGCTGAAGAAGGATCTGGG + Intergenic
976244995 4:82998143-82998165 TTACAGAAGGAGAAAAATCTAGG + Intronic
976775295 4:88699379-88699401 GTGGGGAAGAAGACAGATCGTGG - Intronic
977135106 4:93294494-93294516 GGACAGAAGAAAAAACATCTAGG + Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
977688435 4:99875905-99875927 ATGCAGAAAAAGATAGGTCTTGG + Intergenic
978492549 4:109324147-109324169 GCTCAGAAAAAGAAAGATGTGGG - Intergenic
979308807 4:119178189-119178211 GCTGAGAAGGAGAAAGATCTGGG - Intronic
981259969 4:142707873-142707895 GCTCAGAAGAAGAAAGATAAAGG + Intronic
982396502 4:154920820-154920842 GTGAGGAAGAAAATAGATCTTGG + Intergenic
983066754 4:163219117-163219139 GTGTAGAACAAGAAAGAGTTTGG - Intergenic
983426748 4:167594314-167594336 GTGCATAAGGAATAAGATCTAGG - Intergenic
983965683 4:173807252-173807274 AAGCAGAATAAGAAAAATCTAGG + Intergenic
984106360 4:175552261-175552283 ATGCTGAAGGGGAAAGATCTGGG - Intergenic
984624069 4:181986212-181986234 GTGCAGAAGAAGAAACGTGAGGG - Intergenic
985435964 4:189929797-189929819 GTGAGGAAGAAAATAGATCTTGG - Intergenic
986213256 5:5694263-5694285 TTGAAGGAGAAGAAAGAACTTGG - Intergenic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
989683499 5:44057792-44057814 AAGGAGAAGGAGAAAGATCTTGG + Intergenic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991528783 5:67592819-67592841 GTGAAGAAAAAGAATGTTCTTGG - Intergenic
992311243 5:75501203-75501225 GAGCGGAAGTTGAAAGATCTTGG - Intronic
992726981 5:79616999-79617021 GGGGAGAAAAAGAAAAATCTGGG - Intronic
993047975 5:82890005-82890027 GACCAGAAGAAGAATGAACTGGG + Intergenic
994352741 5:98766097-98766119 GTGACGAAAAAGAAAGATCAAGG + Intergenic
994552211 5:101250423-101250445 TTGCAGAAGAATAAACATATGGG + Intergenic
994781603 5:104096266-104096288 GCTCAGAAGAAGATAGATGTGGG - Intergenic
994885525 5:105556405-105556427 GAGAAGAAGAGGAAAGGTCTAGG + Intergenic
995133498 5:108655935-108655957 GTGCAGCAGAAAAAAAATCTAGG - Intergenic
995963171 5:117870408-117870430 GTGAAGAACAAGAAACATTTAGG + Intergenic
996123001 5:119692155-119692177 GCTCAGAAGAAGAAAGATGTGGG - Intergenic
996800182 5:127395002-127395024 GTTCAAAAGAAGAAAACTCTAGG - Intronic
997240694 5:132304621-132304643 AAGAAGAAGAAGAAAGATCAGGG + Intronic
997291433 5:132738534-132738556 GTGCAGAAGAAGCAAGAGGGAGG - Intergenic
1000606815 5:163335574-163335596 GAGAGAAAGAAGAAAGATCTGGG - Intergenic
1000679432 5:164164457-164164479 GTGTGGAAGAAGAAAGCTCCAGG + Intergenic
1001539743 5:172529455-172529477 GGGCAGAACAAAATAGATCTAGG + Intergenic
1001593349 5:172881453-172881475 GGGCAGTAGAGGAAAGGTCTGGG + Intronic
1002401053 5:178991782-178991804 GGGCAGAAGCAGAAAGATGGGGG - Intronic
1002713874 5:181213073-181213095 GTGCTCAAGAAGGAAGACCTTGG - Intergenic
1004242479 6:13937671-13937693 GTGTAGAAGTAGAAAGGTCATGG + Intronic
1004341921 6:14815367-14815389 TTGAAGGAGAAGAAATATCTAGG + Intergenic
1005420984 6:25650864-25650886 GTTCAGAAGAAAACAGTTCTGGG - Intergenic
1006093446 6:31641734-31641756 GTGCAAAAGAGGAGAGTTCTGGG + Intronic
1007691338 6:43703314-43703336 GTGCAGAAGAAGACCTACCTTGG + Intergenic
1007914760 6:45551212-45551234 GGGGAGAAGAAAAAAAATCTTGG + Intronic
1008063957 6:47027703-47027725 GTGAATAAGAAAAAACATCTAGG - Exonic
1008279646 6:49581371-49581393 GTGCAAATGAAAGAAGATCTGGG - Intergenic
1008547117 6:52592989-52593011 GTGAAAAAGTAGAAAGAGCTTGG + Intergenic
1009757127 6:67954367-67954389 TTGCAGAAGAAGAAAGTAATTGG + Intergenic
1010012426 6:71064382-71064404 GTGGAGCAGAAGCAAGAACTAGG + Intergenic
1010567256 6:77431381-77431403 TTGCAGAAGAGGAAAGATGGGGG - Intergenic
1011370298 6:86629981-86630003 TTGAGGAAGAAGAAGGATCTAGG - Intergenic
1011695008 6:89904375-89904397 TTAGAAAAGAAGAAAGATCTAGG - Intergenic
1012168772 6:95991651-95991673 CTGCAGCTGAAGACAGATCTCGG + Intergenic
1012306061 6:97659181-97659203 GTGCAGAAAAAAAAAAAACTTGG - Intergenic
1012839995 6:104318039-104318061 GAAGAGAAGGAGAAAGATCTAGG + Intergenic
1013862518 6:114652805-114652827 GTGCAGATGAAGAACCAGCTTGG + Intergenic
1014042957 6:116850777-116850799 GTGCAGAAAAAGCAAGAGTTTGG + Intergenic
1016087671 6:139934371-139934393 TTACAGAAGAAGAAAGAGCATGG + Intergenic
1016785103 6:148002721-148002743 CTGCAAAAGAAGAAAGGGCTAGG + Intergenic
1016943527 6:149505651-149505673 ATGAAGAAGAAGAAAGCTGTTGG - Exonic
1017689252 6:156946669-156946691 GTGCAGAGGAAGAAAATTGTTGG + Intronic
1018091158 6:160348005-160348027 CTCCAGAAGAAGAAAGTTCCAGG - Intergenic
1018880808 6:167878180-167878202 GTGCAGAAGAACATGGACCTGGG + Intronic
1018907045 6:168081503-168081525 GTCCAGAAGAAGAGAGAGTTGGG - Intronic
1019109501 6:169698593-169698615 GGGAAGAAGCAGAAAGAGCTTGG - Intronic
1019747305 7:2708185-2708207 CTGCAGATGATTAAAGATCTTGG - Intronic
1019798830 7:3072796-3072818 AGGCAGAAGAGGAAAGACCTGGG + Intergenic
1020467314 7:8495663-8495685 ATGCAGAGGAAGAAAGAAGTGGG + Intronic
1020841835 7:13227548-13227570 GTCCAGAAGAAAATAGATCATGG + Intergenic
1021029995 7:15720741-15720763 GTGATGAATCAGAAAGATCTTGG - Intergenic
1022077271 7:26984582-26984604 CTGAAGAAGAAGAGTGATCTTGG - Intronic
1022622263 7:31996689-31996711 GTGCAGCAGCAGAGAGATGTTGG - Intronic
1022853230 7:34288102-34288124 TTGAAAAAGAAGAAAGATATTGG + Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024442364 7:49435385-49435407 GGGCCAAAGTAGAAAGATCTGGG + Intergenic
1024502471 7:50125825-50125847 GTGGAGAAAATGAAAGATGTTGG + Intronic
1024771609 7:52730588-52730610 GCTCAGAAGAAGAAAAATGTGGG + Intergenic
1025360303 7:58829047-58829069 TTGCAGAAAAGGAAATATCTTGG + Intergenic
1025400963 7:59550087-59550109 TTGCAGAAAAGGAAATATCTTGG + Intergenic
1027242812 7:76344005-76344027 TTGCAGAGAAAGATAGATCTCGG - Intronic
1028248681 7:88513942-88513964 GTGCAATAAAAGAAACATCTAGG + Intergenic
1029328005 7:99826254-99826276 GTGCAGCAGCAGGAAGATATGGG + Intergenic
1030095674 7:105897104-105897126 GTGCCAAAGAAAAAAGACCTGGG + Intronic
1031367487 7:120920432-120920454 TTGCTAAAGAAGAAAGAACTAGG - Intergenic
1031609067 7:123803789-123803811 ATGCAGAAGAAGAAAGACAAAGG - Intergenic
1032471166 7:132180435-132180457 GTGAACATGAAGAAAGAACTTGG + Intronic
1033533087 7:142285810-142285832 TTGGAAAACAAGAAAGATCTTGG + Intergenic
1033718069 7:144023867-144023889 GTGAAGAAGAAGCAAGGTCAGGG - Intergenic
1033854542 7:145543127-145543149 ATGCATAATAAGAAACATCTTGG + Intergenic
1035956617 8:4087613-4087635 GTATCGAAGAAGAAAGATTTGGG - Intronic
1036539059 8:9685842-9685864 GTGAAGAACAAGAAAGATGGAGG + Intronic
1037309413 8:17538690-17538712 TTGCAAAATAAAAAAGATCTAGG + Intronic
1037538977 8:19854158-19854180 TTGCAGAAAAAGAAGGAGCTGGG + Intergenic
1037711807 8:21361013-21361035 GTTCTGAAGAAGAAATATCCAGG - Intergenic
1037796686 8:22001253-22001275 GTGCAGAAGTGGCACGATCTCGG - Intronic
1038726336 8:30085494-30085516 GTGAAGAAGGAGGAAGAACTAGG + Intergenic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039373475 8:37010514-37010536 GGGCAGAAGAAAAAAGACATTGG + Intergenic
1041025266 8:53679109-53679131 ATCAAAAAGAAGAAAGATCTTGG + Intergenic
1041773339 8:61496552-61496574 GGGCAGAGGAAGGAAGCTCTAGG - Intronic
1043309640 8:78842528-78842550 TGGCTGAAGAAGAAAGATCAAGG + Intergenic
1043364020 8:79510524-79510546 GTGCTGAAGAAGAGCCATCTTGG + Intergenic
1044192283 8:89333282-89333304 GTGCAGAAGAAGACAGATGTTGG - Intergenic
1044951552 8:97440295-97440317 GAGTAGAAGAAGATAGGTCTGGG + Intergenic
1045771564 8:105746713-105746735 TTGCAGAAGAACAGAGATTTGGG - Intronic
1046891332 8:119424607-119424629 GTCCAGAAAAAAAAAGATCAGGG - Intergenic
1047490595 8:125371193-125371215 GTGCAGTAGTAGCACGATCTTGG - Intergenic
1047768932 8:128014851-128014873 GTCCAGATGAAGAAAGTTCAGGG - Intergenic
1047792663 8:128220453-128220475 GGGCAGAAGATGTAACATCTGGG + Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1050989027 9:12123001-12123023 GTGCTTAAGAAGGAAGACCTTGG - Intergenic
1052924429 9:34002986-34003008 TTGCAGAGTAAGAAAGATATAGG - Intronic
1053058280 9:35007425-35007447 GTGAAGAAGAAAATAGATTTTGG - Intergenic
1054331125 9:63756773-63756795 GTGAAGAAGAAGGAAGAGATTGG - Intergenic
1054996634 9:71398573-71398595 GTGGAGCAGAAGAGAGAGCTGGG - Intronic
1055253231 9:74334011-74334033 GTGCAGAAGAAAAAAAAGCATGG - Intergenic
1055835290 9:80432914-80432936 GTGCAGTAGAAGAAAAAAATTGG - Intergenic
1055971802 9:81919245-81919267 GTGAAGAACAAGAAAGTTCTTGG + Intergenic
1055973554 9:81934317-81934339 GTGAAGAACAAGAAAGTTCTTGG + Intergenic
1056113476 9:83419723-83419745 GTACAGAACAAGAAAGAGCTGGG + Intronic
1056856399 9:90133430-90133452 GTGCAAAAGAACAAAGATTCTGG + Intergenic
1057544419 9:96006800-96006822 GTTCAGAGGGAGAAAGATTTAGG + Intronic
1059031200 9:110698492-110698514 ATGCAGAAAAAGATAGATTTTGG - Intronic
1059115775 9:111599254-111599276 GGGTAGAAGAAGAAAGATCGGGG - Intronic
1059337058 9:113575528-113575550 GTGCAGAAGAGGCATGACCTTGG - Intronic
1060030344 9:120209598-120209620 TTGCAGAGGAGGAAGGATCTTGG + Intergenic
1060057280 9:120425731-120425753 GTGGAAAGGAAGAAACATCTGGG - Intronic
1060171504 9:121465383-121465405 GGGCAGAACAAGAAAGATTTTGG - Intergenic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1186404221 X:9287602-9287624 AAGCAGAAGAAGAAATATTTAGG + Intergenic
1186451704 X:9679548-9679570 GGGCAGGAGAACAAAGAGCTTGG - Intronic
1186493607 X:9994295-9994317 GTGCAGTGGCAGACAGATCTCGG + Intergenic
1186545290 X:10442770-10442792 GTGCAGAAGTAGAGAGAACTCGG + Intergenic
1188300768 X:28504014-28504036 GTGAGGAAGAAAATAGATCTTGG - Intergenic
1188643471 X:32535403-32535425 TTGGAGAAGAAAAAAGACCTTGG - Intronic
1190900778 X:54671077-54671099 TGGCAGAAAAAAAAAGATCTGGG + Intergenic
1192281288 X:69688795-69688817 CTGCAGAAGTAGCAAGGTCTAGG + Intronic
1193536945 X:82728080-82728102 GAGAAAAAGAAGAAAGATTTGGG - Intergenic
1194442810 X:93954010-93954032 GCTCAGAAGAAGAAAGATGTTGG + Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1199143911 X:144342838-144342860 TTGCAAAAAAAGAAATATCTGGG - Intergenic
1200760966 Y:7038792-7038814 GTGCAAGAGAATAAAGAGCTTGG - Intronic
1200799959 Y:7377495-7377517 GTGCAGAAGGAGACAGATGAAGG - Intergenic
1201061474 Y:10050453-10050475 GTGAAGAAGAAAATAGATTTTGG + Intergenic
1201145539 Y:11063312-11063334 GAGAAGAAAAAGAAAAATCTGGG + Intergenic
1201937400 Y:19423075-19423097 GTGAAGAAGAAAATAGATTTTGG - Intergenic