ID: 1119986806

View in Genome Browser
Species Human (GRCh38)
Location 14:79147631-79147653
Sequence TGAAGGCTTCTGGACAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119986806 Original CRISPR TGAAGGCTTCTGGACAAAGT TGG (reversed) Intronic
900714857 1:4137840-4137862 GGAGGGCTTCTGGAGGAAGTGGG - Intergenic
901254820 1:7813929-7813951 TAAAGGCTAGTGGACAAAGTGGG + Intronic
905311786 1:37054142-37054164 TGTAGGGTTCTGGGCAAAGTGGG + Intergenic
906111067 1:43322467-43322489 TGAAGGCATCAGGCCACAGTTGG - Intronic
907765675 1:57408383-57408405 TGAATGCTTCTGGAACAAATGGG + Intronic
909247127 1:73300417-73300439 GCAAGGCTTCTGGTAAAAGTAGG + Intergenic
909330583 1:74405132-74405154 TGAAGGCTTCTAGAAAGAGATGG + Intronic
912717464 1:111991901-111991923 TGGAGGCTTCAGGAGACAGTTGG + Intergenic
913557596 1:119983676-119983698 TGAAGGCTTCTGAGAAAAGGAGG + Intronic
915326524 1:155083687-155083709 TGGAGGCTTCTGCACACGGTGGG - Intronic
915492693 1:156260036-156260058 TGAAAGCTGCTGGACTAAGCGGG + Intronic
917213200 1:172651317-172651339 TGAAAGCTTCTGGAGAAAAATGG + Intergenic
918071143 1:181134111-181134133 TGAAGGCTGCTGGAGAAATCTGG - Intergenic
919625808 1:199909126-199909148 TGGAGGCTTCAGACCAAAGTAGG + Intergenic
920171537 1:204074964-204074986 TGAAGGGGTCTGGCCAAAGACGG + Intronic
920300629 1:204986506-204986528 TGACGGCTTCTTGAGAACGTGGG - Intronic
923730707 1:236547118-236547140 TGAAGGCTTCAGAAGAAAGAGGG - Intronic
1063512223 10:6656577-6656599 TGTAGACTTCTGGACAGAGAAGG + Intergenic
1065298966 10:24303402-24303424 AGGAGGCTCCTGGACAACGTAGG + Intronic
1067228042 10:44387990-44388012 TGAAGACTTCAGGAGAAGGTGGG - Intergenic
1069608023 10:69752455-69752477 TGGATGCTTCTGGAGAAAGGAGG + Intergenic
1071016435 10:81002345-81002367 TGAAGGCTTCTGGTGAGAGCAGG - Intergenic
1072016036 10:91347572-91347594 AGAAGGTTACTAGACAAAGTAGG - Intergenic
1073362826 10:102914014-102914036 TGAAGGATTCTGGAAAGAGAGGG + Intergenic
1079280610 11:19083688-19083710 TGAAAGCTCTTTGACAAAGTGGG - Intergenic
1080088683 11:28317264-28317286 TGAATGGTTCTGGAGAAAATTGG - Intronic
1080208189 11:29755585-29755607 TGCAGCCTGCTGGACCAAGTGGG - Intergenic
1081384551 11:42456308-42456330 TGAAGTCATCTGGAAAAAGGCGG - Intergenic
1081427284 11:42939262-42939284 TGAAAGTTGATGGACAAAGTAGG + Intergenic
1081509160 11:43751444-43751466 TGAAGACCACTGGACAAAGCAGG + Intronic
1084661285 11:70548036-70548058 TGCAGCCTTCTGGGCAAAGGAGG + Intronic
1085064891 11:73485753-73485775 GCAGGGCATCTGGACAAAGTAGG - Intronic
1085338198 11:75713579-75713601 TGAAGGCTACTGGAGAAATGTGG - Intergenic
1087684035 11:101243469-101243491 TGAAGCTTACTGGAGAAAGTAGG - Intergenic
1089109216 11:116041840-116041862 TGAAAGCTTCAGGACATAGATGG - Intergenic
1094409526 12:30154436-30154458 TGCATTCTACTGGACAAAGTAGG + Intergenic
1097106439 12:56629080-56629102 TGAAGCCTTCTGGGCAAGCTTGG - Intronic
1097587745 12:61534603-61534625 TTTGGGCTTCTGGACAAATTAGG + Intergenic
1097988478 12:65809314-65809336 TGTAGACTTCTGGAAAAATTTGG + Intergenic
1098068678 12:66648118-66648140 TGAAGGCTTCTAGGTGAAGTGGG - Intronic
1098100569 12:67011647-67011669 TGAAACCTTCTTGAGAAAGTAGG - Intergenic
1100052876 12:90471543-90471565 TGACTGCTTTTGGACAAAGGAGG + Intergenic
1100216632 12:92456706-92456728 GGAAGGCGTCTGGAAAGAGTTGG + Intergenic
1100983952 12:100187432-100187454 TGGAGGCTCCAGGGCAAAGTCGG - Intergenic
1102724183 12:115044186-115044208 TGAAGGCTTCTTAAAAAATTTGG + Intergenic
1106786512 13:33113249-33113271 AGAAGGCTTCTGGGTGAAGTTGG + Intronic
1109512479 13:63397070-63397092 TGCAGCCTTCTGGGCCAAGTGGG + Intergenic
1110374906 13:74782409-74782431 TGAAGGCTTTTGGGCAAACCAGG - Intergenic
1114437990 14:22723937-22723959 TGACCGCTTCTTGTCAAAGTTGG - Intergenic
1117926840 14:60789979-60790001 TGAATGTTTATGCACAAAGTTGG + Intronic
1118903966 14:70010176-70010198 CCAAGGCTGCTGGACAAAGTAGG - Intronic
1119514451 14:75237017-75237039 TCATGGCTTCCAGACAAAGTGGG + Intergenic
1119986806 14:79147631-79147653 TGAAGGCTTCTGGACAAAGTTGG - Intronic
1128063145 15:64747797-64747819 TGAATGCTTCTGGGGAGAGTCGG - Intronic
1130775923 15:86982800-86982822 GTAAGGCTTCTGGTCAAAGTAGG + Intronic
1131016091 15:89058834-89058856 TGCAGGCTTCTGTCCAACGTTGG - Intergenic
1133714450 16:8433474-8433496 TGAAAGCTTCTGCTCAAAGGAGG - Intergenic
1133763700 16:8820691-8820713 TGAAGGCATCTGAGGAAAGTGGG + Intronic
1135185535 16:20312502-20312524 TGGACGCTTCTGGACAAGGAGGG - Intronic
1135559567 16:23465559-23465581 TGAAGGGTTTTGGTCAAAATGGG - Exonic
1135908035 16:26531477-26531499 TGGAGGCTTCTGGAGAGTGTAGG - Intergenic
1135955360 16:26952340-26952362 TCAGGGATTCTGGAAAAAGTGGG - Intergenic
1137959643 16:52869407-52869429 TGAAGGACTTTGGACAAAGTTGG + Intergenic
1140815607 16:78618147-78618169 TGAAGGCCACAGCACAAAGTGGG + Intronic
1144146800 17:12406574-12406596 TAAAGGATTCTGGAAAAAATGGG + Intergenic
1149637175 17:58180385-58180407 TGAAGGGATCTGCACACAGTAGG - Intergenic
1151986835 17:77549004-77549026 GCAAGGCTTCTGGAAAGAGTTGG + Intergenic
1153255467 18:3165995-3166017 TGCAGGCTCCTGGGCACAGTGGG - Intronic
1155238173 18:23842240-23842262 TGAAGGCTTCTGGGTGAAGATGG + Intronic
1156763323 18:40620237-40620259 TGAAGAATTCTGAAGAAAGTTGG - Intergenic
1160519710 18:79497661-79497683 TGAAGGCTTCGGTACAGAGAGGG + Intronic
1161306497 19:3572122-3572144 TCTAGGCTTCTGGCCCAAGTTGG - Intronic
1162350414 19:10145458-10145480 GGAAGGCATCTGGAAAACGTTGG + Intronic
1162913768 19:13863824-13863846 TGAAGGCAGCTGGACGATGTGGG + Intronic
1163968637 19:20771566-20771588 TTAAGGCCTCTAGACAAAGCAGG + Intronic
925355516 2:3238467-3238489 TTAAGGCTAATGCACAAAGTGGG + Intronic
925634291 2:5927656-5927678 GTAAGGCTTCTGGTCAAAATAGG + Intergenic
926124875 2:10265772-10265794 TGCAGGCTTCTGCACGAGGTGGG + Intergenic
926409838 2:12591422-12591444 TAAAGGCCTCTGAACAAAATGGG + Intergenic
927886167 2:26720372-26720394 TGAGGGCCTCTGCACAAAGCCGG + Intronic
929747486 2:44673734-44673756 TGAAGACTGCAGGACAAAGAAGG + Intronic
930446955 2:51486067-51486089 TGATGGCTGCTGGAAAAAATAGG - Intergenic
931500270 2:62857031-62857053 TGTAGACTTCTAGACAAGGTTGG + Intronic
931974368 2:67626931-67626953 TGAAGGATTTTAGACAATGTGGG - Intergenic
934168271 2:89316867-89316889 TGAAGGACTCGAGACAAAGTTGG - Intergenic
934199016 2:89865715-89865737 TGAAGGACTCGAGACAAAGTTGG + Intergenic
934861642 2:97768551-97768573 TTAAGGCTTCTGAATAAAATGGG + Intronic
935088038 2:99867606-99867628 TCAAGGCTTTTGGAGAAAGGGGG - Intronic
936287024 2:111188849-111188871 TGAAGGCTTCTGGACTGACAGGG + Intergenic
937218601 2:120328511-120328533 GGAAGGTTTCTGCACAAAGCAGG - Intergenic
937952524 2:127399452-127399474 AGACTGCTTCTGGCCAAAGTTGG + Intergenic
940711059 2:157164417-157164439 TGAAGCCTGCTGGGCAGAGTGGG - Intergenic
944146898 2:196515326-196515348 TGCAGGCTGCTGGGCCAAGTGGG + Intronic
945256528 2:207807855-207807877 TGAAGATTTCTGGAAAAAGGTGG + Intergenic
947173468 2:227336579-227336601 TGATGGCTTCTGTATAAAGCTGG - Intronic
948210183 2:236187220-236187242 TCAAGGCTGCTGGAGAAACTTGG - Intergenic
1169199005 20:3698606-3698628 TGAAGGCTTCTGGAGACAGTTGG + Intronic
1172116443 20:32576144-32576166 TGGAGGGTTCTGGACAGAGGAGG + Intronic
1173726290 20:45300641-45300663 AGAAGGCTTGTGCACAAAGGAGG + Intronic
1174423663 20:50416920-50416942 TGAAGGCTTCTGGGAATAGTGGG - Intergenic
1174857720 20:54063037-54063059 TGAAGCCTTCTGTTCACAGTTGG + Intronic
1175023823 20:55880445-55880467 TGATGGCCTCTGGATGAAGTTGG - Intergenic
1175496727 20:59419635-59419657 TGAAGGCTTCTTGAAGAAGCTGG - Intergenic
1175692323 20:61074475-61074497 TGAAGGCTTCAGAACAAAAGAGG - Intergenic
1177633996 21:23763414-23763436 CGAATGCTTCTGGATAAATTAGG + Intergenic
1178755029 21:35340695-35340717 TGGAAGCTTCTGGAAACAGTAGG + Intronic
1178999593 21:37444450-37444472 TGAAGGCTTCCGTACTTAGTAGG - Intronic
1179676102 21:42983229-42983251 TGAAGGGTTCTGGAGACAGATGG - Intronic
1181392210 22:22591793-22591815 TGAAAACATCTGGACAAATTTGG + Intergenic
1182264715 22:29105190-29105212 AGAGGGCTTCTGGAAAGAGTGGG + Intronic
1183045589 22:35217126-35217148 TGAGGGCTTCAGGAGATAGTGGG + Intergenic
950251760 3:11471309-11471331 TGAAGGCTTGAAGACCAAGTAGG - Intronic
956608913 3:71101928-71101950 TTAAAGCTGCTGGACACAGTTGG - Intronic
958114169 3:89193027-89193049 TGAAATCTTTTGTACAAAGTTGG + Intronic
959489079 3:106965691-106965713 TGAAGACTTGTGGAAACAGTGGG + Intergenic
961141034 3:124556462-124556484 TGAAGGCTTCTCCAGAAACTAGG - Intronic
961651478 3:128418660-128418682 TCAAGGGTGCTGGGCAAAGTTGG - Intergenic
967056198 3:185830701-185830723 TAAAAGCATCTGGACAAAATAGG + Intergenic
967057710 3:185844205-185844227 TGAAAGTTTCTAGACAAAGTTGG + Intergenic
967407257 3:189131058-189131080 TGAACTGTTCTGGGCAAAGTGGG - Intronic
967728205 3:192881704-192881726 GGAAGGCTTCTGGAGAAACCTGG + Intronic
969932925 4:10649706-10649728 TGAAGGTTTCTAGACAATCTAGG - Intronic
970259924 4:14213406-14213428 TGAAGGCTTCTCTGAAAAGTGGG + Intergenic
971403944 4:26302782-26302804 TGAAGTCTCTTGGACTAAGTTGG + Intronic
974276350 4:59725048-59725070 TGAAGGATTCTGAAAAAATTGGG - Intergenic
974856721 4:67469676-67469698 TGAGGGCTGCCTGACAAAGTAGG + Intergenic
977528952 4:98177054-98177076 TTAAGGATTCTGGACAGAGGAGG - Intergenic
978395166 4:108271170-108271192 TGAAATCTTCTGAATAAAGTAGG - Intergenic
979312251 4:119217156-119217178 TGATGGCTTCTTGACAAGGATGG - Intronic
980231844 4:130055626-130055648 TGAGGGGTTATTGACAAAGTGGG + Intergenic
982721542 4:158865038-158865060 GGAAAGGTGCTGGACAAAGTAGG - Intronic
982939990 4:161538441-161538463 TGAATGCTTCTGGAATAATTTGG - Intronic
983491451 4:168394543-168394565 TGAAGGCTTTAGCACAAAGGGGG - Exonic
986880740 5:12167535-12167557 TGAAGCCATCATGACAAAGTGGG + Intergenic
986886885 5:12249658-12249680 TGAAGGCAACTGGGCAAGGTAGG - Intergenic
987367990 5:17167090-17167112 TGGAGGTTGGTGGACAAAGTAGG + Intronic
989483715 5:41963509-41963531 GTAAGACTTCTGGTCAAAGTAGG - Intergenic
990552799 5:56900940-56900962 GACAGACTTCTGGACAAAGTAGG - Intergenic
991615447 5:68492561-68492583 TAATGGCCTCTGGTCAAAGTAGG - Intergenic
994040961 5:95259435-95259457 TTAAGGCCTCCAGACAAAGTGGG - Intronic
997435058 5:133867935-133867957 AGACGGCTTCTGGAGGAAGTGGG - Intergenic
997756989 5:136408627-136408649 AGAAGGCTTGGGGACAGAGTTGG + Intergenic
997898447 5:137741069-137741091 TGAATGATTCTAAACAAAGTTGG - Intergenic
998815070 5:146005731-146005753 TGAAATTTTATGGACAAAGTAGG - Intronic
1000536635 5:162486138-162486160 TGAAGACTCGTTGACAAAGTAGG + Intergenic
1001087469 5:168711092-168711114 TGAAGGCTACTGGCCAAGCTGGG - Intronic
1002064766 5:176646627-176646649 TAAATACTTCTGAACAAAGTTGG + Exonic
1003955450 6:11161256-11161278 AAAAGGTTTCTGAACAAAGTTGG - Intergenic
1005474697 6:26196511-26196533 TGGAGGCTGCTGGAGAAGGTTGG + Intergenic
1006542894 6:34754859-34754881 TGAAGGTACCTGGACAAAGGTGG + Intergenic
1007943247 6:45801815-45801837 AGAAAGCTTCTGGCCAAATTTGG + Intergenic
1008112419 6:47507249-47507271 TGAAGGGTTCAAGACTAAGTGGG - Intronic
1008494809 6:52122164-52122186 TGAAGGCTTTGGTACATAGTAGG + Intergenic
1008704743 6:54144300-54144322 GGAATGCTTCTGGAAGAAGTTGG + Intronic
1011226360 6:85111771-85111793 AGAAGGCTTTTGGACAAAATAGG - Intergenic
1013335661 6:109157761-109157783 TGAAGGCTTCTGAGAAGAGTAGG + Intronic
1013375300 6:109508919-109508941 TGAAGGCTTTTGGACAACTCAGG + Intronic
1015699455 6:136019678-136019700 GTAAGGCTTCTGGTCAAAATAGG - Intronic
1017538140 6:155370778-155370800 TCAAGGTTTCTGGAGAAGGTTGG + Intergenic
1017592064 6:155988825-155988847 ACAAGGCTTATGGAGAAAGTAGG - Intergenic
1018703492 6:166446433-166446455 TGAAGTTCCCTGGACAAAGTTGG - Intronic
1019969262 7:4527010-4527032 TGAAGGAATCTGGACAAAGAAGG - Intergenic
1021643584 7:22765201-22765223 TGGGGGCTTCTGGATAAAGATGG + Intergenic
1022028823 7:26473135-26473157 TGATTGCTTCAGGACACAGTGGG - Intergenic
1024395123 7:48857733-48857755 TGTAGGCTCCAGGACAGAGTGGG + Intergenic
1024400149 7:48914953-48914975 TGTAGGCTCCAGGACAGAGTGGG - Intergenic
1025022220 7:55488827-55488849 TGCAGGCATCTGCACAAAGCAGG - Intronic
1025247472 7:57328171-57328193 TGAAGGCTTCTGGGAATAGTGGG + Intergenic
1031212696 7:118850905-118850927 TAATGTCTGCTGGACAAAGTAGG + Intergenic
1031377588 7:121047227-121047249 TGCAGACTTCTAGATAAAGTTGG - Intronic
1034397184 7:150836053-150836075 TGAAGGACTCAGGACAAAGCAGG + Intronic
1035220385 7:157402868-157402890 AGAAGGCTGATGGAGAAAGTGGG - Intronic
1035523632 8:294586-294608 TCAAGACTTCTGGCAAAAGTTGG - Intergenic
1038966386 8:32577527-32577549 AAGAGGCTTCTGGAAAAAGTAGG + Intronic
1039409054 8:37336710-37336732 TGAAGGCTTCTCTACAAAGGAGG + Intergenic
1042992769 8:74658855-74658877 AGAAGGCCACTGGACAAAGTAGG + Intronic
1047942659 8:129840574-129840596 TGAAGCCTTCTGGATAACATTGG - Exonic
1048194711 8:132322830-132322852 TGAAGGCCTTTGAACACAGTTGG + Intronic
1048203170 8:132393920-132393942 TGAAGGAATCTGTACACAGTGGG - Intronic
1050926567 9:11270316-11270338 TGAAGGCCCCTGGACTAATTCGG - Intergenic
1051057551 9:13005416-13005438 TGAAGGTTTCCAGGCAAAGTGGG + Intergenic
1051804933 9:20981737-20981759 TAAAGGCTTCTTGGCAAAGTGGG + Intronic
1055453043 9:76447973-76447995 GGAAGCCATCTGGACAAAGACGG - Intronic
1059620384 9:115998242-115998264 TGAAGGCTGCTTGCCCAAGTGGG + Intergenic
1061738743 9:132683048-132683070 TGCAGGCTACTGGACCATGTTGG + Intronic
1185848365 X:3461923-3461945 TGCAAGCGTCTGAACAAAGTAGG - Intergenic
1186580679 X:10814539-10814561 TGAAGAAATCTGGACAAAATTGG - Intronic
1186743707 X:12544428-12544450 TTAAGGCATCTGCACAAACTTGG - Intronic
1186775255 X:12858089-12858111 TTAAGGCATCTGCACAAACTTGG + Intergenic
1187397303 X:18930005-18930027 TGAATGCTAATGGACCAAGTGGG - Intronic
1187481291 X:19658247-19658269 GGAAAGCTTCTGGAAAAAGATGG - Intronic
1190376719 X:49795633-49795655 TGAAGGTCTCTGGACAGAATGGG + Intergenic
1192355443 X:70398577-70398599 GGAAGGCTTCTGGAAGAGGTGGG - Intronic
1194122190 X:89975247-89975269 TGAATGCTTCTAGCCAAAGAAGG - Intergenic
1195173001 X:102286871-102286893 TGAAGGCTTTGGGGCAAAGATGG - Intergenic
1195185865 X:102400224-102400246 TGAAGGCTTTGGGGCAAAGATGG + Intronic
1195570523 X:106394288-106394310 TGAAGGCTTGGGGACAATGGGGG + Intergenic
1197657232 X:129130056-129130078 TGGAGGCTTCTGGGTAATGTAGG + Intergenic
1198338578 X:135692111-135692133 TGAAGGCTGATGGACAGACTTGG + Intergenic
1199697055 X:150350123-150350145 TGGAGGCTTCTGGAAAATATGGG + Intergenic
1200475044 Y:3632681-3632703 TGAATGCTTCTAGCCAAAGAAGG - Intergenic
1201261881 Y:12166549-12166571 TGAAGCTTTCTTGACAGAGTGGG - Intergenic