ID: 1119983045

View in Genome Browser
Species Human (GRCh38)
Location 14:79103535-79103557
Sequence CTGGAGTTCGGGAGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119983037_1119983045 2 Left 1119983037 14:79103510-79103532 CCAGCAGAACATTCTAAATTTTG 0: 1
1: 0
2: 0
3: 24
4: 246
Right 1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG 0: 1
1: 0
2: 2
3: 21
4: 341
1119983036_1119983045 17 Left 1119983036 14:79103495-79103517 CCTGGTAGAAGATGTCCAGCAGA 0: 1
1: 0
2: 0
3: 17
4: 156
Right 1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG 0: 1
1: 0
2: 2
3: 21
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119983045 Original CRISPR CTGGAGTTCGGGAGGGAAGT TGG Intronic
900110250 1:1002147-1002169 AGGGAGTTCGGGATGGAAGGAGG + Intergenic
901880485 1:12191129-12191151 CTGGAGTTGCCGGGGGAAGTTGG - Intronic
902798385 1:18814515-18814537 TTGGGGTTAGGGAGGGGAGTAGG - Intergenic
902885806 1:19403886-19403908 CTGGAGTCCAGGAGGGAGGCAGG - Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903364530 1:22797813-22797835 CTAGAGAGCGGGAGGGAAGGAGG - Intronic
905187910 1:36209953-36209975 GTGGAGGTAGAGAGGGAAGTGGG + Intergenic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905751231 1:40466307-40466329 CTGGAGTTCGGGAGAGGTCTGGG - Intergenic
907263911 1:53243166-53243188 CTGGAGTTCGGGGGGTAGGGTGG + Intergenic
907418221 1:54329112-54329134 CTGGACTTCTGGAAGGAAGGGGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
912705467 1:111908639-111908661 CTGGAACACGGGAGAGAAGTTGG - Intronic
912940909 1:114043837-114043859 CTGGAGCTCAGAAGAGAAGTTGG - Intergenic
913077420 1:115352883-115352905 CTGGAGTTCGGGGCTGAAATAGG - Intergenic
913285751 1:117224954-117224976 GTGGAGATAGGGAGGAAAGTGGG - Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914320575 1:146555548-146555570 CTGGAGGTGGGAAGGGTAGTGGG + Intergenic
914876117 1:151513649-151513671 CTGGACTTCTGGCAGGAAGTGGG - Intronic
914880219 1:151540934-151540956 CTGGAGGGCGGGGGGCAAGTAGG + Intronic
915125198 1:153658884-153658906 CAGGTGCCCGGGAGGGAAGTTGG + Exonic
915625557 1:157112073-157112095 CTGGAGTTCGGGTCGGGGGTGGG - Intergenic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
916719140 1:167470275-167470297 CTGGATTTCAGGAGAGAACTGGG - Intronic
917660067 1:177169765-177169787 CTGGAGCTGGGGAAGGAACTTGG - Intergenic
918496742 1:185148211-185148233 CTGGAGTTCAGGAAGAATGTGGG - Intronic
918519952 1:185404409-185404431 GTGGAGTTTGGCAGGGCAGTCGG + Intergenic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920161015 1:203997627-203997649 GCGGAGGTGGGGAGGGAAGTTGG - Intergenic
920189145 1:204181288-204181310 TTGCAGTTGGGGAGAGAAGTTGG + Intergenic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
923404074 1:233643241-233643263 CTGGATTTGGTGAGAGAAGTGGG + Intronic
924337912 1:243001584-243001606 TTTGAGATAGGGAGGGAAGTGGG + Intergenic
924934326 1:248755517-248755539 CTGGAGTTCAGGGAGGATGTGGG - Intronic
1063505722 10:6597630-6597652 CTGGAGGTGGGGGGGGAAATAGG - Intergenic
1064419041 10:15174458-15174480 CTAGAGCTAGGAAGGGAAGTGGG - Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1067019072 10:42779598-42779620 CTGGAGCTGGTGAGGGGAGTGGG + Intergenic
1067247543 10:44559111-44559133 GTTGAGTACGGGAAGGAAGTTGG - Intergenic
1069024940 10:63529358-63529380 CTGGAGATAGATAGGGAAGTAGG + Intronic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1069679510 10:70273997-70274019 ATGGTGTTGGGGAGGGAGGTGGG - Intronic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1072447812 10:95514950-95514972 CTGTAGTGTGGGAGGGGAGTGGG - Intronic
1072548830 10:96461504-96461526 TGGGAGTTGGGGAGAGAAGTTGG - Intronic
1073539253 10:104305071-104305093 CTGCAGTTGGGGAGGGAGATTGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075553236 10:123409575-123409597 CTGGAGTTGGGGAGGGGGGTTGG - Intergenic
1076261683 10:129071664-129071686 CTGGAGTTCCGGGTGGACGTGGG - Intergenic
1076380412 10:130021304-130021326 CTGGACTTGGAGAGGGGAGTGGG + Intergenic
1078321416 11:10338429-10338451 CTTAAGTTCAGGAGGGATGTTGG + Intronic
1078486847 11:11731267-11731289 CAGGAGTTCGGGGAGGGAGTTGG - Intergenic
1079357410 11:19741421-19741443 CTGAAGTGGGGGAGGGAAGTGGG - Intronic
1080115333 11:28615599-28615621 TTGGAGTTCACCAGGGAAGTGGG - Intergenic
1081354991 11:42101755-42101777 CAGAATTTCAGGAGGGAAGTTGG + Intergenic
1082698784 11:56402231-56402253 CTGGAGTTCTGGGTGGGAGTGGG - Intergenic
1083410573 11:62489703-62489725 CTGGAGCTCGGAAGAGAAGCAGG + Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084451680 11:69242737-69242759 CTGGAGATCCCCAGGGAAGTGGG - Intergenic
1084725120 11:70936743-70936765 CTGGAGTCCGGGAGGCGAGGAGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1087666263 11:101052652-101052674 CTGGAGTTAGGGAGGACAGTTGG + Intronic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089512596 11:119009554-119009576 GGGGAGATGGGGAGGGAAGTGGG + Intronic
1091233476 11:134003174-134003196 CTGGAGTTCCGGGGGGGCGTGGG - Intergenic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1092336652 12:7639889-7639911 CTGGAGTTCCGGGGGGGCGTGGG + Intergenic
1093921642 12:24866125-24866147 CTGGAGTTCCGGGTGGGAGTGGG + Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1097054138 12:56239920-56239942 CTGGGGTTGGAGAGGGAGGTAGG + Exonic
1097084187 12:56455108-56455130 GTGGGGTTCAGCAGGGAAGTTGG + Intronic
1099790690 12:87330264-87330286 CTGGAGTTCGGGGTGGGCGTGGG + Intergenic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1101219228 12:102619050-102619072 CTGGAGCTGGGGTGAGAAGTGGG - Intergenic
1101642212 12:106595265-106595287 CTGGAGTTGGGGAGGCAAGGAGG - Intronic
1103256526 12:119546246-119546268 CTGGTGTTGTGGAGGAAAGTTGG + Intergenic
1103668518 12:122592073-122592095 CTGGAGTTCCGGGTGGATGTGGG + Intronic
1103993088 12:124812179-124812201 CTGGAGTTAGGAAGGGAGGGTGG - Intronic
1104691038 12:130826530-130826552 ATGCAGTCCGGGAGGGAACTGGG - Intronic
1104843620 12:131835974-131835996 CTGGAGGTCAGGGCGGAAGTGGG + Intronic
1105578147 13:21671813-21671835 CTGCAGTAAGGGAGGGGAGTTGG + Exonic
1106398296 13:29403048-29403070 CTGAACTTCAGGAGGGAAGGAGG + Intronic
1108527381 13:51297355-51297377 CTGGAATTAGGGAGGGATGAAGG + Intergenic
1109133262 13:58614470-58614492 GTGGAGTCCGGGTGGGAAGAAGG + Intergenic
1110425034 13:75357473-75357495 CTGGAGTTGGGGAGGTGAGAAGG - Intronic
1114993825 14:28321277-28321299 GTGGAGTTGGGGAAGGAAATGGG + Intergenic
1115128492 14:30025039-30025061 CTGGTGTTTGGCAGGGGAGTAGG + Intronic
1116078731 14:40145757-40145779 CTGGGCTTTGGGAGGTAAGTAGG + Intergenic
1117435972 14:55715582-55715604 TTGGACGTCTGGAGGGAAGTGGG - Intergenic
1118033428 14:61840293-61840315 CTAGAGCTTGGGAGAGAAGTTGG + Intergenic
1118313306 14:64708383-64708405 CTGGAGGTCGGAAGCGGAGTGGG + Intronic
1118440189 14:65805001-65805023 GTGGAGCTCAGGAGAGAAGTGGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121175910 14:91890467-91890489 CTGGAATTTGAGGGGGAAGTCGG + Intronic
1121979506 14:98442446-98442468 CAGGAGTTTGGGAGTGAACTGGG + Intergenic
1123129238 14:105972312-105972334 CTGGACTCCGGGAGGGAATGAGG + Intergenic
1123178162 14:106441908-106441930 CTGGAGTCTGGGAGGCTAGTGGG + Intergenic
1126873052 15:53010154-53010176 CTGGAGTTCAGGAGAGAGGCTGG + Intergenic
1127470025 15:59282488-59282510 CTGGAGTTTGTGAGGGAAAGAGG - Intronic
1127488420 15:59439961-59439983 CTGGTGCTCGGGAGAGAAGGTGG - Intronic
1127610477 15:60631436-60631458 CTGGAGATTGGCAGGGAAGTAGG - Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1129499556 15:76023246-76023268 CTGGAGTGCAGTAGGGGAGTGGG + Intronic
1129750066 15:78056506-78056528 CTGGAGTTTGGGAGGCAGGCTGG + Intronic
1130882933 15:88070610-88070632 CTGGAGATCAGGAAGGAAGGAGG - Intronic
1130901248 15:88208241-88208263 CTTGAGTGTGGGAGGGATGTGGG - Intronic
1131149877 15:90040699-90040721 CTGGAGTTGGGGAGCGAGGTGGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1134563052 16:15227317-15227339 GTGGAGATGGGGAGGAAAGTGGG - Intergenic
1134923586 16:18138950-18138972 GTGGAGATGGGGAGGAAAGTGGG - Intergenic
1136356062 16:29745479-29745501 CTGGGGTCTGGGAGGGAAATGGG - Intronic
1137725597 16:50654727-50654749 CTGGAGTTAGAGAGGGAGGGAGG + Intergenic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138214588 16:55191946-55191968 CTGGAGGGTGGGAGGGAATTTGG + Intergenic
1140012958 16:71154558-71154580 CTGGAGGTGGGAAGGGTAGTGGG - Intronic
1140962980 16:79935002-79935024 CTTGAATTTTGGAGGGAAGTGGG + Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141910404 16:87054658-87054680 CTGGAGTTGCAGATGGAAGTAGG + Intergenic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142547409 17:714571-714593 CGGGAGTGCGGGAGGGGAGACGG - Intronic
1143031691 17:3971493-3971515 CTGGAGTTTGGGAGGGCTGGGGG + Intergenic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1144611524 17:16722681-16722703 CAAGAGTTGGGGAGGGAAGGTGG - Intronic
1144901216 17:18592669-18592691 CAAGAGTTGGGGAGGGAAGGTGG + Intergenic
1145045495 17:19611717-19611739 CTGGAATTTGGGAGGCAAATGGG - Intergenic
1145131290 17:20353428-20353450 CAAGAGTTGGGGAGGGAAGGTGG - Intergenic
1147861136 17:43524243-43524265 CTGGAGACGGGGTGGGAAGTGGG - Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151336932 17:73445569-73445591 CTGGAGTCCAGGAGGGATGGAGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151657293 17:75501992-75502014 CAGGAGTTGGGGAAGGCAGTGGG + Exonic
1152451053 17:80380477-80380499 CTAGAGTTTGGGAGGACAGTCGG - Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1153575150 18:6512437-6512459 GTGGAGTTCGGGGTGGGAGTTGG - Intronic
1155803137 18:30134110-30134132 GTGGAGTTGGGGAGGGAAGGAGG + Intergenic
1157253155 18:46114372-46114394 CTGGAGTTGGGGTTGGAGGTAGG + Intronic
1158187847 18:54791877-54791899 GTGGAGTTTGGCAGGGCAGTCGG + Intronic
1158565657 18:58552210-58552232 CTGGGGTTGGGGTGGGAGGTAGG - Intronic
1159113309 18:64085386-64085408 CTGGAGATCCAAAGGGAAGTGGG - Intergenic
1159719483 18:71869780-71869802 CTGGAGTTGGGGTGGTAATTAGG - Intergenic
1159774651 18:72589429-72589451 CTGGAGTTTGGGATAGAGGTGGG + Intronic
1161741992 19:6026946-6026968 ATGGAGGTGGGGAGGGAGGTGGG + Intronic
1164933016 19:32189713-32189735 CTGGAATTAGGGAGGGAGGCTGG - Intergenic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165560908 19:36678800-36678822 CTGGAGTGCTGGAGTGCAGTGGG - Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166649750 19:44563516-44563538 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
1166840789 19:45695727-45695749 CAGGAGTCGGGGAGGGTAGTGGG + Intronic
1167890978 19:52539050-52539072 CGGGAGTGGGGGAGAGAAGTAGG + Intronic
925359637 2:3268346-3268368 CTGGAGTGCAGGTGGGGAGTGGG - Intronic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
926108638 2:10168196-10168218 CTGCAGTTGGGGAGAGAGGTTGG - Intronic
926154015 2:10440820-10440842 CTCTACTTCGGGTGGGAAGTCGG + Exonic
926297595 2:11579874-11579896 CTGGAGTCCAGGAGAGCAGTCGG - Intronic
926764746 2:16314489-16314511 CTGGAGTTCAGAAGAGAGGTTGG + Intergenic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
930468241 2:51780597-51780619 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
932093753 2:68828953-68828975 AAGGAGTTTGGGAGGGAAGAGGG - Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
935019709 2:99218052-99218074 ATGGGGTTGGGGAAGGAAGTGGG + Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937307311 2:120880386-120880408 CTGGACTTCGGTGGGGAAGATGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
939777379 2:146404003-146404025 CTGGAGTTCCGGGTGGGAGTGGG - Intergenic
940165008 2:150761352-150761374 CTTGAGTTTGGGAGGTACGTGGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944842784 2:203640462-203640484 CTGGGGTTGGGTGGGGAAGTGGG - Intergenic
944982555 2:205138021-205138043 ATGGAGTCCGATAGGGAAGTGGG + Intronic
947545061 2:231004686-231004708 CTGGAGTTCTGGAGGCAGGCAGG + Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
949010867 2:241677620-241677642 CTGGAGTCTGGGAGAGAGGTAGG + Intronic
1168845912 20:944615-944637 CTGGAGTGGGGGTGGGAAATGGG + Intergenic
1169213858 20:3782834-3782856 TCGGATTTCGGGAGGGAAGGTGG + Intergenic
1169489468 20:6058865-6058887 CTGGAGTTCTGGGGGTAAATGGG - Intergenic
1169563075 20:6822922-6822944 CTGGAGATTGGGCGGGAAGGGGG + Intergenic
1170937697 20:20824127-20824149 CTGGAATCCAGGAGGGAGGTGGG + Intergenic
1171973175 20:31577177-31577199 CTGAAGTGCGGGAGGGGAGGTGG + Intronic
1171982799 20:31639114-31639136 CTGGAGTTAGGCAGGGAGGAAGG - Intronic
1172957205 20:38769458-38769480 TTGGATCTGGGGAGGGAAGTCGG + Intronic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173584878 20:44174946-44174968 CTGGAGTGCAGGAGGGATCTTGG - Intronic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1178924408 21:36762797-36762819 CTGGAGGCCAGGATGGAAGTGGG - Intronic
1180303512 22:11055401-11055423 CTGGAGTTGGGGGGGAATGTTGG - Intergenic
1181852705 22:25761453-25761475 CTGGAGTTTGGGTGGGAGGAGGG + Intronic
1182159949 22:28111647-28111669 CCGGAGCTGGGGAGGGCAGTAGG + Intronic
1182190328 22:28453427-28453449 CTGGAGCTCAGTAGAGAAGTGGG - Intronic
1182919948 22:34070071-34070093 CTGGAGCCCGGGAGAGAAGCTGG - Intergenic
1182923046 22:34097710-34097732 GTGGAGGTGGGGAGGGATGTGGG + Intergenic
1182971283 22:34580693-34580715 CTGTAGTTGGGGAGTGGAGTAGG - Intergenic
1183027719 22:35078495-35078517 GTGGACTTAGGGAGGGAAGGGGG + Intronic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1183530433 22:38350599-38350621 CTGGAGATGGGGCGGGCAGTAGG - Intronic
949681960 3:6524265-6524287 GTGGAGGTAGGGATGGAAGTAGG + Intergenic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
953661712 3:44895536-44895558 CTGCAGTTGGAGAGGGAGGTGGG + Intronic
953775263 3:45811266-45811288 CTGGCTTTAGGAAGGGAAGTGGG - Intergenic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955740523 3:62086380-62086402 CTGGGGTTAGGGTGGGAATTTGG - Intronic
956425267 3:69127966-69127988 CTGGAGTGGGGAGGGGAAGTGGG + Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
957374518 3:79338825-79338847 GTGGAGTTCAGGTGAGAAGTAGG - Intronic
959503245 3:107130913-107130935 CTGGAGGTCAGAAAGGAAGTGGG + Intergenic
959556112 3:107720357-107720379 CTTGTGCTGGGGAGGGAAGTGGG + Intronic
959925177 3:111913102-111913124 ATTGAGTTTGGGAGGAAAGTTGG + Intronic
959995424 3:112675444-112675466 CTGGAGATCGCAAGGGAAGAGGG + Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
962087363 3:132205814-132205836 CTGCTGTTTGGGAGGAAAGTTGG - Intronic
962680608 3:137796066-137796088 CTGGGGTCGGGGTGGGAAGTAGG - Intergenic
964315880 3:155443910-155443932 CTGGAGTTAAGGAGGGATATTGG - Intronic
964506428 3:157405031-157405053 CTGGTGTCTGTGAGGGAAGTAGG - Intronic
965377360 3:167941933-167941955 CTAGAGCAGGGGAGGGAAGTAGG - Intergenic
966905906 3:184525730-184525752 CTGGAATTTGGGGGGGAGGTGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968699023 4:2046099-2046121 CTGGAGTGCAGGTGGGCAGTGGG - Intergenic
969476980 4:7427413-7427435 CTGAAGCTCAGGAGTGAAGTCGG - Intronic
972389882 4:38604587-38604609 CTAGAGTTCAGGAGGGAAGATGG - Intergenic
972630227 4:40835962-40835984 CTGGAGTGGGGGAGGGAAGGAGG + Intronic
973047412 4:45551882-45551904 CTGGAGTACCGGAAGGCAGTTGG - Intergenic
974147393 4:57965474-57965496 CTGGAGTTCCGGATGGGCGTGGG + Intergenic
978317735 4:107458374-107458396 ATGGGGTTGGGGAGGGATGTGGG - Intergenic
978764776 4:112392849-112392871 CTAGAGTTAGGGAGAGGAGTTGG - Intronic
978795661 4:112705662-112705684 CCGGAGTTCGGGAGGTGGGTGGG - Intergenic
978928141 4:114275608-114275630 CTGCAGTTTGGGAAAGAAGTGGG - Intergenic
980048919 4:128019335-128019357 ATGGAGTGAGGGAGGTAAGTAGG - Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982261552 4:153498551-153498573 TTGGAGGTGGGTAGGGAAGTGGG + Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982989650 4:162255854-162255876 CTGGAATAAGGGAGGTAAGTTGG + Intergenic
983230682 4:165126248-165126270 CTGGAGTTCGGGGTGGGCGTGGG - Intronic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
985487543 5:159895-159917 CTGGAGGCCGGGAAGGAAGCGGG - Intronic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
987358202 5:17083509-17083531 CTGGAGTTCGGAGTGGACGTGGG + Intronic
987876926 5:23691174-23691196 CTGGAGTTCTGGGTGGACGTGGG + Intergenic
988628778 5:32906577-32906599 CAGGAGTTCAGGAGAGAAGGTGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
990696960 5:58429179-58429201 CTGGAGCGCGGGAGGGGAGGAGG - Intergenic
990774950 5:59295805-59295827 GTGGTGTTAGGGAGTGAAGTAGG + Intronic
991205841 5:64049479-64049501 GTGGGGTTGGGCAGGGAAGTGGG + Intergenic
991509671 5:67362886-67362908 CTGGAGTTTGGAGGAGAAGTTGG - Intergenic
992205053 5:74423073-74423095 CAGGAGTTAGGGAGGAATGTTGG + Intergenic
992793320 5:80232962-80232984 AGGGAGTTTGGGAGGGAACTGGG + Intronic
993529214 5:89003928-89003950 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
993958907 5:94272178-94272200 CAGGAGTTGGGAAGGGTAGTGGG + Intronic
995748675 5:115430828-115430850 CTGGAGTTTGGGAAGGAGCTGGG - Intergenic
995910743 5:117183615-117183637 CTGGTGTTTTGGAGGGATGTGGG + Intergenic
997200709 5:132008537-132008559 GTGGAGTCCAGGAGGGTAGTAGG - Intronic
997618072 5:135266293-135266315 CTGGAGATGGGGAGGGAGCTGGG + Intronic
997676878 5:135719791-135719813 CTGGACTGCAGGAGGGCAGTGGG - Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1002076815 5:176713180-176713202 CTGGATTCCGGGAGGGACCTGGG + Intergenic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1003060700 6:2860194-2860216 CTGGAGTTCCGGGTGGACGTGGG + Intergenic
1005435171 6:25802040-25802062 CTGGAGTTTAGGTGGGAATTGGG + Intronic
1005707470 6:28469663-28469685 CTGGAGTTCCGGGGAGACGTGGG - Intergenic
1005942355 6:30570173-30570195 CTGGAGCTCGGGGCAGAAGTTGG + Intergenic
1006045051 6:31288057-31288079 CTGGGGTAAGGCAGGGAAGTGGG + Intronic
1006411708 6:33877761-33877783 CTGGTGTGGGGCAGGGAAGTAGG - Intergenic
1006636897 6:35467633-35467655 CTGGAGTTCGGGAAGGGTTTTGG + Intergenic
1006923890 6:37643748-37643770 CTGGAGGATGGGAGGGGAGTGGG - Intronic
1007078814 6:39084665-39084687 CTTGAGTGGGGGAGGGAAGGAGG - Intronic
1007623872 6:43231405-43231427 CTGGAGTTAGGGAAGTAAGAGGG - Intergenic
1009978999 6:70703830-70703852 CTGGAGTTAGGGAGGCCACTGGG + Intronic
1014213210 6:118728483-118728505 CTGGAGGTTGGGTAGGAAGTGGG - Intergenic
1015151927 6:130049758-130049780 CTGGAGCTCGGGGGAGAGGTCGG - Exonic
1015582419 6:134740338-134740360 GTAAAGTTTGGGAGGGAAGTAGG - Intergenic
1015955077 6:138590361-138590383 TTTGAGTTTGGGAGGGAAGGTGG - Intronic
1017055812 6:150434721-150434743 ATGGAGGTGGGGAGGGAAGGGGG - Intergenic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1019102291 6:169641225-169641247 CTGGAGCTCGGGAGAGGAGGGGG - Intronic
1019117349 6:169775631-169775653 CTGAAGCTCAGGAGAGAAGTAGG + Intronic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1020378436 7:7514748-7514770 TTGGAGGTGGGAAGGGAAGTTGG - Intronic
1020648088 7:10840659-10840681 TTGGGGTCCAGGAGGGAAGTTGG + Intergenic
1021827611 7:24571497-24571519 CTGGGGTTGGGGTGGGAGGTAGG - Intergenic
1021927010 7:25543555-25543577 CTGGAGTTGGGTTGGGCAGTGGG - Intergenic
1021964613 7:25905410-25905432 TTGGAGTTCAGAAGGGAAGAGGG + Intergenic
1022815855 7:33913515-33913537 CTGGAGTAGGGGTGGGCAGTAGG + Intronic
1024482966 7:49884166-49884188 ATGGAGTGTGGGAGGGAAGAAGG + Intronic
1026502915 7:70958144-70958166 GAGGAGTTAGGGAGGCAAGTCGG - Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027890500 7:83967355-83967377 CTGGAGCTGGGGAGAGAAGGGGG - Intronic
1029366323 7:100118918-100118940 TAGGAGTTCGCCAGGGAAGTGGG - Intronic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031979410 7:128115150-128115172 CTGGAGTTCAGGAGGAAACATGG - Intergenic
1033115056 7:138617840-138617862 GTGGAGGTGGGGAGGAAAGTAGG + Intronic
1034259241 7:149744482-149744504 GTTGAATTCGGGTGGGAAGTAGG - Intergenic
1034590172 7:152131854-152131876 CTGGAGTGAGGGAGGGTAGTGGG + Intergenic
1034911551 7:155002638-155002660 GGGGAGTGCGGGAGGGAAGGCGG - Intronic
1035059865 7:156061605-156061627 ATGGGGTTGGGGTGGGAAGTGGG - Intergenic
1036260454 8:7235748-7235770 CTGGAGTTCTGGATGGGCGTGGG + Intergenic
1036306161 8:7603774-7603796 CTGGAGTTCTGGATGGGCGTGGG - Intergenic
1036312491 8:7694304-7694326 CTGGAGTTCTGGATGGGCGTGGG + Intergenic
1036357006 8:8051759-8051781 CTGGAGTTCTGGATGGGCGTGGG - Intergenic
1037600696 8:20391497-20391519 ATGGAGTGGGAGAGGGAAGTGGG + Intergenic
1037674668 8:21043194-21043216 TTGGAGGTCGGGGGGGAGGTGGG - Intergenic
1038453804 8:27658364-27658386 CAGGACTTCTGGAAGGAAGTTGG + Intronic
1039061279 8:33573953-33573975 CTGGAGTTCTGGGTGGATGTGGG + Intergenic
1039469311 8:37803589-37803611 CTGGAGTTTGGGAAGGATGGGGG - Intronic
1040610175 8:48976367-48976389 CTGGAGCTCTGGAGGGGATTAGG - Intergenic
1040730314 8:50438097-50438119 CTGGAATTCGGGAGCTAAGCTGG - Intronic
1042512592 8:69626782-69626804 CTGGAGTTCCGGATGGGCGTGGG - Intronic
1042973159 8:74433304-74433326 GTGGAGTTAGGAAGGGAAGGGGG - Intronic
1044433701 8:92137515-92137537 ATGGAGTTTGGGAGGGGAGGAGG - Intergenic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047642122 8:126832136-126832158 CATGAGTTCAGGAGGGAGGTAGG + Intergenic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1048007477 8:130431177-130431199 CAGGAGTCTGGGAGGGAAGATGG - Intronic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048484302 8:134832537-134832559 CTGGGGTTTGGGAGGTAATTTGG + Intergenic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1049027672 8:140006813-140006835 CTAGGGTGCGGGAGGGAAGTAGG + Intronic
1049153888 8:141055489-141055511 CTGGACTGCGGGAAGGGAGTGGG + Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1050062080 9:1719854-1719876 CTGGAGGTGGGGAGTGAAGGAGG + Intergenic
1050301559 9:4264016-4264038 CTGGAGCTCTGGAGTGAAGTGGG - Intronic
1051473167 9:17473077-17473099 CTTGGGTTCAGGTGGGAAGTAGG - Intronic
1053578214 9:39374755-39374777 CTGGACTTGGGGTGGGGAGTGGG - Intergenic
1053842744 9:42202803-42202825 CTGGACTTGGGGTGGGGAGTGGG - Intergenic
1054099797 9:60933566-60933588 CTGGACTTGGGGTGGGGAGTGGG - Intergenic
1054121196 9:61209189-61209211 CTGGACTTGGGGTGGGGAGTGGG - Intergenic
1054586547 9:66973319-66973341 CTGGACTTGGGGTGGGGAGTGGG + Intergenic
1054835605 9:69672389-69672411 CTGGAGGGCGGGAGGGAGGGTGG - Intergenic
1055266182 9:74498175-74498197 CGGGAGTTCTGGAGGGACGCGGG + Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1058432256 9:104929485-104929507 CTGGAGGTGGGAAGAGAAGTAGG - Intergenic
1058506348 9:105669896-105669918 CTGGAGTTGGGGAGGAAGGAGGG + Intergenic
1058786467 9:108393555-108393577 CTGGAGTTCCGGATGGGCGTGGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1060594258 9:124839032-124839054 CTGGAGTTCCGGATGGGTGTGGG - Intergenic
1061319595 9:129819880-129819902 CTGGAGTGCTGGAGTGCAGTGGG - Intronic
1062138681 9:134943764-134943786 CAGGACCTCGGGAGGGAAGAAGG - Intergenic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1188470377 X:30531071-30531093 CTGGAGTTTGGGAGTGCAATGGG + Intergenic
1190891979 X:54577568-54577590 CTGGAGGTGGTGAGGGAAATGGG - Intergenic
1190963987 X:55280333-55280355 CTGGAACTAGGGAGGAAAGTGGG + Intronic
1191618663 X:63192881-63192903 CTGGAGTTCCGGATGGGCGTGGG - Intergenic
1192369239 X:70499692-70499714 CTGGAGATTGGAAGAGAAGTAGG + Intronic
1193541607 X:82779658-82779680 GTGGGGTTTGGGAGGGAGGTAGG + Intergenic
1193884576 X:86969621-86969643 CTGGAGTTCGCGAGCCAAGATGG + Intergenic
1194603241 X:95949468-95949490 CTGGAGTCCAAGAGGGATGTAGG - Intergenic
1196767609 X:119262393-119262415 TTGGAGGTAGGGAGGGAGGTAGG + Intergenic
1198557911 X:137815612-137815634 CTGGAGATAGGAAGGGATGTGGG + Intergenic
1198679870 X:139170033-139170055 ATGGAGTTCAGGTGGGAATTGGG - Intronic
1198972621 X:142298557-142298579 CTGGAGTTCCGGGTGGACGTGGG - Intergenic
1199511913 X:148631753-148631775 GAGGAGTTAGGGAGGTAAGTGGG + Intronic
1199559296 X:149146191-149146213 CTGGGGTGGGGGTGGGAAGTTGG + Intergenic
1200104029 X:153702565-153702587 GTGGCGTTCAGGAGGGGAGTGGG - Intronic
1200232097 X:154449183-154449205 CAGGAGTTGGGAAGGGAAGGCGG - Intronic