ID: 1119988360

View in Genome Browser
Species Human (GRCh38)
Location 14:79166283-79166305
Sequence CCGGCTCCTTCTCAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119988356_1119988360 27 Left 1119988356 14:79166233-79166255 CCTAGAATTCTGGAGTAGTTAAA 0: 1
1: 0
2: 0
3: 22
4: 233
Right 1119988360 14:79166283-79166305 CCGGCTCCTTCTCAGTTTGAGGG 0: 1
1: 0
2: 3
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119988360 Original CRISPR CCGGCTCCTTCTCAGTTTGA GGG Intronic
900526395 1:3130947-3130969 CCAGCACCTTCTGAGTTTGTGGG + Intronic
907050410 1:51326297-51326319 CCATCTTGTTCTCAGTTTGATGG - Intronic
907487305 1:54786910-54786932 CAGGCTCCTTCTCAGTTTAGAGG + Intronic
907946403 1:59140092-59140114 CAGGCTGCTTCTCTGTTTGCTGG - Intergenic
911845332 1:102745647-102745669 CCCTCTCCTTCTCCTTTTGATGG + Intergenic
913469974 1:119177693-119177715 CCCTCTCCTTCCCATTTTGATGG - Intergenic
914050615 1:144127209-144127231 CCGGCTCCTTGCCAGGCTGATGG - Intergenic
914128567 1:144838236-144838258 CCGGCTCCTTGCCAGGCTGATGG + Intergenic
915261014 1:154676865-154676887 CCCTCTCCTTCCCATTTTGATGG - Intergenic
915417972 1:155757070-155757092 CCAACTCCTTCTCAGTTTGATGG - Exonic
916404955 1:164489152-164489174 CCGGCTCCTTCTCAGTTTTTAGG - Intergenic
920435846 1:205946627-205946649 CCGGCTCCTTCTCTGTCCGCTGG - Intergenic
920756476 1:208738497-208738519 CCCTCTCCTTCCCATTTTGATGG - Intergenic
924458542 1:244237772-244237794 CCGGCTCATTCTCATCTTTAAGG - Intergenic
1065654374 10:27932657-27932679 CTGCCTCCTTCTCAGTTTTTAGG + Intronic
1068918312 10:62457283-62457305 CTGCCTCCTTCTCACTTTCATGG - Intronic
1071069244 10:81671855-81671877 CTGGCTCTTTCTCAGCTAGAGGG - Intergenic
1071797247 10:89020016-89020038 CAGGCTATTTCTCTGTTTGAAGG - Intergenic
1072092612 10:92143729-92143751 CTGGCTCCTACTCAGGTTTAGGG + Intronic
1072638563 10:97193550-97193572 CCAGCTCCTTCTAAGTTTCTTGG - Intronic
1077349337 11:2085073-2085095 CCGCCTCCTGCTCAGTCTGGTGG - Intergenic
1079584572 11:22110078-22110100 CCTCCTCCTCCTCAGTGTGAAGG - Intergenic
1079730764 11:23936196-23936218 CCTTCTCCTTCCCATTTTGATGG + Intergenic
1080622269 11:33996731-33996753 CTGGCTCCTTCTCAGTTGAAGGG + Intergenic
1081421877 11:42880354-42880376 CCCTCTCCTTCCCATTTTGATGG - Intergenic
1084654496 11:70507192-70507214 ACGTCACCTTCTCAGCTTGAGGG + Intronic
1091538468 12:1436334-1436356 CCGGCTCCTTCTCAGTCCATAGG - Intronic
1092472762 12:8793652-8793674 CCCTCTCCTTCCCATTTTGATGG - Intergenic
1093527298 12:20116763-20116785 CCCTCTCCTTCCCATTTTGATGG + Intergenic
1093763471 12:22936771-22936793 TTGGCTCCTTCCCAGTTTGGAGG - Intergenic
1095225913 12:39675986-39676008 CTGGTTCCTTCTCATTTGGATGG - Intronic
1096086078 12:48865861-48865883 CGGCCTCCTCCTCAGTTGGAGGG - Exonic
1097141858 12:56908783-56908805 CCCTCTCCTTCTCAGTTGGTGGG + Intergenic
1097264892 12:57738955-57738977 CCGCCTCCTCCTCAATGTGAGGG - Intronic
1097730740 12:63125416-63125438 TCAGCTCCTTCCCAGTTTGGGGG - Intergenic
1099894965 12:88633947-88633969 TCAGCTCCTTCCCAGTTTGGAGG - Intergenic
1106620135 13:31364777-31364799 CCTGCCCCTTCTGAGTTTGGAGG + Intergenic
1106730842 13:32539976-32539998 CCGGCTGCTTATTAGTTTTAAGG - Intergenic
1106732380 13:32554798-32554820 CTGGCTCCTTCTATGTTTGGAGG + Intergenic
1109531189 13:63650250-63650272 TCGGCTCCTTCCCAGTTTGGGGG + Intergenic
1112519587 13:100083651-100083673 CCCTCTCCTTCCCATTTTGATGG - Intergenic
1112890367 13:104222143-104222165 CAGGCTCCTTCACAGGGTGAAGG + Intergenic
1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG + Intergenic
1117819449 14:59632500-59632522 CTGGCTGCTTTTCAGTTGGAGGG + Intronic
1119988360 14:79166283-79166305 CCGGCTCCTTCTCAGTTTGAGGG + Intronic
1120568903 14:86093427-86093449 ACAGCTCATTCTCAGTTTCATGG + Intergenic
1121097357 14:91226960-91226982 CAGCCTCCTTCTCAATTTCATGG - Intergenic
1121704463 14:95981383-95981405 TCTGCTCCTTCTCAGCTGGAAGG - Intergenic
1122954969 14:105066281-105066303 CAGGCTGCTTCTGAGTTTCAGGG + Intergenic
1123006492 14:105326325-105326347 CTCGCTCCTGGTCAGTTTGAGGG + Intronic
1123445374 15:20327006-20327028 CCGGCTCCTTGCCAGGCTGATGG + Intergenic
1124170793 15:27370949-27370971 CCTGCTCCTTCTCAAACTGAAGG + Intronic
1132992964 16:2806584-2806606 GCGGCCCTTTCTAAGTTTGAGGG + Intergenic
1135385791 16:22038375-22038397 CTGGCTCCTTCTCATTACGATGG - Intronic
1135459193 16:22626997-22627019 TTGGCTCCTTCCCAGTTTGGGGG - Intergenic
1135809633 16:25575764-25575786 CCAGCTCCTTCTAAGTGTGTTGG - Intergenic
1138666365 16:58572517-58572539 CCAGCTACTTCAGAGTTTGAGGG + Intronic
1142737040 17:1907693-1907715 CCGGCCCCTTCTCCATTTGGGGG - Intergenic
1142859430 17:2751987-2752009 CCAGTTCCTTCTCAGTTAAATGG + Intergenic
1147031707 17:37643287-37643309 CCTGCTCCTTCTCAGTTACTCGG + Intronic
1149088616 17:52751185-52751207 CCGGCCCCTTCTGAGTTGGCAGG + Intergenic
1149163439 17:53722675-53722697 TTGGCTCCTTCCCAGTTTGGTGG - Intergenic
1152148892 17:78586629-78586651 GCGGCTCCCTCTCACTTTGCTGG + Intergenic
1156922809 18:42543346-42543368 CCCTTTCCTTCTCAGTGTGAAGG + Intergenic
1161459628 19:4389098-4389120 AGGGCTCCTTCTCAGAGTGAGGG - Intronic
1162919671 19:13893162-13893184 CTGGCTCCTTTTCTGGTTGACGG + Exonic
1202690022 1_KI270712v1_random:79847-79869 CCGGCTCCTTGCCAGGCTGATGG - Intergenic
927190901 2:20516302-20516324 CCTTCTCCTACTCAGTTTCAAGG + Intergenic
927524188 2:23721882-23721904 CAGCCTGCTTCTCAGATTGAGGG - Intergenic
930955140 2:57195403-57195425 CTGACTCCTTCTCAGTTTAGCGG + Intergenic
933956393 2:87376176-87376198 CCGGCTCCTTGCCAGGCTGATGG + Intergenic
934240541 2:90268201-90268223 CCGGCTCCTTGCCAGGCTGATGG + Intergenic
934620200 2:95798985-95799007 CCTGCTCCTTCTCAGTGTCTGGG - Intergenic
934640688 2:96025572-96025594 CCTGCTCCTTCTCAGTGTCTGGG + Exonic
936062063 2:109301448-109301470 CTGGCCCCTTCGCTGTTTGATGG + Intronic
936066731 2:109338027-109338049 CAGGCTCCTTCTGTTTTTGATGG + Intronic
939742677 2:145929086-145929108 CCGTCTCCTACTGACTTTGAAGG - Intergenic
942307863 2:174626585-174626607 CCCGCCCCATCTCAGTCTGATGG + Intronic
943926046 2:193781968-193781990 CCTGCCACTTCTCAGTTTGGGGG - Intergenic
944729438 2:202502288-202502310 CCCTCTCCTTCCCATTTTGATGG - Intronic
945471623 2:210234010-210234032 TAGGCTCCTTCCCAGTTTGGGGG + Intergenic
948799374 2:240424633-240424655 CCTGCTCCTTCTTAGCTTGAGGG + Intergenic
1172186466 20:33034171-33034193 CCTGTCCCTTCCCAGTTTGAAGG + Exonic
1172372750 20:34407727-34407749 CTGGCTCCTTGTCATTTGGATGG + Intronic
1173963435 20:47092633-47092655 CCACCTCTTTCTCAGTTTAATGG - Intronic
1176008622 20:62880215-62880237 CCCCCTCCCTCTCAGTTTGGAGG - Exonic
1177835471 21:26182463-26182485 CCAGCTTCTTCCCAGTTTGGGGG + Intergenic
1182879811 22:33723796-33723818 CCGGGCCCTTCTCAGGTTAAGGG - Intronic
1184033513 22:41908159-41908181 CCTGCTCATTCTCAGTTCCAAGG - Intergenic
949691774 3:6648711-6648733 CCACCTCCTACTCATTTTGAAGG - Intergenic
952453475 3:33452019-33452041 CCCTCTCCTTCCCATTTTGATGG - Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
955186221 3:56717815-56717837 CCCTCTCCTTCCCATTTTGATGG - Intergenic
956095824 3:65714929-65714951 CCTGCTCCTTCTGAGTTTCGGGG - Intronic
957014609 3:75048304-75048326 ACGGCTCCTTCTGTGTTTCATGG - Intergenic
959722207 3:109504975-109504997 CTGGTTCCTTCTCAGTTGGTAGG + Intergenic
960132382 3:114071181-114071203 CCGGTCACTTCTGAGTTTGAGGG - Intronic
961321898 3:126082621-126082643 CCGTTTCCTCCTCAGTCTGATGG - Intronic
963021548 3:140876786-140876808 CCCTCTCCTTCTCCTTTTGATGG - Intergenic
965229348 3:166029900-166029922 CCGCCTCCTTCTGAGTTGGTGGG - Intergenic
966492848 3:180548145-180548167 TTGGCTCCCTCTCAGTTTGGGGG + Intergenic
968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG + Intronic
972203819 4:36747642-36747664 CCCGCTCCTTCTGAGTTGGCAGG + Intergenic
974524040 4:63025318-63025340 CCTGCTCCTTCTCTGTTGGGTGG + Intergenic
975372693 4:73606953-73606975 CAGGCTCGTGCTCAGGTTGATGG - Intronic
975595393 4:76044813-76044835 CCCTCTCCTTCCCATTTTGATGG + Intronic
977331642 4:95644075-95644097 TCAGCTCCTTCCCAGTTTGGAGG + Intergenic
978670811 4:111245021-111245043 CTGGTTCCTTCTCATTTGGATGG - Intergenic
980703028 4:136457269-136457291 CCTGCTCCTTCTGAGTTGGTGGG + Intergenic
981650219 4:147048919-147048941 CTGGCTCCTTCTCACTTTTTAGG + Intergenic
985238235 4:187900541-187900563 GCCTCTCCTTCTCAGTTTGCTGG - Intergenic
986500918 5:8399350-8399372 TCAGCTCCTTCCCAGTTTGGGGG - Intergenic
989400215 5:41000480-41000502 CTGGCACCTTCCCAGTTTCAAGG + Intronic
989957748 5:50375717-50375739 CCCTCTCCTTCCCATTTTGATGG - Intergenic
992497912 5:77311068-77311090 CTGGCCCCTTGTCAGTCTGAAGG - Intronic
1000085642 5:157885437-157885459 CCATCTCCTTCCCACTTTGATGG - Intergenic
1000123974 5:158225658-158225680 CTGGCTCATTCTCAGTTTCCTGG + Intergenic
1002365850 5:178710226-178710248 TCGGCTCCTTCCCAGTTTGAGGG - Intergenic
1002810428 6:623020-623042 CCTGCTCCTTCTGAGGATGAGGG - Intronic
1002880103 6:1243329-1243351 CTGGTTCCCTCTAAGTTTGACGG - Intergenic
1005214631 6:23510852-23510874 CCAGCTGTTTCTCAGTTTGTTGG - Intergenic
1005749304 6:28868305-28868327 CCGGGACCTTCCCAGTTTGGGGG - Intergenic
1009407298 6:63327869-63327891 CCCTCTCCTTCCCATTTTGATGG + Intergenic
1009589739 6:65651986-65652008 TAGGCTCCATCTCACTTTGATGG + Intronic
1009624306 6:66118778-66118800 CTGGCTGCTTCTCATTTTTAGGG + Intergenic
1012838151 6:104295908-104295930 TTGGCTCCTTCCCAGTTTGAAGG - Intergenic
1013302858 6:108820348-108820370 CTGGCTCATTTTCAGTTTGCAGG + Intergenic
1015843792 6:137497534-137497556 CCTGCTCCTTCTCGGGTTCAGGG - Intergenic
1019312552 7:369774-369796 CCGGTTCCTTATCTGTTTAATGG - Intergenic
1019959576 7:4447977-4447999 CCGGCTCCTTCTCAGCCTCCAGG + Intergenic
1020825432 7:13021715-13021737 GCGGGGCCTTCTCATTTTGAAGG + Intergenic
1021111137 7:16696034-16696056 CCGGCTCCTTCTGCTTTTGAAGG + Intronic
1022977166 7:35569410-35569432 CCTGCTTCTACTCAGTTTTATGG + Intergenic
1023704729 7:42929819-42929841 CAAGCTCCTTCCCAGTTTCAGGG + Intronic
1033480458 7:141735128-141735150 TCGGCTTCCTCTCAGTTTGGGGG + Intergenic
1034731232 7:153389170-153389192 TTGGCTCCTTCCCAGTTTGCAGG + Intergenic
1035320345 7:158025203-158025225 GCGCCTCCTTGTCAGTGTGATGG + Intronic
1039084752 8:33768863-33768885 CCGTGTCATTCTTAGTTTGATGG - Intergenic
1041985913 8:63922401-63922423 CCTGGTCTTTCTCAGTTTAATGG + Intergenic
1043348542 8:79330198-79330220 CCCACTCCTTCACAGCTTGAGGG - Intergenic
1043421631 8:80104242-80104264 CCAGCTCCTTCCCAGTTTGGGGG + Intronic
1043737863 8:83769328-83769350 CTGCCTCCTTCCGAGTTTGAGGG - Intergenic
1047448548 8:124941862-124941884 CCGGCTCCTTCACTCTTTTATGG + Intergenic
1055366545 9:75550344-75550366 TCGTCTCCTTCTAAGTTTGGGGG - Intergenic
1059257783 9:112946362-112946384 TCAGCTCCTTCTCAGTTTGGGGG - Intergenic
1060135319 9:121147917-121147939 CCTTCTCCTTCTCAGTCTGTAGG - Intronic
1061273379 9:129556580-129556602 CTGGCTCCTTCTCAGCTTTCAGG - Intergenic
1062111378 9:134783865-134783887 CCAGCGGCTTCTCGGTTTGATGG + Intronic
1187180019 X:16935385-16935407 CAGCCACCTTCTCAGTTTGTTGG + Intergenic
1190145199 X:47884664-47884686 CCACCAACTTCTCAGTTTGAAGG - Intronic
1191225778 X:58041284-58041306 CTGGCTCTTTCTCATTTTGTGGG - Intergenic
1195947157 X:110227464-110227486 CTTTCTCCTTCTCAGTATGACGG - Intronic
1199433035 X:147782233-147782255 CCACCACCTTCTCAGTTTGCTGG - Intergenic
1200316103 X:155134697-155134719 TTGGCTCCTTCCCAGTTTGGGGG + Intronic
1200822880 Y:7606115-7606137 ACAGCTCCTTCTCAGGTTAACGG - Intergenic
1200878037 Y:8180290-8180312 CCAGTTCCTTCTCAGCTTGACGG - Intergenic
1202189942 Y:22231371-22231393 CCAGTTCCTTCTCAGCTTAATGG - Intergenic
1202237175 Y:22724974-22724996 ACAGCTCCTTCTCAGGTTAACGG + Intergenic