ID: 1119998702

View in Genome Browser
Species Human (GRCh38)
Location 14:79279562-79279584
Sequence AAGAAGGACTGGAGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1947
Summary {0: 1, 1: 0, 2: 8, 3: 174, 4: 1764}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119998702_1119998706 -8 Left 1119998702 14:79279562-79279584 CCTCTTTCCCTCCAGTCCTTCTT 0: 1
1: 0
2: 8
3: 174
4: 1764
Right 1119998706 14:79279577-79279599 TCCTTCTTATTCTCTTCCTCTGG 0: 1
1: 0
2: 4
3: 65
4: 642
1119998702_1119998711 17 Left 1119998702 14:79279562-79279584 CCTCTTTCCCTCCAGTCCTTCTT 0: 1
1: 0
2: 8
3: 174
4: 1764
Right 1119998711 14:79279602-79279624 GCGGTGGCTGCTGCTGCTGCTGG 0: 1
1: 2
2: 38
3: 300
4: 1119
1119998702_1119998709 1 Left 1119998702 14:79279562-79279584 CCTCTTTCCCTCCAGTCCTTCTT 0: 1
1: 0
2: 8
3: 174
4: 1764
Right 1119998709 14:79279586-79279608 TTCTCTTCCTCTGGCTGCGGTGG 0: 1
1: 0
2: 1
3: 25
4: 262
1119998702_1119998708 -2 Left 1119998702 14:79279562-79279584 CCTCTTTCCCTCCAGTCCTTCTT 0: 1
1: 0
2: 8
3: 174
4: 1764
Right 1119998708 14:79279583-79279605 TTATTCTCTTCCTCTGGCTGCGG 0: 1
1: 0
2: 3
3: 37
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119998702 Original CRISPR AAGAAGGACTGGAGGGAAAG AGG (reversed) Intronic
900017420 1:162293-162315 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900047679 1:520889-520911 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900069893 1:762757-762779 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900245032 1:1632695-1632717 AAAATGGACTGGAAGGAAACGGG - Intronic
900256263 1:1699854-1699876 AAAATGGACTGGAAGGAAACGGG - Intronic
900295879 1:1949154-1949176 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
900681777 1:3920443-3920465 AAGAAGGAAGGGAGGGACGGAGG - Intergenic
900836881 1:5011593-5011615 TAGAAGGTGGGGAGGGAAAGTGG + Intergenic
900851090 1:5143657-5143679 CAGAAGGCGTGGAGGGACAGCGG + Intergenic
900918547 1:5656134-5656156 AAGGAGGGATGGAGAGAAAGAGG + Intergenic
900932129 1:5744110-5744132 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932159 1:5744186-5744208 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932168 1:5744210-5744232 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932193 1:5744270-5744292 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932812 1:5747567-5747589 AAGAACGGTAGGAGGGAAAGAGG + Intergenic
901266416 1:7914186-7914208 GAGAGGGAAGGGAGGGAAAGCGG - Intergenic
901280072 1:8026744-8026766 AAGAAGCCCTGGAGGGGGAGAGG + Intergenic
901410232 1:9077804-9077826 AGGAAGGACAGGAGGGAGGGAGG + Intronic
901961430 1:12829298-12829320 AAGAAAGAAGGGAGGGAGAGAGG - Intronic
901968016 1:12883905-12883927 AAGAAAGAAGGGAGGGAGAGAGG - Intronic
901975825 1:12943035-12943057 AAGAAAGAAGGGAGGGAGAGAGG - Intronic
901983417 1:13054170-13054192 AAGAAAGAAGGGAGGGAGAGAGG - Intronic
901985590 1:13073165-13073187 AAGAAAGAAGGGAGGGAGAGAGG + Intronic
901996219 1:13153602-13153624 AAGAAAGAAGGGAGGGAGAGAGG - Intergenic
901998672 1:13174748-13174770 AAGAAAGAAGGGAGGGAGAGAGG + Intergenic
902009349 1:13258730-13258752 AAGAAAGAAGGGAGGGAGAGAGG + Intronic
902017160 1:13317875-13317897 AAGAAAGAAGGGAGGGAGAGAGG + Intronic
902035491 1:13454966-13454988 AGAAAGAACTGAAGGGAAAGGGG - Intergenic
902088738 1:13884923-13884945 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
902190293 1:14758158-14758180 AGGAAGGAATGGAGGGAGGGAGG - Intronic
902216484 1:14937484-14937506 AAGAAGGATGGCAGGGAGAGAGG - Intronic
902553811 1:17235138-17235160 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
902698252 1:18154786-18154808 AGAAAGGAAGGGAGGGAAAGAGG - Intronic
902883483 1:19388384-19388406 AGGAAAGAAAGGAGGGAAAGAGG + Intronic
903299712 1:22370134-22370156 AAGAAGGAAGGGAAGGAGAGAGG - Intergenic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
903438757 1:23371321-23371343 AAGAGGGAGTGGAAGGACAGTGG + Exonic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
904104729 1:28069625-28069647 GAGAAGGAAGGAAGGGAAAGAGG + Intronic
904112378 1:28136306-28136328 AAGAAGCTCAGGAGGGCAAGAGG - Intergenic
904318215 1:29679779-29679801 AAGAAGAGAAGGAGGGAAAGAGG - Intergenic
904335417 1:29794115-29794137 AAGGAGGACAGGAGGGAGAGAGG - Intergenic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
904463877 1:30696727-30696749 AAGGAGGAGAGGAGGGAGAGAGG + Intergenic
904464372 1:30699092-30699114 AAGGAGGAGAGGAGGGAGAGAGG + Intergenic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
905258361 1:36700275-36700297 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
905265063 1:36746680-36746702 AAAAAGGACTGTGGGGAGAGGGG + Intergenic
905309111 1:37037372-37037394 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
905309138 1:37037430-37037452 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
905363984 1:37438808-37438830 GAGAGGGATAGGAGGGAAAGGGG + Intergenic
905506873 1:38486670-38486692 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
905564016 1:38948889-38948911 AAGAAGGAAAGGAGGGAAGGAGG + Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905825413 1:41022713-41022735 AAGAAAGGCTTGAGGGAGAGGGG - Exonic
905865493 1:41374193-41374215 AGGAAGGCCAGGAGGGAAGGAGG + Intronic
905893493 1:41531191-41531213 ATGGAGGACTGGAGAGATAGAGG + Intronic
906275226 1:44510288-44510310 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
906740719 1:48181218-48181240 AAGACGGACTTAAGGAAAAGGGG + Intergenic
906807716 1:48795397-48795419 AAGAAGGGGTTGAGGAAAAGGGG - Intronic
907122153 1:52017288-52017310 AAGAAAGAAGGGAAGGAAAGAGG + Intergenic
908496407 1:64699305-64699327 AGGAACCACTGGTGGGAAAGCGG - Intergenic
908524335 1:64973312-64973334 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
908801506 1:67885295-67885317 AAGAAGAAAGGGAGGAAAAGAGG + Intergenic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
908902841 1:68976093-68976115 AAGAAAGAGAGGAGGGAAAGAGG - Intergenic
909069717 1:70980083-70980105 AAGAAGAACTGGAAGGGAGGCGG + Intronic
909101467 1:71354563-71354585 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
909138855 1:71836924-71836946 AGGAAGGACAGGAGGGAGGGAGG + Intronic
909524774 1:76610540-76610562 ATGAAGGCCTGGAGGGAGGGAGG + Intronic
909987414 1:82178700-82178722 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
910051308 1:82977521-82977543 AAGAAGGAAGGGAGGGAGAGAGG - Intergenic
910163314 1:84297704-84297726 AAGAGAGAGTGGAGAGAAAGAGG - Intergenic
910489470 1:87753043-87753065 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
910597974 1:88999575-88999597 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
910751809 1:90639033-90639055 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
910820060 1:91336398-91336420 AAGAAGGGATGGAGGTAAGGAGG - Intronic
910860028 1:91734035-91734057 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
911032137 1:93500453-93500475 AGAAAGGAAGGGAGGGAAAGAGG + Intronic
911049567 1:93659143-93659165 AAGAGGGAATGAAGGGATAGGGG + Intronic
911065848 1:93787242-93787264 TTGAAGGAATGGAGGAAAAGGGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912226823 1:107743248-107743270 AAGAAGGACTGGTTGGGAAGAGG + Intronic
912315711 1:108666082-108666104 AAGCAGGAGTAGATGGAAAGGGG + Intergenic
912349457 1:108997779-108997801 AAGAAGGAAGGAAAGGAAAGGGG + Intronic
912602644 1:110953138-110953160 AGGAAGGAATTCAGGGAAAGGGG - Intronic
912727375 1:112070053-112070075 AAGAGTAACTGGAGGGATAGTGG - Intergenic
913400769 1:118430332-118430354 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
913573135 1:120141533-120141555 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
914294392 1:146306330-146306352 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
914555436 1:148757113-148757135 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
914767514 1:150651865-150651887 CAGAAGGAAAGGAGAGAAAGAGG + Intronic
914880632 1:151543942-151543964 AAGAAGGAAGAGAGGGAAGGAGG - Intronic
914896173 1:151675778-151675800 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
914942131 1:152032609-152032631 CAGAAAGGCTGGAAGGAAAGGGG + Exonic
914991189 1:152501008-152501030 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
915281398 1:154824752-154824774 AGGAAGCAGTGAAGGGAAAGGGG + Intronic
915289127 1:154870996-154871018 AAGAAGGAGAGAAAGGAAAGTGG + Intergenic
915332347 1:155120938-155120960 AAGAAGGAGTGGGAGCAAAGCGG - Intergenic
915388483 1:155518831-155518853 AGGAAGGAATGGAGGGAGGGAGG + Intronic
915878721 1:159643013-159643035 AAGAAGTAAGGGAGGGAGAGAGG + Intergenic
915885428 1:159716491-159716513 AGGAAGGATGGGAGGGAGAGAGG + Intergenic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916238083 1:162610833-162610855 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
916270169 1:162932458-162932480 AAGAAGGACAGGAGGCAGAAAGG - Intergenic
916400205 1:164439470-164439492 ATGAGGCACTGGAGTGAAAGTGG - Intergenic
916414988 1:164584103-164584125 AGGAAGGAAGGGAGGGAGAGGGG + Intronic
916554987 1:165886771-165886793 AAGAAGGCAGGGAGGGAAGGAGG - Intronic
916565713 1:165975004-165975026 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
916611438 1:166395784-166395806 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
916702178 1:167308525-167308547 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
916832104 1:168503669-168503691 AGGAAAGACTGGAGGGGGAGGGG - Intergenic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917070170 1:171141896-171141918 AAGAAGGAGAGGTGGGAAGGAGG - Intronic
917139077 1:171816564-171816586 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
917470559 1:175322778-175322800 AAGAAAGAAAGGAGGGAAGGAGG + Exonic
917562039 1:176168495-176168517 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
917564225 1:176195101-176195123 AAAAAGGAGAGGAGAGAAAGAGG + Intronic
917564228 1:176195118-176195140 AAGAGGGAGAGGAGAGAAAGAGG + Intronic
917737603 1:177934817-177934839 AAGGAGGAATGGAGGGAGGGAGG + Intronic
918029667 1:180793101-180793123 AGGAAGGAAAGGAGGGAGAGAGG + Intronic
918038360 1:180896981-180897003 AAGAAGGAATGAAGGAAGAGAGG + Intergenic
918446476 1:184622215-184622237 AAGGAGGAAGGGAGGGTAAGTGG + Exonic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
918502847 1:185217584-185217606 AGGAAGGGAGGGAGGGAAAGAGG - Intronic
918533519 1:185549214-185549236 AGGCAGGACTGCAGAGAAAGGGG - Intergenic
918546204 1:185687436-185687458 AGGAAGGGAGGGAGGGAAAGAGG - Intergenic
918790246 1:188815941-188815963 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
919094223 1:193010410-193010432 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
919221134 1:194629914-194629936 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
919333026 1:196195314-196195336 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
919392978 1:197010589-197010611 AAGAAGGATGGGAGGGAAGGAGG + Intergenic
919399058 1:197086238-197086260 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
919479920 1:198075610-198075632 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
919509788 1:198447710-198447732 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
919516947 1:198537395-198537417 AAGAAGGAAGGGCGAGAAAGAGG - Intronic
919533237 1:198751841-198751863 AAGAACCACTGAAGGGACAGTGG + Intronic
919728736 1:200899907-200899929 AAAGAGGTCTGAAGGGAAAGGGG + Intronic
919741694 1:200984834-200984856 AAGCAGGGCTGGAGGGCAAGTGG - Intronic
919750098 1:201032219-201032241 AAGCAGGAAGGGAGGGAGAGAGG - Intergenic
919757926 1:201077557-201077579 AGGAAGAGCTGTAGGGAAAGGGG - Intronic
919798703 1:201337521-201337543 AGGAAGGAAGGGAGGGAAAGGGG + Intergenic
920162818 1:204012555-204012577 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
920276003 1:204804785-204804807 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
920317721 1:205090863-205090885 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
921186622 1:212675702-212675724 AAGAAGGAAGGGAAGGGAAGGGG + Intergenic
921285061 1:213602201-213602223 AAGAAGGAATGGAGGGAGGGAGG - Intergenic
921477273 1:215627364-215627386 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
922057441 1:222054962-222054984 AAGAAGGAAGGAAGGGAAAGAGG + Intergenic
922105260 1:222508207-222508229 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922265575 1:223980741-223980763 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922265581 1:223980757-223980779 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922455469 1:225770498-225770520 AAGAAGCACGGTAGGGAAGGTGG - Intergenic
922593324 1:226795424-226795446 AAGATGGACTGGAGAGGGAGAGG - Intergenic
922820786 1:228484067-228484089 AGGAAGGAGTGGAGGGAGAGAGG - Intergenic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
923784457 1:237054172-237054194 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
924040014 1:239975118-239975140 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
924040016 1:239975126-239975148 AGGAAGGAAAAGAGGGAAAGAGG + Intergenic
924040064 1:239975430-239975452 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
924041102 1:239984725-239984747 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
924185562 1:241485752-241485774 CAGAAAGAGTGGAGGGCAAGGGG - Intergenic
924347436 1:243085744-243085766 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
924390205 1:243546414-243546436 AGGAAGAACAGGAGGAAAAGAGG + Intronic
924581869 1:245330484-245330506 AAGAGGGAGTGGGGGGAGAGTGG + Intronic
924581898 1:245330559-245330581 GAGAGGGAGTGGAGGGAGAGTGG + Intronic
924585734 1:245359697-245359719 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1062996440 10:1870995-1871017 AAGAAAGAAAGCAGGGAAAGTGG + Intergenic
1063136510 10:3221521-3221543 AAGTAAGATTGGAGGCAAAGAGG + Intergenic
1063605760 10:7521537-7521559 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1063636248 10:7785829-7785851 AAAAAGGGGTGGAGGGAAAATGG + Intronic
1063698025 10:8356525-8356547 AAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1063755565 10:9003107-9003129 GAGAAGGATGGGAGGGAGAGAGG - Intergenic
1063789631 10:9427552-9427574 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1063919089 10:10913884-10913906 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1063999738 10:11653650-11653672 AAGGAAGGCGGGAGGGAAAGAGG - Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064018036 10:11787860-11787882 AAGAAAGACTGCAGAGAAAGAGG + Intergenic
1064210515 10:13357247-13357269 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1064308167 10:14187149-14187171 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1064483457 10:15762263-15762285 AAAAAGGAATGGAGGGATGGAGG - Intergenic
1064526315 10:16260401-16260423 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1064526428 10:16260805-16260827 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1064813281 10:19226628-19226650 AAGAAAGAAGGGAGGGAAGGAGG + Intronic
1064925297 10:20562912-20562934 AACGAGGAGTGGAGGGAATGTGG - Intergenic
1064996324 10:21299804-21299826 GAGAAGGACTGCAGGGTGAGTGG + Intergenic
1065005067 10:21371756-21371778 AGGAAGGAAGGGAGGGAAAAAGG + Intergenic
1065005962 10:21380319-21380341 AGAAAGGACTGAAGGGCAAGAGG - Intergenic
1065167483 10:22994673-22994695 AGGAAGGACTGGAGGGGGTGAGG + Intronic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065360021 10:24880880-24880902 AAGAAAGAAAGGAAGGAAAGAGG - Intronic
1065372160 10:24998334-24998356 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1065482984 10:26213352-26213374 AAGAAGGCCTGGAGGGCACTTGG - Intergenic
1065509225 10:26461178-26461200 AAGAAGGAAGGAAGGGAAGGAGG + Intronic
1065638341 10:27753422-27753444 AAGCAAGAAGGGAGGGAAAGAGG - Intergenic
1065639802 10:27770302-27770324 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1065856949 10:29838828-29838850 AGGAAGGAAGGGAGGGAGAGGGG + Intergenic
1065885541 10:30073742-30073764 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1065933534 10:30500136-30500158 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1065996800 10:31066915-31066937 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1066104035 10:32141462-32141484 AAGAAGGACTGGGAAGTAAGTGG + Intergenic
1066252885 10:33651548-33651570 AAGAAGGACTTGTGGGGTAGTGG + Intergenic
1066290884 10:34013465-34013487 AAGGAGGAAAGGAGGGAGAGAGG - Intergenic
1066553334 10:36583953-36583975 AGGAAGGAAGGGAGGGAAAAAGG - Intergenic
1066728918 10:38419130-38419152 AAGGAGGAACGGAGGGAAGGAGG - Intergenic
1067202487 10:44185374-44185396 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1067241005 10:44493564-44493586 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1067528119 10:47050470-47050492 GAGAGGGAGAGGAGGGAAAGAGG + Intergenic
1067557799 10:47284832-47284854 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067720322 10:48723170-48723192 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1067970217 10:50961393-50961415 ATGAAGTACTGCAGAGAAAGAGG - Intergenic
1068022344 10:51601013-51601035 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
1068022557 10:51603432-51603454 AAGAAGGAATGTAGGTGAAGAGG + Intronic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068080239 10:52310504-52310526 AAGAAGGAAAGAAGGGAAGGAGG + Intergenic
1068120553 10:52779224-52779246 AAGAAAGGAAGGAGGGAAAGAGG - Intergenic
1068819069 10:61352256-61352278 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1069258245 10:66361330-66361352 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
1069473795 10:68715623-68715645 AAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1069568180 10:69477721-69477743 ATGAAGAACTGGGGGGAAAGGGG - Intronic
1069723896 10:70565592-70565614 ATGAAGGAGTGGAGGCAGAGTGG + Intronic
1069813473 10:71179191-71179213 TAGCAGGGGTGGAGGGAAAGAGG - Intergenic
1069923144 10:71829681-71829703 AAGAAGAGCTGAGGGGAAAGAGG - Intronic
1070065310 10:73027831-73027853 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1070536879 10:77385719-77385741 AAGAAGGACAGGTTGGAAAGAGG + Intronic
1070661791 10:78311765-78311787 AGGAAGGAAGGGAGGGACAGAGG - Intergenic
1070694017 10:78548487-78548509 AAGGAGGAATGGATGGAAAGAGG + Intergenic
1070698227 10:78578933-78578955 AAGAAGCACTGAATGGAAAGGGG - Intergenic
1070984710 10:80678724-80678746 AAGAGTGGCAGGAGGGAAAGGGG + Intergenic
1071150840 10:82632402-82632424 AAGAAGCACTCCAGGTAAAGGGG - Intronic
1071198322 10:83187640-83187662 AAGAGTGACTTGAGGGAGAGTGG - Intergenic
1071441655 10:85703526-85703548 AAGAAGGAGAGGAGGAAAAAAGG + Intronic
1071483789 10:86084323-86084345 AGGAAGGAGGGGAGGGAGAGAGG + Intronic
1071854369 10:89608366-89608388 AAGAAGGAGGGGAGGGATGGTGG + Intronic
1072139136 10:92574223-92574245 CAGGCGGACTGGAGGGACAGGGG + Intergenic
1072198753 10:93140044-93140066 AAGAAAGGCTGGAAGGCAAGAGG - Intergenic
1072539660 10:96388733-96388755 AAGGACGACTGGAAGGAAAGGGG - Intronic
1072645449 10:97251070-97251092 AATAAGGAAGGAAGGGAAAGGGG + Intronic
1072723215 10:97793672-97793694 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1072759434 10:98043714-98043736 AGGAAGGTCTGGAGGAAAGGAGG + Intergenic
1073140397 10:101243420-101243442 GAGAAGGAGTGGAGGGGATGAGG + Intergenic
1073433061 10:103499396-103499418 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1073482537 10:103795863-103795885 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1073484758 10:103809678-103809700 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1073541472 10:104319084-104319106 GGGAAGGACTGCAAGGAAAGGGG + Intronic
1073649103 10:105339990-105340012 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1074085212 10:110204579-110204601 TAGAACGTCTGGGGGGAAAGGGG + Intergenic
1074514192 10:114149659-114149681 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1074651420 10:115527883-115527905 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1074731824 10:116386493-116386515 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1075065655 10:119287350-119287372 AAGGAGGAAGGGAGGGAGAGAGG + Intronic
1075105571 10:119538115-119538137 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1075122718 10:119675920-119675942 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1075197709 10:120375364-120375386 AAGAAGAACTGGAGGCAATATGG + Intergenic
1075382299 10:122029010-122029032 AAGAAAGACGGGAAGGGAAGGGG - Intronic
1075557996 10:123447299-123447321 AGGAAGGACTGAGGGGCAAGTGG - Intergenic
1075931881 10:126304311-126304333 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076020745 10:127070641-127070663 ACAAAGGACTGGAGAGGAAGTGG + Intronic
1076201536 10:128562730-128562752 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1076214243 10:128679961-128679983 ATGGAGGACTGGAGGCAGAGAGG + Intergenic
1076571968 10:131438936-131438958 AGGCAGGAAGGGAGGGAAAGAGG - Intergenic
1076591698 10:131588039-131588061 AAGGAGCACAGGAGAGAAAGTGG - Intergenic
1076974016 11:157499-157521 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1077272253 11:1686821-1686843 GAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1077633653 11:3827386-3827408 AAGGAGGCCTGCAGAGAAAGGGG - Exonic
1077843422 11:5999193-5999215 AAAAATAACTAGAGGGAAAGAGG + Intergenic
1078061300 11:8046689-8046711 AAGATAGGCTGGAGGCAAAGAGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078108174 11:8371760-8371782 ACGAAGGGATGGAGGGAAAGAGG - Intergenic
1078490632 11:11764980-11765002 AAGAAGAAATGGAGGCACAGAGG - Intergenic
1078526767 11:12107424-12107446 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1078900080 11:15633783-15633805 AAGAAAGAGTGGAGGGACAGAGG - Intergenic
1078932101 11:15920678-15920700 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1079303279 11:19298459-19298481 TAGAAGGAAGGGAGGGGAAGGGG - Intergenic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1079540931 11:21573770-21573792 AGGAAGGGAGGGAGGGAAAGAGG + Intronic
1079748550 11:24164495-24164517 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1079964396 11:26963205-26963227 AAGGAGGGCAGGAGGGAGAGAGG + Intergenic
1080043497 11:27784106-27784128 AAAAAAGAAGGGAGGGAAAGAGG - Intergenic
1080135030 11:28844600-28844622 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1080279247 11:30537653-30537675 AAGAAGGAAGGGAGGAAAGGAGG + Intronic
1080471647 11:32551746-32551768 AAGAAGGATGGGAGGCAATGTGG + Intergenic
1081659482 11:44879251-44879273 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1082717124 11:56627833-56627855 AAGAAGGACAGAAGAGAAAGTGG + Intergenic
1082761878 11:57135375-57135397 AGGCAGGAAAGGAGGGAAAGAGG + Intergenic
1082947098 11:58772137-58772159 AATAAAGGCTGGAGGGAAAAAGG + Intergenic
1083674905 11:64319706-64319728 AGGAAGGACTCCAGGGTAAGGGG - Intronic
1084157626 11:67323001-67323023 AGGGAGGAGAGGAGGGAAAGAGG - Intronic
1084159323 11:67336942-67336964 AAGAAGTACTTAAAGGAAAGTGG + Intronic
1084449915 11:69230482-69230504 AAGAAGCACAGAAGGGACAGAGG + Intergenic
1084493440 11:69490391-69490413 AAGAAGAACTGGATGAAAGGCGG - Intergenic
1084596513 11:70119915-70119937 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
1084729538 11:71064573-71064595 AAGACAGACTGGAAGGAAAGAGG + Intronic
1084843529 11:71879126-71879148 AAGAAGGGCTAGAGGTGAAGAGG + Intronic
1085271479 11:75272702-75272724 AGGAAGGAAGAGAGGGAAAGCGG + Intronic
1085384948 11:76152301-76152323 AGGAAGGAATGGCGGGAACGGGG - Intergenic
1085478092 11:76800252-76800274 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1085781305 11:79411612-79411634 AAGAAAGACTGGAGGGAGAAGGG - Intronic
1085847513 11:80083219-80083241 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1085983675 11:81757363-81757385 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086174567 11:83874306-83874328 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1086307162 11:85493789-85493811 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1086783878 11:90940826-90940848 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1086961526 11:92983546-92983568 TAGAAGGACAGGAAGGGAAGGGG + Intronic
1087547099 11:99598405-99598427 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1087641598 11:100760762-100760784 AAGAAGGACAGGATGGAGAAAGG + Intronic
1087666367 11:101053647-101053669 AAGAAAGAAAGGAGGGAAAAGGG - Intronic
1087669584 11:101089706-101089728 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1087806899 11:102565236-102565258 GAGAAAGACTGGGAGGAAAGTGG - Intergenic
1087906107 11:103699724-103699746 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1088183896 11:107142396-107142418 AAGGAGGAAAAGAGGGAAAGGGG - Intergenic
1088339306 11:108745071-108745093 AAGAAGGAAAGGAAGGGAAGGGG - Intronic
1088453434 11:110007540-110007562 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1088524309 11:110736325-110736347 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1088594000 11:111426289-111426311 AAGGAGGACTGGATTGAGAGTGG + Intronic
1088601680 11:111484705-111484727 AAGAAAGACAGGAAGGAAAGAGG + Intronic
1089052379 11:115557141-115557163 AAGAAGGGAGGGAGGGAACGAGG - Intergenic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089511177 11:118998219-118998241 AAGAAGGTCTGGCGGCACAGAGG - Exonic
1089879750 11:121762470-121762492 AAGAAGGAGGGGAGGGGAACAGG + Intergenic
1089960787 11:122615532-122615554 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1090019453 11:123114447-123114469 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1090201413 11:124860373-124860395 AAGAAGGACTTGATGGAGTGAGG + Intergenic
1090226188 11:125073491-125073513 AAGAAGGACTGGAGGGGTGGAGG - Intronic
1090240483 11:125177944-125177966 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1090392739 11:126399991-126400013 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1090648263 11:128783984-128784006 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1091116110 11:133015330-133015352 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1091143218 11:133253896-133253918 AAGAAGGAAGGGAGGGAGTGAGG - Intronic
1091898347 12:4122630-4122652 AAAAAAGAATGGAGGGAGAGTGG - Intergenic
1092092273 12:5812711-5812733 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1092162643 12:6324385-6324407 AAGAAGAACTGGAAGGAAGCAGG - Intronic
1092281493 12:7101174-7101196 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
1093152022 12:15633034-15633056 AGGCAGGACAGGAGGGAAGGAGG + Intronic
1093363775 12:18266810-18266832 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
1093971108 12:25376854-25376876 AAGAGGGAAGGGAGGGAAAGGGG + Intergenic
1094146149 12:27230521-27230543 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1094330386 12:29285552-29285574 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1094599744 12:31898169-31898191 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1094715322 12:33008198-33008220 AAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1095385540 12:41645755-41645777 AGGAAGGGAGGGAGGGAAAGGGG + Intergenic
1095473971 12:42566204-42566226 ACGAAAGAATGGAGGGAAGGGGG + Intronic
1095998438 12:48109322-48109344 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1095999375 12:48116113-48116135 AGGAAGGAAGGGAGGGAAGGGGG - Intronic
1096009557 12:48201512-48201534 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1096077266 12:48813681-48813703 AAGAAGACCTGGAGGGAGAGAGG - Intergenic
1096196075 12:49649602-49649624 CAGAAGGACTGGAAGGGCAGGGG + Intronic
1096571882 12:52528142-52528164 AAGAAGGGCTGGAGGAAATCAGG - Intergenic
1096766993 12:53899363-53899385 AAGAAGGAAGGAAGGGAAGGAGG + Intergenic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097558528 12:61171345-61171367 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
1097776424 12:63651972-63651994 CAGAAAGGCTGGATGGAAAGTGG - Intronic
1097827253 12:64186885-64186907 AAGCAGAAGTGGATGGAAAGAGG - Intronic
1097968221 12:65603795-65603817 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1098101131 12:67018258-67018280 AAGAAAGGCTGGAGGCAGAGAGG - Intergenic
1098333414 12:69377408-69377430 AAGAAAGAAAGGAGGGAAGGAGG - Intronic
1098521762 12:71440819-71440841 AGGAAGGAAGGGAGGAAAAGAGG - Intronic
1098977127 12:76914145-76914167 AAGAAGGGATGGAGGGAGAGAGG - Intergenic
1099079648 12:78160858-78160880 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1099188129 12:79538053-79538075 AAGAAGGCCTGGAAAGAAAAAGG + Intergenic
1099321678 12:81158653-81158675 AAGAATAACTGCAGGGAAACAGG - Intronic
1099609387 12:84848312-84848334 AAGAAAGGAAGGAGGGAAAGAGG + Intergenic
1099652529 12:85446418-85446440 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1100141151 12:91620499-91620521 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1100149587 12:91719937-91719959 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1100149606 12:91720053-91720075 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1100471252 12:94895222-94895244 AAAAAGGACAGAAGGGAGAGAGG - Intergenic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1100602086 12:96120736-96120758 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1100620202 12:96263932-96263954 AGGAAGAACTGAAGAGAAAGTGG + Intronic
1100643332 12:96503416-96503438 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1100835731 12:98565237-98565259 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1101255557 12:102973612-102973634 AAGAAAGAAGGGAGGAAAAGAGG - Intergenic
1101255584 12:102973733-102973755 ATGAAGGAAGGAAGGGAAAGAGG - Intergenic
1101743845 12:107522781-107522803 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1101848822 12:108386148-108386170 AAAAAGCACTGGTAGGAAAGTGG + Intergenic
1101860136 12:108475926-108475948 AACAAGGACTTGAGTGCAAGTGG - Intergenic
1102035839 12:109769943-109769965 AAGATGTATTGGAGGGAAGGGGG - Exonic
1102216777 12:111167212-111167234 AAGAAGGCCTGTGGGGACAGGGG - Intronic
1102397798 12:112602249-112602271 ATGAAGGAGTGGAAGGAATGGGG - Intronic
1102543436 12:113638312-113638334 AACAGGGACTGGAGGGAGGGGGG + Intergenic
1102660931 12:114527696-114527718 AGGAAGGAAGGGAGGGAAAGAGG - Intergenic
1102705680 12:114878381-114878403 AGGGAGGGCGGGAGGGAAAGAGG - Intergenic
1102717411 12:114986302-114986324 AAGAAGGAAGGGAGAGAGAGAGG - Intergenic
1102729825 12:115098693-115098715 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1102759020 12:115369095-115369117 GAGAAGGAGAGGAGGGAGAGAGG + Intergenic
1102796326 12:115691911-115691933 AAGAAGGGGAGGAGAGAAAGGGG - Intergenic
1102864047 12:116360321-116360343 AGGAAGGAATGGAGGGAGGGCGG - Intergenic
1102992131 12:117322798-117322820 AAGGAGGAAGGGAGGGAAGGAGG - Intronic
1103022796 12:117549814-117549836 AAGAAAGGATAGAGGGAAAGAGG + Intronic
1103040345 12:117690028-117690050 AAGAATGAATGGAGGGAGGGAGG + Intronic
1103230192 12:119323583-119323605 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1103251627 12:119504990-119505012 AAGAAAGAAAGGAGGGAAGGAGG - Intronic
1103688575 12:122752381-122752403 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1103855008 12:123961315-123961337 AATAAGGACTGGAGTGAAAAAGG + Intronic
1104166601 12:126236778-126236800 AAGAAGGAATGGAAGGAGAGAGG - Intergenic
1104250172 12:127085770-127085792 AACAAGGAAAGGAAGGAAAGAGG + Intergenic
1104289600 12:127455702-127455724 AGGGGGGACTGCAGGGAAAGGGG + Intergenic
1104878737 12:132054701-132054723 ACGGAGGAGTGGAGGGACAGTGG + Intronic
1105064337 12:133183508-133183530 AAAAAGGAGAGGAGGTAAAGAGG + Intronic
1105473610 13:20712956-20712978 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
1105945393 13:25185462-25185484 AAGAAATACTCGAGGGAAATAGG - Intergenic
1105956732 13:25290269-25290291 AGAAAGGACAGGAGGGAAATAGG - Intergenic
1106028900 13:25980441-25980463 AAGAAGGCCTGTAGGGGGAGTGG + Intronic
1106310442 13:28549413-28549435 AGGAAGGTGTGGAGGGTAAGGGG + Intergenic
1106489106 13:30200620-30200642 AGAAAGGACTGCAGGGAGAGTGG + Intergenic
1106556113 13:30810018-30810040 AAGGAGGAGGTGAGGGAAAGTGG + Intergenic
1106896744 13:34311245-34311267 AAGAAGAAAAGGAGGGAGAGAGG + Intergenic
1107113861 13:36725778-36725800 AAAAAGGACCAAAGGGAAAGAGG + Intergenic
1107119742 13:36783163-36783185 AAGAAGGAGAGAAGGGAGAGAGG + Intergenic
1107391905 13:39973752-39973774 AGGAAAGAATGGAGGGAGAGAGG - Intergenic
1107436132 13:40382342-40382364 AAAAAGGACAGGAGGAAACGGGG - Intergenic
1107672098 13:42756403-42756425 AGGAACGACTGGGAGGAAAGTGG - Intergenic
1107687558 13:42918936-42918958 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1107917659 13:45168951-45168973 AAGGAGGTAAGGAGGGAAAGAGG - Intronic
1107917673 13:45168994-45169016 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1108114167 13:47109587-47109609 AATAAGGGCTGGAGGAAAAAAGG - Intergenic
1108490210 13:50974412-50974434 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1108685667 13:52816784-52816806 AAGCAGGTTTGGAGGGAAAGAGG - Intergenic
1108688243 13:52839336-52839358 AAGACGGAGTGGAGGGAGACAGG + Intergenic
1108822340 13:54368662-54368684 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1108854639 13:54777277-54777299 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1109036177 13:57263489-57263511 AAGAAGGAAGGGAGGGAACAAGG - Intergenic
1109119465 13:58435982-58436004 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1109184839 13:59255670-59255692 AAGAAGGAAGGGAGGGACGGTGG + Intergenic
1109321563 13:60816631-60816653 AAGAAGGACGGAAGGGAGGGAGG - Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109759854 13:66813472-66813494 AAGAAGGAAGGGAGGAAAGGAGG + Intronic
1109778676 13:67078305-67078327 AGGAAGGATTGGATAGAAAGAGG - Intronic
1110325751 13:74213567-74213589 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1111084127 13:83351786-83351808 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1111086433 13:83380739-83380761 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1111246907 13:85551964-85551986 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1111488546 13:88938097-88938119 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1111613890 13:90640234-90640256 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1111685174 13:91492934-91492956 GAGAAGCACTGGGGGGAAAGAGG - Intronic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111868749 13:93803432-93803454 AACAAGTATTGGTGGGAAAGTGG + Intronic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112050029 13:95635935-95635957 AAGGAGGTAGGGAGGGAAAGAGG + Intronic
1112126368 13:96472777-96472799 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1112158159 13:96840005-96840027 AAGAAGGAAAGGAGGGAAGGGGG + Intergenic
1112211225 13:97379702-97379724 AAGAAGGAATGGAAGGAGAAAGG + Intronic
1112242546 13:97696218-97696240 AAGAATGAGGGGAGGTAAAGAGG + Intergenic
1112294419 13:98174084-98174106 AAAAAAGACTGGAAGGAAATCGG + Intronic
1112311060 13:98317919-98317941 AAGAAGGAAAGGAAGGAGAGAGG - Intronic
1112436985 13:99397611-99397633 AAGAAAGCCAGGAGGGAAACAGG + Intergenic
1112743754 13:102504621-102504643 AATAAGGTTTGGAGGGAAGGGGG + Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113049985 13:106200146-106200168 AGGAAGGAATGGAGGGACAGAGG - Intergenic
1113302678 13:109039059-109039081 AAGAATGACTGGAGGCTTAGTGG + Intronic
1113420758 13:110170026-110170048 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1113598609 13:111552355-111552377 AAAAAAGACTGGAAGGAAACAGG - Intergenic
1113598618 13:111552511-111552533 AAAAAAGACTGGAAGGAAACAGG - Intergenic
1113635071 13:111913721-111913743 AACAAGGCGTGGTGGGAAAGTGG + Intergenic
1113663022 13:112120013-112120035 AAGAAGGGAGGGAGGAAAAGAGG + Intergenic
1113673994 13:112195861-112195883 AAGAAAGAAGGAAGGGAAAGAGG - Intergenic
1113674084 13:112196204-112196226 AGGAAGGAAGGTAGGGAAAGAGG - Intergenic
1113796523 13:113061719-113061741 AAGAGGGAGGGGAGGGCAAGGGG - Intronic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1113933446 13:113980840-113980862 AAGAAGGAAGGAAGGGAAGGAGG + Intronic
1113992243 14:16036887-16036909 AAGAAGGAAGGGAGGAAGAGAGG - Intergenic
1114258170 14:21019789-21019811 AACAATTACTGGAGGAAAAGAGG + Intronic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114460269 14:22882210-22882232 AAGGAGGACAAGAAGGAAAGGGG + Intergenic
1114671031 14:24411185-24411207 AAGAAGAACCGGAGGGTGAGAGG + Exonic
1114920046 14:27314649-27314671 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1115026790 14:28756113-28756135 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
1115071483 14:29328224-29328246 AGGAAGGAAGGGAGGGAAATGGG + Intergenic
1115314183 14:32008879-32008901 AAAAAGGAATGGAGGGAGAAAGG - Intronic
1115315354 14:32019604-32019626 AGGAAGCACTGGGGGGAAAACGG + Intergenic
1115317570 14:32041137-32041159 ATAAAGGACAGGAGGGAAAAAGG + Intergenic
1115437552 14:33392817-33392839 AAAAAACACTGGAGGAAAAGAGG - Intronic
1115440581 14:33430267-33430289 AAGAAGAACTGAAGGGAAGGCGG - Intronic
1115497820 14:34024529-34024551 GAGAAGGGCTGGAAGGAAAGGGG - Intronic
1116252961 14:42510267-42510289 AAGAAAGACAGGAGGGAGGGAGG + Intergenic
1116411617 14:44631116-44631138 AAGAAGGAAAGAAGGGAAAAGGG + Intergenic
1116596604 14:46856741-46856763 AAAAAGGAATGGAAGGAGAGAGG - Intronic
1116659588 14:47692089-47692111 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1116908808 14:50435347-50435369 AAGGAGGACGGGAGGGAGTGAGG - Intronic
1117247445 14:53900176-53900198 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1117359534 14:54959422-54959444 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1117531119 14:56661509-56661531 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1117918269 14:60701553-60701575 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
1118506744 14:66421767-66421789 ACCAAAGCCTGGAGGGAAAGAGG - Intergenic
1118536064 14:66766021-66766043 AAGCAGGACTTGAGGGATAATGG + Intronic
1118569474 14:67178629-67178651 AAGAAGAAGAGAAGGGAAAGAGG + Intronic
1118701416 14:68437579-68437601 AGGCAGGAATGGAGGGAAAGGGG - Intronic
1118780645 14:69005518-69005540 AAGAAATCCTGCAGGGAAAGGGG + Intergenic
1119519625 14:75276709-75276731 GAGGGGGACGGGAGGGAAAGGGG - Intergenic
1119996035 14:79254805-79254827 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120005695 14:79355276-79355298 AAGAAGAGTTGGAGGGACAGAGG - Intronic
1120016050 14:79474813-79474835 AAGAAGGAAGAGAGGGAAAGAGG + Intronic
1120309378 14:82810780-82810802 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1120309420 14:82810908-82810930 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1120309440 14:82810968-82810990 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1120346266 14:83294206-83294228 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1120635556 14:86946382-86946404 GAGAGGGACTGGAGGGAGGGAGG - Intergenic
1121108311 14:91295250-91295272 GAGAAGAACTGGAAGGAAAAAGG + Intronic
1121298415 14:92849411-92849433 AAAAAAGACTGGAAGGAAACAGG - Intergenic
1121509254 14:94500297-94500319 AAGAAGGCGAGGAGGGGAAGAGG - Intronic
1121593246 14:95137094-95137116 AAGAAGGAAAGGAGGAAAAAGGG + Intronic
1121800255 14:96768854-96768876 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1121833655 14:97073096-97073118 AAGAAGAAAGGGAGGGAGAGAGG - Intergenic
1121908742 14:97770065-97770087 AAGATGGGCTGGAGGCCAAGGGG + Intergenic
1121916752 14:97842449-97842471 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1122031231 14:98914162-98914184 AAAAAGGAAAGAAGGGAAAGAGG + Intergenic
1122033214 14:98928653-98928675 AGGATGGATTGGAGGGAATGTGG - Intergenic
1122049217 14:99043715-99043737 AAGAAAGAGTGGTGTGAAAGGGG - Intergenic
1122207053 14:100152907-100152929 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1122359459 14:101150903-101150925 GAGAAGGAAGGGAGGGAGAGAGG - Intergenic
1122370032 14:101224608-101224630 AACATGGAGTGGGGGGAAAGAGG - Intergenic
1122570468 14:102695500-102695522 AAGAAGGAAAGGAGGGAAGGAGG + Intronic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1123191999 14:106580356-106580378 AAGGAGGACAGCATGGAAAGTGG - Intergenic
1202904668 14_GL000194v1_random:61185-61207 AGGGAGGATTGGAGGGACAGAGG + Intergenic
1124614699 15:31233142-31233164 AAGAAGGCCTCCAGGGAAGGCGG + Intergenic
1124618406 15:31259579-31259601 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1124985678 15:34609936-34609958 AACAATGACAGGACGGAAAGAGG + Intergenic
1125213366 15:37240666-37240688 AAGGAGGAATGGAGGGAGGGTGG + Intergenic
1126167645 15:45667061-45667083 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1126226806 15:46280321-46280343 AAGAAGGAAAGGAGGGAATGAGG + Intergenic
1126370221 15:47938072-47938094 AAGAAGGAAGGGAGGAACAGAGG + Intergenic
1126772858 15:52075021-52075043 TGGAAGGAGTGGAGGGGAAGAGG - Intergenic
1126780048 15:52132002-52132024 AGGGAAGACTGGAGGGATAGCGG - Intronic
1127013374 15:54655236-54655258 CAGAAGAACAGGAGGGTAAGAGG + Intergenic
1127099405 15:55549924-55549946 AAGTAGTACTGGATGGAGAGAGG - Intronic
1127121778 15:55778116-55778138 AAGAAGGAAGGAAGGAAAAGGGG - Intergenic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127444094 15:59042534-59042556 TACAAGGACTGGGGGGAAATGGG - Intronic
1127560562 15:60132436-60132458 AGGCAGGAAGGGAGGGAAAGAGG + Intergenic
1127672238 15:61206242-61206264 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
1127924962 15:63530282-63530304 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1128157660 15:65401986-65402008 TAGAAGGGCAGGAGAGAAAGGGG + Intronic
1128617504 15:69121647-69121669 AAGAGGGAAAGGAGGGAGAGAGG - Intergenic
1128677991 15:69625843-69625865 AAGAAGGAAGGGAGGGATGGAGG - Intergenic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129195596 15:73964284-73964306 AAGAAGGACTGTATATAAAGGGG - Intergenic
1129403575 15:75300379-75300401 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1129521508 15:76189343-76189365 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1129748339 15:78040744-78040766 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
1129905226 15:79182563-79182585 AGGAAGGAATGGAGGGAGCGAGG - Intergenic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130302775 15:82692584-82692606 AAGAAGGACCAGCGGAAAAGAGG + Intronic
1130423248 15:83769707-83769729 AATAATGACTGGAAGCAAAGAGG - Intronic
1130473989 15:84247668-84247690 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130481402 15:84361736-84361758 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130533577 15:84766674-84766696 AGGAAGGAATAGAGGGAGAGAGG + Intronic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1130993357 15:88889983-88890005 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1131285893 15:91057118-91057140 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131492620 15:92876107-92876129 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1131528016 15:93167836-93167858 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131528030 15:93167873-93167895 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131528046 15:93167914-93167936 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131624499 15:94103245-94103267 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1131727155 15:95239283-95239305 AAAGAGGAAAGGAGGGAAAGAGG + Intergenic
1131908133 15:97166226-97166248 AGGGAGGAATGGAGGGAGAGAGG - Intergenic
1131945419 15:97615352-97615374 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131978113 15:97966077-97966099 AAGGAGGAAGGGAGGGAAGGAGG - Intronic
1132022225 15:98372582-98372604 CACCAGGACTGGAGGGCAAGTGG - Intergenic
1132390134 15:101432668-101432690 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1132420441 15:101661329-101661351 AAGGATGGCTGGAGGGCAAGAGG + Intronic
1132634323 16:936071-936093 AAGAAGGCTGGGAGGGAGAGAGG + Intronic
1132755870 16:1485115-1485137 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1132755884 16:1485154-1485176 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1132918020 16:2364689-2364711 AAGAAGGAGAGGAGGGAGAGAGG + Intergenic
1132941547 16:2510951-2510973 AAGAAGGAGGGGAAGGAAAGTGG + Intronic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1133260651 16:4547598-4547620 AAGAAAGAAAGGAAGGAAAGAGG - Intergenic
1133392714 16:5422638-5422660 GAGAAGGATTGGGAGGAAAGAGG + Intergenic
1133551172 16:6855842-6855864 AGAAAGGAAGGGAGGGAAAGAGG - Intronic
1133594049 16:7273165-7273187 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1133594247 16:7275159-7275181 AAGAAGGGATAGAGGGAGAGAGG + Intronic
1133647779 16:7780618-7780640 AAGAAGGAAGGGAGGGAGAGAGG - Intergenic
1133725244 16:8531042-8531064 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1133830630 16:9320266-9320288 AAGAAGGGTGAGAGGGAAAGTGG - Intergenic
1133839492 16:9394728-9394750 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1133862040 16:9605231-9605253 AGGAAGGAAAGGAGGGAGAGAGG - Intergenic
1133978141 16:10614947-10614969 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1133979721 16:10624140-10624162 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1134022497 16:10930746-10930768 AAGAGTGAGTGGAGGGAATGGGG - Exonic
1134032681 16:11005098-11005120 TAAAAGGACTGGAATGAAAGAGG - Intronic
1134121725 16:11588586-11588608 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1134300482 16:12986290-12986312 AAGAAGGGAAGGAAGGAAAGAGG - Intronic
1134318228 16:13139373-13139395 AAGAAGGAAGGGAGGGACGGAGG - Intronic
1134439920 16:14293268-14293290 AAGAAGGGAGGGAGGGAATGGGG - Intergenic
1134655279 16:15943565-15943587 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1135000258 16:18771170-18771192 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1135004477 16:18806741-18806763 ACAGAGGAATGGAGGGAAAGGGG + Exonic
1135177574 16:20244372-20244394 AAGAATGAAAGGAAGGAAAGAGG - Intergenic
1135263331 16:21000019-21000041 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1135264375 16:21009944-21009966 AAGAAGGAAGGGAAGGGAAGAGG + Intronic
1135271278 16:21071831-21071853 AAGCAGGAATATAGGGAAAGGGG - Intronic
1135708025 16:24691787-24691809 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1135826096 16:25730352-25730374 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1135887703 16:26326488-26326510 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1135945191 16:26859030-26859052 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1135991088 16:27219213-27219235 AAGAAGCACTGAAGGGGATGAGG + Intronic
1136039041 16:27563529-27563551 AAGAAAGACTGCAGGGAAGAGGG + Intronic
1136095861 16:27955951-27955973 AGGAAGGACAGGAGGGAGGGAGG + Intronic
1136250155 16:28999081-28999103 AAGAAGGAAGGAAGGGAAGGAGG - Intergenic
1136494734 16:30635402-30635424 AAGAAGGACTAGGGGGAATGGGG + Intergenic
1136617103 16:31404817-31404839 AAGAAAGGAAGGAGGGAAAGAGG - Intronic
1136634809 16:31513947-31513969 AAGAAGGAAGGGAGGGAGAGAGG - Intergenic
1136667433 16:31824546-31824568 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1137256975 16:46783618-46783640 GGGAAGGACTGGAGAGAAAGGGG + Intronic
1137316626 16:47331316-47331338 AAGGAGGAAGGGAGGGACAGAGG + Intronic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137558011 16:49484787-49484809 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137686978 16:50393134-50393156 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1137746856 16:50828571-50828593 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137774033 16:51040943-51040965 AGGAGGGAGAGGAGGGAAAGAGG + Intergenic
1137842574 16:51653677-51653699 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137914081 16:52409759-52409781 AAAAAGGACTGGAAGAAAACTGG - Intergenic
1137919668 16:52474662-52474684 AAGAAAGAAGGGAGGGAGAGAGG + Intronic
1137944097 16:52717308-52717330 GAGAAGGATTGGAATGAAAGAGG - Intergenic
1137972764 16:53001996-53002018 AAGAAGGAAATGAGGGAAAGGGG + Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138174375 16:54883397-54883419 AAGAAAGAATGGAGGGAGGGAGG + Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138232782 16:55351559-55351581 TAGAAGAACTGAAGGTAAAGAGG + Intergenic
1138263111 16:55639793-55639815 AAGAAAGATTGGAGGGAGAGAGG + Intergenic
1138458837 16:57136073-57136095 AAGAAGGAAGGGAGGGATGGAGG + Intronic
1138746866 16:59373368-59373390 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1138972060 16:62157317-62157339 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1139016256 16:62692451-62692473 AGGAAGGACGGGAGGGAAGGAGG + Intergenic
1139028520 16:62850240-62850262 GACAAGGAGGGGAGGGAAAGAGG + Intergenic
1139131206 16:64148321-64148343 AAGAAGGAAGGGAAGGAAGGAGG - Intergenic
1139352808 16:66347932-66347954 AAGAAGGACAAGTGAGAAAGCGG + Intergenic
1139760387 16:69180213-69180235 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1140127323 16:72128942-72128964 AGGAAAGACGGGAGGGACAGTGG - Intronic
1140206985 16:72941051-72941073 AAGAAGGCCTGGAGTGAACCAGG + Intronic
1140208064 16:72949582-72949604 GGGAAGGGCTGGGGGGAAAGCGG + Intronic
1140228389 16:73097047-73097069 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1140286708 16:73609674-73609696 AAGAAGGAAGGAAGGGAAAGAGG + Intergenic
1140379096 16:74470313-74470335 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1140419289 16:74804937-74804959 GAGAAGGAGGGGAGGGACAGGGG - Intergenic
1140541487 16:75760282-75760304 AAGGAAGAATGGAAGGAAAGAGG - Intronic
1140828728 16:78731516-78731538 AAGAAGGAATGAAAGGAAAAAGG - Intronic
1140845080 16:78879063-78879085 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
1140906702 16:79415379-79415401 AGCAAGGAAGGGAGGGAAAGAGG + Intergenic
1140976137 16:80062017-80062039 AAGAAGGAATTGAAGAAAAGAGG + Intergenic
1141174715 16:81711182-81711204 AAAAAGGGCTGGGGGGAGAGGGG - Exonic
1141434275 16:83990456-83990478 AAGAGGCACTGAGGGGAAAGGGG - Intronic
1141705407 16:85661844-85661866 AAGCAGGAGTGGACGGAGAGGGG - Intronic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1141799574 16:86297725-86297747 GAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1141885009 16:86885409-86885431 AAGATGGACTGGAGCAAATGGGG - Intergenic
1141892109 16:86933199-86933221 AAGAAGGGAAGGAGGGAAATGGG + Intergenic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142408461 16:89904103-89904125 CAGGAGGACTGCAGGGGAAGCGG - Exonic
1142446242 16:90140164-90140186 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1203143361 16_KI270728v1_random:1783621-1783643 GAGAAGGAAGGGAAGGAAAGAGG - Intergenic
1203143393 16_KI270728v1_random:1783743-1783765 AGGAAGGAAGGAAGGGAAAGAGG - Intergenic
1203143423 16_KI270728v1_random:1783840-1783862 AGGAAGGAAGGAAGGGAAAGAGG - Intergenic
1142461263 17:95299-95321 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1142526295 17:543944-543966 AAGAAGGAAGGAAGGGAGAGTGG + Intronic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1143021288 17:3918215-3918237 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1143137792 17:4721329-4721351 AGGAGTGACAGGAGGGAAAGGGG + Exonic
1143173087 17:4941180-4941202 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1143197600 17:5087941-5087963 AAGAAGATCTAGAGGGAAAATGG + Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143437434 17:6939739-6939761 TAGCAGGGCTGGAGGGAGAGTGG + Intronic
1143457615 17:7078089-7078111 AGGAGGGACTGGAGAGGAAGTGG + Exonic
1143472926 17:7187141-7187163 AATAATGCCTGGAGGGAAACAGG + Intergenic
1143570351 17:7754185-7754207 AAGAAGGACAGGAGTTGAAGGGG + Intronic
1143651859 17:8268391-8268413 AAGAAGGAAAGGAAGGAAGGAGG + Intronic
1143784155 17:9244335-9244357 AAGACAGAGTGGGGGGAAAGGGG + Intergenic
1144036025 17:11366781-11366803 AAGAAAGACTGGAGGAGAAATGG + Intronic
1144288797 17:13805771-13805793 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144465514 17:15493716-15493738 AGGAAGGGAGGGAGGGAAAGAGG - Intronic
1144502655 17:15802688-15802710 AAGAAGGCCTGGTGGGGAGGAGG + Intergenic
1144561045 17:16320443-16320465 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1144759958 17:17701549-17701571 AAGAGAGAGGGGAGGGAAAGGGG - Intronic
1144939526 17:18928376-18928398 AAGAAGAAGTGGGGGGAAAGAGG + Intronic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145741292 17:27276868-27276890 GAGAAGGACTTGGGGGAAGGCGG - Intergenic
1145751076 17:27355503-27355525 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1145816679 17:27799844-27799866 AGGAAGGAAAGGAAGGAAAGAGG + Intronic
1145840323 17:27988998-27989020 AGGAAGGAGTGGAGAGAAAGGGG + Intergenic
1146010997 17:29194304-29194326 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1146011350 17:29197174-29197196 AGTCAGGACTGGAGGGACAGGGG + Intergenic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146086366 17:29833806-29833828 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1146086394 17:29833883-29833905 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1146367319 17:32238965-32238987 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1146411718 17:32591568-32591590 AAGAAAGGCGGGATGGAAAGAGG - Intronic
1146466610 17:33091195-33091217 AGGGAGGACTGGATGGAATGAGG + Intronic
1146537179 17:33662733-33662755 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1146698492 17:34931410-34931432 ATGAAGAACTGGAGGGCATGTGG - Intronic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1146978247 17:37134945-37134967 AAGCAGGAGTAGAGGAAAAGTGG + Intronic
1147128251 17:38388175-38388197 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1147159951 17:38563907-38563929 GAGGAGGCTTGGAGGGAAAGGGG + Intronic
1147185889 17:38712926-38712948 AAGAAGGAGTAGAGGGTATGGGG - Intronic
1147502017 17:40974766-40974788 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1148033814 17:44642544-44642566 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1148370390 17:47095359-47095381 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1148428573 17:47622624-47622646 AAGAAGGACACCAGGGAATGGGG - Exonic
1148850643 17:50553375-50553397 ACCAAGGCCTGGAGGGAAAGAGG + Intronic
1148859577 17:50596966-50596988 AAGGAGGACAGGAGGAAGAGAGG + Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1149422572 17:56524998-56525020 AAGAAGGTAAGGAAGGAAAGTGG + Intergenic
1149539810 17:57460449-57460471 AGGAAGGTAGGGAGGGAAAGTGG + Intronic
1149676244 17:58465141-58465163 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1149939375 17:60846758-60846780 AAGAAGGAATGAAGGGAGGGAGG - Intronic
1150374965 17:64673559-64673581 AGGAAGAAAGGGAGGGAAAGAGG + Intergenic
1150431549 17:65122487-65122509 AAGGAGGATTGGAGGTACAGGGG - Intergenic
1150474215 17:65462108-65462130 ACCCAGGACTGGAGGGAGAGGGG - Intergenic
1150504034 17:65680491-65680513 AAGAAGGACGGGATGGAAAGAGG - Intronic
1150646256 17:66979211-66979233 AAGAAAGAAAGGAGAGAAAGAGG - Intronic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1150748822 17:67840521-67840543 GAGAAGGAGAGGAGGAAAAGGGG - Intronic
1150837019 17:68573627-68573649 AAGAAAGAAAGGAGGGAAGGAGG - Intronic
1150984868 17:70184569-70184591 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1151228458 17:72664365-72664387 CAGAAGGCAGGGAGGGAAAGTGG + Intronic
1151230247 17:72679609-72679631 AAGACCCACTGGAGGCAAAGGGG + Intronic
1151414856 17:73955456-73955478 AAGAAGGAAGGGACGGGAAGGGG + Intergenic
1151465781 17:74284231-74284253 AAAAAGGAAAGAAGGGAAAGTGG + Intronic
1151534269 17:74729858-74729880 AAGAAGATCTGGAGGGACAAAGG + Intronic
1151643476 17:75413791-75413813 AAGAAAGAAGGGAGGGAAGGAGG - Intergenic
1151714464 17:75824247-75824269 AACACGGCCTGCAGGGAAAGGGG - Exonic
1151867821 17:76816031-76816053 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152006553 17:77685830-77685852 ATGAAGGGATGGAGGGAGAGAGG - Intergenic
1152667313 17:81578575-81578597 AAGCATGACAGGAGGGGAAGGGG + Intronic
1153216199 18:2823304-2823326 AAGAAAGAAGGGAGGGAGAGAGG - Intergenic
1153574140 18:6504049-6504071 AGGAAGGAAAGGAGGGAAAAAGG + Intergenic
1153633125 18:7090709-7090731 GAGAAGGAAGGGAGGGAGAGAGG + Intronic
1153786832 18:8543126-8543148 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1153804718 18:8702344-8702366 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1153956572 18:10101512-10101534 CAGAAGGAATGAAGGGAGAGGGG - Intergenic
1154147601 18:11879303-11879325 AAAAAGGAGTGGAGGGGATGAGG + Intronic
1154385116 18:13886349-13886371 GAGAAGGATGGGAGGGAAAGTGG - Intronic
1154975273 18:21451445-21451467 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
1155096444 18:22560129-22560151 AAGGAGGCGTGGAGGGCAAGAGG + Intergenic
1155231673 18:23780338-23780360 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1155495213 18:26436031-26436053 AAGAGGGAATGGAGGTCAAGAGG - Intergenic
1155630595 18:27887702-27887724 AAGAAGGGATGGAAGGAAGGAGG - Intergenic
1155762157 18:29582101-29582123 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1155966054 18:32036595-32036617 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1156034493 18:32751429-32751451 ATGAAAGACTAGAGGAAAAGGGG + Intronic
1156037507 18:32782411-32782433 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1156037530 18:32782485-32782507 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1156037544 18:32782526-32782548 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1156215125 18:34990192-34990214 AAGAAAGACTGCAACGAAAGGGG - Intronic
1156316424 18:35972807-35972829 TAAGAGGACTGGAGGGGAAGCGG + Intronic
1156451128 18:37266968-37266990 CAGAAGGGCTGTGGGGAAAGGGG + Intronic
1156523592 18:37744149-37744171 AAGAAGGGAGGGAGAGAAAGAGG - Intergenic
1156539895 18:37899113-37899135 AATAAGGAAGGGAGGGACAGAGG - Intergenic
1156623590 18:38882114-38882136 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1156838281 18:41581802-41581824 AGGAAGGAAGGAAGGGAAAGAGG - Intergenic
1156859039 18:41815139-41815161 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1157084541 18:44565791-44565813 AAGAAGGAAGAGAGGGAAAGAGG + Intergenic
1157423617 18:47566485-47566507 AGGATAGACAGGAGGGAAAGAGG + Intergenic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1157563204 18:48663123-48663145 AAGAAGGGCTGGAGGGCATCAGG + Intronic
1157837097 18:50914851-50914873 AAGAAGGAAGGGAGAGAAGGAGG - Intronic
1158103722 18:53861222-53861244 AAGAAGGGAGGGAGGGAGAGAGG + Intergenic
1158159158 18:54460625-54460647 AGGAAGGATTGAAGGGAAGGAGG - Intergenic
1158293614 18:55969742-55969764 AGGAAGGAAAGGAGGGAGAGAGG - Intergenic
1159029630 18:63217989-63218011 AGGAAGGAAGGGAGGGATAGAGG + Intronic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159595939 18:70382922-70382944 AAAAACAACAGGAGGGAAAGGGG + Intergenic
1159847819 18:73486960-73486982 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1160060785 18:75527101-75527123 CAGAAAGACAGGAGGGAGAGAGG - Intergenic
1160127969 18:76195980-76196002 AAGACGAAATGGAGAGAAAGAGG + Intergenic
1160128688 18:76204688-76204710 AAGACAGACTTGAGGGAAGGTGG - Intergenic
1160135274 18:76266250-76266272 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1160180179 18:76627571-76627593 AAGAAGGAGTAAAGAGAAAGAGG + Intergenic
1160488128 18:79312046-79312068 GGGAATGACTGGAGGGAAGGCGG - Intronic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160568885 18:79803308-79803330 AAGAAGAACTGGAGGCCTAGAGG - Intergenic
1160650964 19:227666-227688 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1161093928 19:2377667-2377689 AAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1161427722 19:4213238-4213260 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161756651 19:6138715-6138737 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1161794403 19:6378176-6378198 AAGAAGGCCTGGTGGGAGAAGGG + Intronic
1161856990 19:6771826-6771848 AGAAAGGAAGGGAGGGAAAGAGG + Intergenic
1162134745 19:8548430-8548452 AAAGAGGGCTGGAGGGAAACTGG - Intronic
1162338970 19:10080020-10080042 AAGAAGGAATGGAGGGAGGGAGG + Intergenic
1162448807 19:10741917-10741939 AAGAAGGGAGGGAGGGAAAGAGG - Intronic
1162727573 19:12699321-12699343 AAGAGGGTGAGGAGGGAAAGAGG + Exonic
1162858902 19:13490830-13490852 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1162858921 19:13490906-13490928 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1163137266 19:15321288-15321310 AGGAAGGAAGGAAGGGAAAGAGG + Intronic
1163213935 19:15862498-15862520 AAGAAGAAGGGGAGGGGAAGGGG + Intergenic
1163477109 19:17532857-17532879 AGGGAGGAAGGGAGGGAAAGGGG + Intronic
1164249975 19:23467843-23467865 AAGAAGAAGTGGAGGAGAAGAGG - Intergenic
1164441907 19:28285159-28285181 AAGAAGGATGGAGGGGAAAGAGG + Intergenic
1164655447 19:29917811-29917833 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
1164706620 19:30324848-30324870 AGGAAGGACTGGAAGAAGAGAGG - Intronic
1164714802 19:30383873-30383895 AAGAAGGAAGGGAGGGAGGGGGG - Intronic
1164714873 19:30384219-30384241 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1164744235 19:30599386-30599408 AAGAAGGAAGGGAGGAAAGGAGG - Intronic
1164816058 19:31204338-31204360 AGGAAGGACGGGAGGGAAGGAGG - Intergenic
1164829638 19:31310582-31310604 CAGAATGAATGCAGGGAAAGGGG + Intronic
1164882310 19:31742660-31742682 ATGAAGGACAGGAGGGAGGGAGG + Intergenic
1164903119 19:31945177-31945199 AAGAAGGTCTCCAGGGAGAGTGG - Intergenic
1164925623 19:32127777-32127799 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1164925628 19:32127793-32127815 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1165085260 19:33341144-33341166 AAGAAGGAGGGGAGGGAGAGAGG + Intergenic
1165189336 19:34049353-34049375 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1165438267 19:35808784-35808806 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1165463536 19:35958816-35958838 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1165821410 19:38678708-38678730 AAGAAGGTGTGGAGGGACACAGG - Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166115536 19:40651549-40651571 AAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1166709860 19:44929884-44929906 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1166935499 19:46330030-46330052 AAGAAGGAAGGAAGGGAAGGAGG + Intronic
1167011853 19:46813760-46813782 AGGAGGGATAGGAGGGAAAGAGG - Intergenic
1167056263 19:47112996-47113018 AAAAAGGATTTGAGGGAGAGAGG + Intronic
1167554179 19:50183003-50183025 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1167671688 19:50857251-50857273 GAGAAGGAATGGAGTGAGAGGGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168073246 19:53964110-53964132 AAGATGAACTGACGGGAAAGAGG - Intronic
1168075462 19:53978808-53978830 AAGAAGGGAGGGAGGAAAAGAGG + Intronic
1168093238 19:54099622-54099644 AGGAAGGAATGGAGGGAGGGAGG + Intronic
1168109051 19:54181656-54181678 AAGAAAGAAGGGAGGGAAGGAGG + Intronic
1168287083 19:55340390-55340412 AAGGAGGCCTGGAGGGTGAGAGG - Intronic
1168301927 19:55409795-55409817 AAGCAGGACTGGTGGCATAGCGG - Intergenic
1168464982 19:56594989-56595011 AGGAGGGACAGGAGGGAAGGGGG - Intergenic
1168483526 19:56741081-56741103 AAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1168503904 19:56916769-56916791 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1168508764 19:56957960-56957982 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
925356693 2:3246834-3246856 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
925356699 2:3246850-3246872 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
925372094 2:3353301-3353323 AATAAAGACTGGAAGGAAATAGG - Intronic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
925641454 2:5989493-5989515 AAGACAGACTGGAGAGTAAGGGG - Intergenic
925785598 2:7429349-7429371 AAGAAGCACTACAGGGCAAGCGG - Intergenic
925799443 2:7583450-7583472 AAGAAGGAAGGAAGGGAAGGAGG + Intergenic
925880339 2:8346811-8346833 AAGAAAGAGTTGAAGGAAAGGGG + Intergenic
926138587 2:10355020-10355042 CAGAAGGACAGGAAGCAAAGTGG + Intronic
926345398 2:11940421-11940443 AGGAAGGACATGAGGGGAAGTGG + Intergenic
926433123 2:12810005-12810027 AGGAAGGACAAGAGGCAAAGAGG + Intergenic
926660282 2:15458142-15458164 AAGAAGGAAATGAGGGAAAAAGG + Intronic
926879470 2:17527306-17527328 AAGGATGAGAGGAGGGAAAGAGG + Intergenic
927294644 2:21440336-21440358 AAGATGGACTCAGGGGAAAGGGG - Intergenic
927444102 2:23142460-23142482 AAGAAAAAAAGGAGGGAAAGAGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927923266 2:26990320-26990342 AGGAAGGACTGAGTGGAAAGCGG - Intronic
927989847 2:27440326-27440348 AAGAAGGCATGCAGGCAAAGGGG - Intronic
928276493 2:29905621-29905643 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
928328651 2:30339932-30339954 AAGCAGGACTGAGGGCAAAGGGG - Intergenic
928507129 2:31965290-31965312 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
928902561 2:36336002-36336024 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
929013267 2:37469103-37469125 AAGAAAGAAGGGAAGGAAAGTGG - Intergenic
929013490 2:37471084-37471106 AAGAAAGAAGGGAAGGAAAGAGG - Intergenic
929090700 2:38214450-38214472 AGAAAGGCCTGGAGGGAAAGAGG - Intergenic
929185723 2:39091828-39091850 AAGAAGGAGTGGCAAGAAAGTGG - Intronic
929197777 2:39204022-39204044 AGGAGGAACTGAAGGGAAAGGGG - Intronic
929311506 2:40431396-40431418 ATGAAGGACTGTAGGCAAGGAGG + Intronic
929380005 2:41338019-41338041 AAGAAAGGAGGGAGGGAAAGAGG + Intergenic
929541688 2:42827967-42827989 AAGAAGGTCTGGAGAGGAGGAGG + Intergenic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
929687534 2:44047478-44047500 AAGAAGGAAATCAGGGAAAGGGG + Intergenic
929712693 2:44281006-44281028 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
930263318 2:49171673-49171695 AAGAGGGACAGAAGAGAAAGAGG + Intergenic
930352664 2:50277444-50277466 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
930356481 2:50327618-50327640 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
930406269 2:50960334-50960356 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
930589830 2:53314001-53314023 AAGAAGAAAAGGAGGGAAGGAGG + Intergenic
930715193 2:54587582-54587604 ATGGAGGACTGGAGGAGAAGAGG + Intronic
930755185 2:54966377-54966399 GAGAAGCACTGCAGGGAGAGAGG + Intronic
930765481 2:55081037-55081059 AAGAAAGAAAGGAAGGAAAGAGG - Intronic
931909176 2:66876334-66876356 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
932057475 2:68461217-68461239 AAGAACAATTGCAGGGAAAGAGG - Exonic
932206867 2:69890989-69891011 AAGAACAAGTGGAGGGAATGAGG - Intergenic
932375210 2:71229267-71229289 AAGAAGCAGTGGAGGGTATGGGG - Intergenic
932478892 2:72026880-72026902 AAAAGGGACTGGAAGGAAAGAGG + Intergenic
932729891 2:74212148-74212170 AAGAAGGAAGGGAAGGAGAGAGG - Intronic
932814330 2:74849690-74849712 AAGAAGGGGTGGAAGGAAAGGGG + Intronic
932823110 2:74918141-74918163 AAGAACGAGAGGAGAGAAAGTGG + Intergenic
932881069 2:75502611-75502633 AAGAAGGAAAAGAGGGAAAGAGG + Intronic
933027323 2:77276371-77276393 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
933120903 2:78536839-78536861 AAGAAGGAAGGAAGGGAGAGAGG + Intergenic
933408016 2:81887594-81887616 GTTAAGGACTGGAGGGAAATGGG - Intergenic
933553755 2:83807285-83807307 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
933654001 2:84872525-84872547 AGGAAGGACTAGAGGGAGGGAGG + Intronic
933725470 2:85424390-85424412 AAGAAGGGAGGAAGGGAAAGAGG - Intronic
933731767 2:85461717-85461739 AAGCAGAATTGGAGGGAAACTGG + Intergenic
934124184 2:88870627-88870649 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
934130271 2:88941402-88941424 AGGCAGGGCTGCAGGGAAAGGGG - Intergenic
934501974 2:94869230-94869252 AGGGAGGATTGGAGGGACAGAGG - Intergenic
934676102 2:96250712-96250734 AAGAAGGAACGGAGAGAACGTGG + Exonic
934728896 2:96643768-96643790 AAGAAGGAAGGGAAAGAAAGGGG + Intergenic
935173702 2:100629722-100629744 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
935191090 2:100779433-100779455 AAGATGGATTAGAGGGAAAGAGG + Intergenic
935309536 2:101769936-101769958 AGGAAAGTCTGGAGGGAAATCGG + Intronic
935316225 2:101836958-101836980 AAGAAATTCAGGAGGGAAAGAGG - Intronic
935400590 2:102656237-102656259 GAGGAGGCCTGTAGGGAAAGAGG - Intronic
935447458 2:103171817-103171839 AATAAGGAAAGGAGGGAAACTGG - Intergenic
935716979 2:105947914-105947936 AAGAAGGAAGGGAGGGACAGAGG + Intergenic
935741479 2:106152476-106152498 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
936053266 2:109241681-109241703 AAGAGGGACTGCAGGGACTGGGG - Intronic
936499886 2:113058791-113058813 AAGAAGGAAAGGAAGGAAAGAGG + Intronic
936504198 2:113092046-113092068 AAGAAGGAAGGGAGGAAGAGGGG + Intergenic
936591906 2:113812373-113812395 AAGAAGGAGAGGGAGGAAAGGGG + Intergenic
936840635 2:116764290-116764312 AAGGAAGAATGAAGGGAAAGTGG - Intergenic
936990639 2:118361593-118361615 AAGCAGTATTGGAGGGAATGGGG - Intergenic
937024997 2:118690518-118690540 AGGAAGGAAGGGAGGGAAAGAGG + Intergenic
937034541 2:118769852-118769874 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
937368276 2:121280795-121280817 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
937838094 2:126494268-126494290 AAGAAGGATGGGAAGAAAAGGGG + Intergenic
938554155 2:132408647-132408669 AAGGAGGAAGGGAGGGAGAGGGG + Intergenic
938680047 2:133680105-133680127 AAGAAGGAAGGGAGGAAAAAAGG + Intergenic
938860583 2:135364091-135364113 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
939758166 2:146138866-146138888 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
940018448 2:149131502-149131524 AAGAAAAAGAGGAGGGAAAGAGG + Intronic
940489611 2:154341617-154341639 AAGAAGGAGGAGAGGAAAAGAGG + Intronic
940576560 2:155513485-155513507 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
940649176 2:156424071-156424093 AACAAGGGCTGGAGAGAACGTGG + Intergenic
940692579 2:156937544-156937566 AAGAAGGAAGGAAGGGAGAGAGG + Intergenic
940875012 2:158889841-158889863 AAGAAGGATTGATTGGAAAGAGG + Intergenic
941079253 2:161041136-161041158 AAGAATGACTGTAGAGAAATGGG - Intergenic
941336054 2:164245112-164245134 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
941569221 2:167148494-167148516 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
941587895 2:167382462-167382484 AAGGAGGAAGGGAGGGAGAGAGG - Intergenic
942043235 2:172084676-172084698 AGGAAGGCTGGGAGGGAAAGAGG + Intergenic
942121844 2:172785801-172785823 AAGAAGAAGTGGAGAGAAAGGGG - Intronic
942206471 2:173624688-173624710 AAGAAGAACTGGCGTGGAAGAGG + Intergenic
942289427 2:174454655-174454677 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
942487901 2:176458512-176458534 CAGAGGGACTTGAGGGTAAGTGG - Intergenic
942573028 2:177332569-177332591 AAGATGGAGTTCAGGGAAAGTGG + Intronic
942845113 2:180414954-180414976 AAGAAGGATGGGAAGGTAAGGGG + Intergenic
942874352 2:180776113-180776135 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
943016454 2:182516666-182516688 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
943022240 2:182589250-182589272 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
943060963 2:183040821-183040843 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
943330758 2:186556300-186556322 AAGAAGGAATAGAGGGAGGGAGG - Intergenic
943575940 2:189631108-189631130 AAGAAGGAAGGGAGGAAAGGTGG + Intergenic
944177651 2:196850710-196850732 AGGGAGGAAGGGAGGGAAAGAGG + Intronic
944406750 2:199393253-199393275 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
944676444 2:202036545-202036567 AAGAAGACCTGGGTGGAAAGCGG + Exonic
944727285 2:202484347-202484369 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
944737119 2:202577252-202577274 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
944809050 2:203310010-203310032 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
945028962 2:205645837-205645859 AAGAAGGAACGGAGGGAGGGAGG + Intergenic
945093669 2:206199458-206199480 AAGAATGCCGGGAGGGAAAGAGG + Intronic
945136779 2:206637844-206637866 ATGAAAGACTGGGAGGAAAGGGG - Intergenic
945269107 2:207921038-207921060 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
945472190 2:210240002-210240024 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
945600947 2:211864189-211864211 AAGAAGGAGAGGTGGGAAAAAGG - Intronic
946165753 2:217862924-217862946 AGGATGGTCTGGAGGGAATGGGG - Intronic
946340363 2:219062696-219062718 TAGAGGGGCAGGAGGGAAAGGGG - Intergenic
946524817 2:220507271-220507293 AGGAAGGGCTGGAGGGACGGAGG - Intergenic
946643488 2:221808813-221808835 AAAAAGGAAGGGAGGGAAAGTGG + Intergenic
946736148 2:222756579-222756601 AATGAGGCCAGGAGGGAAAGGGG - Intergenic
946853188 2:223927908-223927930 AAGGAGGCCTGGGGGGAAAGGGG + Intronic
946999601 2:225438980-225439002 GAGATGTGCTGGAGGGAAAGCGG + Intronic
947077684 2:226363836-226363858 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
947228439 2:227862020-227862042 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
947272138 2:228348071-228348093 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
947341857 2:229148777-229148799 AAGAAGGAAGGGAGAGAGAGAGG + Intronic
947504739 2:230699167-230699189 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
947629907 2:231645392-231645414 AGGAAGGACAGGAGGGAGGGAGG - Intergenic
947903896 2:233745709-233745731 CAGAATGGCTGGAGGGTAAGAGG + Intronic
948037832 2:234873534-234873556 AAGAAGGAAGGGTGGGCAAGGGG + Intergenic
948181370 2:235983386-235983408 AAGAAGGAAAGGAGAAAAAGGGG - Intronic
948402473 2:237693641-237693663 AAGAAGGAAGGGTGGGAATGTGG + Intronic
948434907 2:237946457-237946479 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1168915531 20:1482582-1482604 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1169246393 20:4028382-4028404 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1169574068 20:6938931-6938953 AAGAAGGAAGAGAGGGAAAGAGG - Intergenic
1169593304 20:7169663-7169685 AAGAAGGACAAATGGGAAAGAGG + Intergenic
1169670456 20:8094459-8094481 AACAAGAACTGGAGGGAACTGGG + Intergenic
1169766729 20:9154855-9154877 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1169869763 20:10238041-10238063 AAGGAGGTCTGGAGGATAAGAGG - Intronic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170346084 20:15388243-15388265 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170501842 20:16982538-16982560 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1170702111 20:18713015-18713037 AAGAAGGAAGGCTGGGAAAGTGG - Intronic
1170859910 20:20093285-20093307 ATTAGTGACTGGAGGGAAAGGGG + Intronic
1170938225 20:20827825-20827847 AAGAAGGAAGGGAGGGAGGGGGG + Intergenic
1171202668 20:23254639-23254661 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1171327428 20:24307659-24307681 GTGTAGGACTGCAGGGAAAGAGG - Intergenic
1171344105 20:24452690-24452712 AAGGAGGGCTGGAGGGAAAGGGG - Intergenic
1171360044 20:24581084-24581106 GAGAAGCAATGGAGGCAAAGTGG + Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171862468 20:30413181-30413203 AAGAAGGGAAGGAAGGAAAGAGG + Intergenic
1172756093 20:37285554-37285576 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1173001797 20:39110329-39110351 AGGAAGGACCGAAGGGAAAAAGG - Intergenic
1173144216 20:40510866-40510888 AAGGAGGAAGGAAGGGAAAGAGG + Intergenic
1173187508 20:40852034-40852056 AAGAAGGACTTGAGAGAGAAAGG + Intergenic
1173197252 20:40925813-40925835 AAGAAGGAAGGGAGGGATGGAGG + Intergenic
1173444664 20:43106706-43106728 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1173503606 20:43570602-43570624 AAGAAGAGCTGGAGGGGAGGAGG - Exonic
1173965258 20:47107792-47107814 AAGAAGGAAGGGAAGGGAAGGGG + Intronic
1173990172 20:47296251-47296273 AAGAAGGAGTGGGGGGTGAGAGG - Intronic
1174178441 20:48659333-48659355 AAGGAGGAAGGGAGGGAAAGAGG + Intronic
1174216527 20:48920798-48920820 GAGAAAGACAGGAGGGAGAGGGG - Intergenic
1174221569 20:48959590-48959612 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1174573224 20:51518535-51518557 AAAAAGGACTGCAGGGTAAGAGG - Intronic
1174724311 20:52845330-52845352 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1174740417 20:53008206-53008228 AAGAAACACTGGATGGAAAGAGG + Intronic
1174742768 20:53031908-53031930 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1174763545 20:53230038-53230060 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1174766579 20:53260034-53260056 AGGAAGGAAAGAAGGGAAAGAGG - Intronic
1174819101 20:53712127-53712149 AAGAAGGAAGGAAGGGAAGGAGG - Intergenic
1174952328 20:55055895-55055917 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1175413344 20:58785691-58785713 AAGAAAGAGAGGAGGGAAGGGGG + Intergenic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1175831553 20:61967585-61967607 AGGAAGGAAGGGAGGGGAAGGGG - Intronic
1175984011 20:62755280-62755302 AGGAATGAATGGAGGGAAGGAGG - Intronic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1176624039 21:9075952-9075974 AGGGAGGATTGGAGGGACAGAGG + Intergenic
1176874877 21:14117552-14117574 AATAAAGGCTGGAGGGAAAAAGG + Intronic
1176952037 21:15059522-15059544 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1177180004 21:17734811-17734833 AGGAAGGGCGAGAGGGAAAGAGG + Intergenic
1177234203 21:18365520-18365542 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1177273426 21:18877093-18877115 AAGAAGGAATAGAGAGAAAGGGG + Intergenic
1177289727 21:19095814-19095836 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
1177491667 21:21833577-21833599 ACAAAGTAGTGGAGGGAAAGAGG + Intergenic
1177637510 21:23806660-23806682 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1177642959 21:23867712-23867734 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1177856993 21:26410915-26410937 AAGCAAGACTTTAGGGAAAGAGG - Intergenic
1177902051 21:26928590-26928612 AAAAAGGAAAGGAGGGAGAGAGG - Intronic
1178042274 21:28652451-28652473 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1178043954 21:28673154-28673176 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1178247617 21:30968978-30969000 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1178259479 21:31085616-31085638 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1178307619 21:31503542-31503564 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1178337879 21:31759937-31759959 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1178503838 21:33147233-33147255 AAGAAGGAACGGAGGGAGGGAGG + Intergenic
1178637495 21:34317400-34317422 AAGAAGGAATGGGGGAAAGGAGG - Intergenic
1178682266 21:34682788-34682810 AAAAAAAAATGGAGGGAAAGGGG - Intronic
1178734069 21:35132987-35133009 AAAATGTACTGGAAGGAAAGAGG - Intronic
1178741592 21:35206779-35206801 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1179040462 21:37797852-37797874 AAGAAGAAATGAAGGGAAATGGG + Intronic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179288086 21:39995270-39995292 GAGAAGGACTGGAGTCCAAGTGG + Intergenic
1179296843 21:40070326-40070348 AAGAAGGAAGGTAGGGAAGGAGG + Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1179435953 21:41362262-41362284 AAGAGGCTCTGGAGGGGAAGTGG + Intronic
1179535004 21:42045747-42045769 AAGTAGGACAGGAAGGGAAGGGG - Intergenic
1179725468 21:43339227-43339249 GAGAAGAACAGGAGAGAAAGAGG - Intergenic
1179986594 21:44925401-44925423 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1180315028 22:11270630-11270652 AAGAAGGAAGGGAGGAAGAGAGG + Intergenic
1180656863 22:17429097-17429119 AAGAAGGATTGGTGGGATAGGGG + Intronic
1180790988 22:18575422-18575444 AATAAGGACTTGAGGGGAGGCGG + Intergenic
1181230747 22:21419892-21419914 AATAAGGACTTGAGGGGAGGCGG - Intronic
1181247900 22:21514977-21514999 AATAAGGACTTGAGGGGAGGCGG + Intergenic
1181662497 22:24362585-24362607 AAATAGGACAGCAGGGAAAGGGG - Intronic
1181719039 22:24759834-24759856 AAGAAGGACATGAGGGGCAGGGG - Intronic
1182016419 22:27043960-27043982 AAGAAGGACAAAAGGGAAGGAGG - Intergenic
1182031594 22:27163289-27163311 AAAAGGGAAGGGAGGGAAAGGGG + Intergenic
1182031650 22:27163709-27163731 AAGAAAGAAAGGAGGGAAACAGG + Intergenic
1182033186 22:27176159-27176181 AGGAAGGGAAGGAGGGAAAGTGG + Intergenic
1182106123 22:27691020-27691042 AAGAAAGAATGGAAGGAAGGAGG + Intergenic
1182126045 22:27816638-27816660 AAGAAAGAAAGGAGGGAGAGAGG - Intergenic
1182402066 22:30086144-30086166 AAGGAGGAAGAGAGGGAAAGGGG - Intronic
1182818957 22:33196768-33196790 AAGAAGAAGAGGAGGAAAAGAGG + Intronic
1182931438 22:34178199-34178221 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1183115586 22:35690050-35690072 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1183214945 22:36473557-36473579 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1183239134 22:36643000-36643022 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
1183354548 22:37351170-37351192 GAGAAGGACTGGGAGGAGAGAGG - Intergenic
1183465269 22:37977183-37977205 AAGAATGGCTGGTGGGAAAGAGG + Intronic
1183566476 22:38619101-38619123 AAGAAGAACAGGAGGTACAGAGG + Intronic
1183698788 22:39438142-39438164 AGGAAGGAAGGGAGGGAAGGGGG - Intergenic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1183722410 22:39570312-39570334 AAGACGGAAGGGAGGGAGAGAGG - Intergenic
1184248423 22:43247173-43247195 AAGAAGGAAAGGATGGAAAGTGG + Intronic
1184314033 22:43668940-43668962 AACAAGAACTGGAGAGACAGTGG + Exonic
1184608905 22:45590229-45590251 ATGAAGGTCTGGAGGGATGGGGG - Intronic
1184630966 22:45779421-45779443 AAGACGGACTGGAAGGAAGAGGG + Intronic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1185037018 22:48484709-48484731 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1185155382 22:49190629-49190651 AAGAAGGAAGGAAGGGAGAGAGG + Intergenic
1185364336 22:50430016-50430038 AAGGAGGACTGTATGGAGAGGGG - Intronic
1203237697 22_KI270732v1_random:21802-21824 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
949214772 3:1552533-1552555 AAGTAGGAGTGCAGAGAAAGAGG + Intergenic
949374212 3:3368966-3368988 AAGAAAAACTGGAGGGAAAGTGG - Intergenic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
949823315 3:8138664-8138686 AGGAAGGAAGGGAGGGGAAGGGG + Intergenic
950053574 3:10009303-10009325 GAGGAGGTCTGGGGGGAAAGGGG - Intronic
950394782 3:12725894-12725916 AAGAGGGACAGTGGGGAAAGGGG + Intergenic
950539097 3:13599439-13599461 AAGGAGGTCAGGAGGGGAAGTGG + Intronic
950585126 3:13886864-13886886 AAGAAGGAGAGGTGGGAAGGAGG + Intergenic
950728625 3:14936635-14936657 AGGCTGGACTGGAGGGAAAAAGG - Intergenic
950779431 3:15378668-15378690 AAGATGGAGTGGCTGGAAAGAGG + Intergenic
950794888 3:15502756-15502778 AAGAAGGACTCTGAGGAAAGAGG + Intronic
950907559 3:16552972-16552994 AAGAAGGAAAGGAAGGGAAGGGG + Intergenic
951193523 3:19798468-19798490 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
951479828 3:23148517-23148539 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951595718 3:24316355-24316377 AGGAAGGAAAGGATGGAAAGAGG - Intronic
951615825 3:24542533-24542555 AAGTAGGAAGGGAGGGAGAGAGG + Intergenic
951829369 3:26907306-26907328 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
951864328 3:27290798-27290820 AAGAAGGAGAAGAGAGAAAGAGG + Intronic
952047712 3:29344120-29344142 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
952145334 3:30525986-30526008 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
952373988 3:32749900-32749922 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
952518683 3:34132244-34132266 AAGAAAGACTAGAGAGAGAGGGG + Intergenic
952568006 3:34681363-34681385 AATAAAGGCTGGAGGGAAAAAGG + Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952708293 3:36402299-36402321 AAGAAGGAAGGAAGGGAAAAGGG + Intronic
952717894 3:36499529-36499551 AAGAAAGAAGGGATGGAAAGTGG + Intronic
953050500 3:39337661-39337683 AAGTATTACTGGAGAGAAAGAGG - Intergenic
953175133 3:40543957-40543979 AAGAAGGACTCCAGGAAAAAAGG + Intronic
953202887 3:40793409-40793431 AAGAAGGAATGAAGGAAAAAAGG - Intergenic
953273886 3:41475949-41475971 AGGAAAGGATGGAGGGAAAGAGG + Intronic
953427864 3:42810563-42810585 AAGAAAAAGTGGAGGGAAAGGGG - Intronic
953704994 3:45224876-45224898 AAGACGGAGAGGAGGGAAATGGG - Exonic
953876756 3:46671057-46671079 TAACAGGACTGGAGGGAGAGAGG + Exonic
954110592 3:48430739-48430761 AAGTGGGAGTGGAGGAAAAGGGG - Intergenic
954155967 3:48685184-48685206 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954611932 3:51949104-51949126 AACAGGGATTGGAGGGAAGGGGG - Intergenic
954857119 3:53653742-53653764 CAGAAGGAGAGGAGAGAAAGAGG + Intronic
955066636 3:55538858-55538880 AAGAAGGGATAGAGGGATAGAGG - Intronic
955306288 3:57836225-57836247 AAGAAGGAATAGAGGAGAAGAGG + Intronic
955832634 3:63020550-63020572 AAGAAGGGAGGGAGGGAGAGAGG + Intergenic
956329303 3:68087614-68087636 AAGAAGGGTGGGAGGGAGAGAGG - Intronic
956486030 3:69722740-69722762 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
956525905 3:70160362-70160384 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
956568231 3:70663896-70663918 AAGACATACTGGAGGGAAACTGG - Intergenic
956665425 3:71637577-71637599 AGGAAGGATGGGAGGGAGAGAGG + Intergenic
956725925 3:72156470-72156492 AGGGAGGAGTGAAGGGAAAGAGG + Intergenic
956756532 3:72393406-72393428 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
956961754 3:74411031-74411053 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
957220849 3:77380692-77380714 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
957611422 3:82472164-82472186 GAGAAGGACAGGAGGGAGACAGG + Intergenic
957958870 3:87224779-87224801 AAGAAGGACAGAAGGGTAAAAGG - Intergenic
958073559 3:88646913-88646935 AAGATGGGATGGAGGGAAAGGGG + Intergenic
958471325 3:94524234-94524256 AAGAGGGACTGGAGAGGGAGGGG - Intergenic
958479460 3:94628169-94628191 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
958927136 3:100171210-100171232 AGGAAGGAAGGAAGGGAAAGAGG - Intronic
958933185 3:100229351-100229373 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
959205223 3:103298400-103298422 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
959282206 3:104358680-104358702 AAGAAGGAAGAGAGGGAGAGAGG - Intergenic
959368614 3:105494626-105494648 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
959456706 3:106571876-106571898 AATAAAGGCTGGAGGGAAAAGGG + Intergenic
959721355 3:109493553-109493575 AAGATGGAAGGAAGGGAAAGGGG - Intergenic
959926880 3:111932014-111932036 AAGAAGGGAGGGAAGGAAAGTGG + Intronic
960286827 3:115839217-115839239 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
960673841 3:120176263-120176285 AAGAAGGAAGGAAGGGAGAGAGG - Intronic
960674060 3:120177863-120177885 AAGAAAGCTAGGAGGGAAAGAGG + Intronic
960770017 3:121183659-121183681 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
960822892 3:121752985-121753007 AAGAGGGATGGTAGGGAAAGGGG + Intergenic
960935001 3:122893771-122893793 AGGAAGGGCTGGAGGGAGGGAGG + Intergenic
961320988 3:126075457-126075479 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
961480716 3:127178009-127178031 AAGCAGGACTGGACAGACAGAGG - Intergenic
961522761 3:127476732-127476754 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
961639038 3:128353446-128353468 GAGGAGGAGAGGAGGGAAAGAGG - Intronic
961812064 3:129527700-129527722 AAGATGGAGTGGAGGGAGGGAGG - Intergenic
961881824 3:130067042-130067064 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
962042660 3:131723367-131723389 ATGAAGGAAGAGAGGGAAAGGGG + Intronic
962199301 3:133388479-133388501 TGGAAGGAAGGGAGGGAAAGAGG + Intronic
962201950 3:133407573-133407595 AAGAAAGAGTGGAGGGGAGGAGG + Intronic
962207889 3:133450079-133450101 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
962231829 3:133672725-133672747 AAGAGGGAAGGGAGGGGAAGGGG + Intergenic
962304452 3:134273215-134273237 AGGATGGACTGGAGGGGAAATGG + Intergenic
962619886 3:137167898-137167920 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
962711685 3:138091654-138091676 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
962777092 3:138671917-138671939 AAGAAAAAGTGGAGAGAAAGGGG + Intronic
962784757 3:138757609-138757631 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
962784843 3:138758241-138758263 AAAAAGGAATTGAGGGAAAGGGG + Intronic
963008630 3:140749437-140749459 AAGAAAGGAGGGAGGGAAAGAGG + Intergenic
963186812 3:142428015-142428037 AAGAAGGAAGGGAAGAAAAGAGG - Intronic
963492162 3:146015679-146015701 GAGAAGAACAGGAGGGGAAGAGG - Intergenic
963543129 3:146620273-146620295 AAGAAAGAGAGGAAGGAAAGAGG - Intergenic
963627397 3:147690629-147690651 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
963715708 3:148801378-148801400 ATGAAGGGATAGAGGGAAAGAGG - Intronic
963853018 3:150226478-150226500 AGGAAGGAATGGAGGGGAAGGGG + Intergenic
964434750 3:156639943-156639965 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
964527970 3:157635652-157635674 AAGAAAGAAAGAAGGGAAAGAGG + Intronic
964592075 3:158376156-158376178 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
964779054 3:160315046-160315068 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
964903872 3:161694045-161694067 AGGGAGGAAGGGAGGGAAAGAGG - Intergenic
964914647 3:161825709-161825731 GAGAGGGAAGGGAGGGAAAGAGG - Intergenic
965186901 3:165476518-165476540 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965186953 3:165476684-165476706 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965430601 3:168582932-168582954 ATGAAGGAGTGCAGGGGAAGTGG - Intergenic
965498944 3:169433583-169433605 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
965620970 3:170642061-170642083 AAGCAGGAATGGAAGGAGAGTGG - Intronic
965775683 3:172228187-172228209 AAGAATCACTGGAGGGAGAAAGG + Intronic
965851250 3:173028002-173028024 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
966028149 3:175311643-175311665 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
966204772 3:177394848-177394870 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
966238175 3:177726043-177726065 ATGAAGGAGAGGAGGGAAATGGG - Intergenic
966270334 3:178097066-178097088 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
966272635 3:178126267-178126289 AAGAAGGAAAGAAAGGAAAGAGG + Intergenic
966273823 3:178141373-178141395 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
966398839 3:179527144-179527166 AGGAAGGGGTGGAGGGGAAGGGG + Intergenic
966424795 3:179769807-179769829 AAGAAGGAAGGGATGGAAGGAGG - Intronic
966569399 3:181424070-181424092 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
966857554 3:184205700-184205722 AAGATGGACTAGGGGGAAGGGGG - Intronic
967191294 3:186987139-186987161 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
967478499 3:189947703-189947725 GAGAAGGATTGGAGGAAAAAAGG - Intergenic
967666671 3:192181007-192181029 AAAAAGGGCTGGATGGAATGAGG + Intronic
967850135 3:194076167-194076189 GAGAAGGAGTGGAGGAAAACAGG - Intergenic
968286992 3:197514566-197514588 AGGAACGACAGGAGGTAAAGAGG + Intronic
968339337 3:197941546-197941568 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
968366866 3:198192321-198192343 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
969436082 4:7190379-7190401 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
969459414 4:7320891-7320913 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
969525297 4:7701180-7701202 AAGGAGGAAGGGAGGGAGAGGGG + Intronic
969784627 4:9445206-9445228 AAGAAGGGCTAGAGGTGAAGAGG + Intronic
970043900 4:11828123-11828145 AAGAAGGGAGGGAGGGAGAGAGG - Intergenic
970068531 4:12127831-12127853 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
970249021 4:14094491-14094513 TAGGAGGGCTGGTGGGAAAGGGG - Intergenic
970301742 4:14688440-14688462 AAGAAAGAAAGGAGGGAAGGAGG + Intergenic
970365064 4:15350128-15350150 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
970383719 4:15535346-15535368 AAGAAGGAGGGGAGGGATGGAGG - Intronic
970564394 4:17317358-17317380 AGGAAGGAATGGAGGAAGAGAGG + Intergenic
970690352 4:18612688-18612710 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
970697978 4:18699660-18699682 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
970914927 4:21321764-21321786 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
971311074 4:25526135-25526157 AATAAGCACTGGTGGGAAAAGGG + Intergenic
971361277 4:25940766-25940788 AGGAAGGAAGGGAAGGAAAGGGG - Intergenic
971393694 4:26209602-26209624 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393702 4:26209626-26209648 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393710 4:26209650-26209672 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393727 4:26209698-26209720 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393735 4:26209722-26209744 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393743 4:26209746-26209768 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393761 4:26209795-26209817 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393779 4:26209844-26209866 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971394441 4:26215372-26215394 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
971487532 4:27175709-27175731 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
971523931 4:27591690-27591712 AAGAAGGAATGAAGGAAAGGAGG + Intergenic
971563095 4:28106247-28106269 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
971651319 4:29279063-29279085 AAGAAGGAAGCGAGGGAGAGTGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
971956598 4:33428024-33428046 AAGAAAGACTCAAGGGAAAATGG + Intergenic
972103151 4:35447512-35447534 AAGAAGGGAGGGAGGGAGAGAGG + Intergenic
972103201 4:35447715-35447737 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
972161018 4:36227622-36227644 AAGCAGGCATGGGGGGAAAGAGG + Intronic
972418610 4:38866889-38866911 AAGAAGGGATGGAGTGAGAGAGG + Intergenic
972680433 4:41301355-41301377 AAGAAAGACAGTAGGAAAAGAGG - Intergenic
972693200 4:41419762-41419784 AGGAAGGAGAGGAGGGAAAAGGG - Intronic
972697193 4:41459294-41459316 AAGAAGGAAGGAAGGGACAGAGG - Intronic
972722950 4:41719064-41719086 AAGGAGGAAGGGAAGGAAAGGGG + Intergenic
972874630 4:43343477-43343499 AAGAAGGCATGGATGGAAGGAGG - Intergenic
972889731 4:43542275-43542297 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
973016289 4:45142852-45142874 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
973157667 4:46977214-46977236 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
973173522 4:47175040-47175062 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
973657462 4:53063979-53064001 AAGAAGGAAGGGAAGGAGAGAGG - Intronic
973744324 4:53948372-53948394 AAGAAGGACAGGAGAGAAGGAGG + Intronic
973786192 4:54334965-54334987 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
973931567 4:55798101-55798123 AAGAGAGACTGGAAGGGAAGGGG - Intergenic
974251955 4:59395985-59396007 AAATAGGACTGCAGGGAAAAAGG - Intergenic
974374830 4:61062297-61062319 AGGAAGGACGGGAGGGAGGGAGG + Intergenic
974435803 4:61856330-61856352 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
975087456 4:70359618-70359640 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
975089240 4:70381418-70381440 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
975156092 4:71074666-71074688 AAGGAAGAAGGGAGGGAAAGAGG + Intergenic
975570195 4:75808678-75808700 AGGAAGGATGGGAGGGAGAGAGG - Intronic
975851611 4:78578372-78578394 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
975965994 4:79973087-79973109 AAGAAGGAAGGAAGGAAAAGAGG + Intronic
976200195 4:82570376-82570398 AGCAAGGACTGGAAGTAAAGGGG - Intergenic
976322894 4:83735952-83735974 AAGAAGGGAAGGAGGGAAAAGGG - Intergenic
976476688 4:85492091-85492113 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
976512537 4:85928319-85928341 AGGAAGGACGGGAGGAAAGGAGG - Intronic
976561326 4:86504907-86504929 AAGAGGGACTGTAGGCAAACTGG - Intronic
976766619 4:88604453-88604475 GCCTAGGACTGGAGGGAAAGAGG - Intronic
976810248 4:89092416-89092438 AGGAAGGACGGGAGGGAGGGAGG + Intronic
976873158 4:89821265-89821287 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
976909256 4:90280315-90280337 AAGAAGGAAGGGAGGGAGAAAGG - Intronic
976960525 4:90966158-90966180 AAGAAGGAGTGAAGAGAAAGTGG + Intronic
977451659 4:97206750-97206772 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
977517973 4:98045950-98045972 AAGAAGGAGAGAAGAGAAAGAGG - Intronic
977655216 4:99513657-99513679 AGGAAGGAAGGGAGGGAATGAGG - Intronic
977851273 4:101832851-101832873 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
977898139 4:102386904-102386926 AAGAAAGACTTGAAGGAAGGTGG - Intronic
978071616 4:104479749-104479771 AGGAAGGAAGGGAGGGAGAGGGG - Intronic
978177795 4:105755311-105755333 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
978282774 4:107036905-107036927 TAGAGGGTCTGGAAGGAAAGGGG + Intronic
978497164 4:109372357-109372379 AAAAAGAACTCGAGGGGAAGGGG + Intergenic
978826210 4:113027002-113027024 AAGAAGGGCTGGGGTGAGAGTGG + Intronic
978888119 4:113790373-113790395 AAGAAGGACTAGAAAGAAATGGG - Intergenic
978954006 4:114593955-114593977 AATAAAGGCTGGAGGGAAAAAGG - Intergenic
979032421 4:115666302-115666324 AAGAAGGAAGGGAGGCAAGGAGG - Intergenic
979255280 4:118601930-118601952 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
979476021 4:121158163-121158185 AAGAAGCTCTGGTGAGAAAGGGG - Intronic
979877880 4:125916494-125916516 AAGAAGGAAGGAAGAGAAAGGGG - Intergenic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
980121336 4:128731323-128731345 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
980180590 4:129395554-129395576 AAGAAGCATTTGAGGGAAAAAGG - Intergenic
980194179 4:129566548-129566570 AAGAAAGACTGAAGGGTTAGGGG + Intergenic
980196532 4:129596134-129596156 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
980285225 4:130771500-130771522 AAGAAGGAATGTAGGGAAATGGG - Intergenic
980727597 4:136785569-136785591 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
981183229 4:141770032-141770054 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
981676620 4:147350251-147350273 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
982052724 4:151518650-151518672 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
982129141 4:152211662-152211684 AGGAAGGAAAGGAGGGAGAGAGG + Intergenic
982162203 4:152581516-152581538 GAGAAGGAGTGGAAGGAAAGTGG - Intergenic
982321039 4:154077846-154077868 GAGAAGGGCAGGAGGGAAATGGG + Intergenic
982587920 4:157266112-157266134 AGGAAGGTCTGAAGGGAAAATGG + Intronic
982708643 4:158737463-158737485 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
982846018 4:160253358-160253380 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
982878456 4:160677307-160677329 AAGGAGGAAGGAAGGGAAAGAGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
982985723 4:162203590-162203612 AAGAAGCACTGGCGGGAACCGGG + Intergenic
983202199 4:164873294-164873316 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
983552547 4:169032371-169032393 AAGAAGGAAAGAAGGGAAGGAGG - Intergenic
983713491 4:170749214-170749236 AAGAAGACTTGGAGGGAGAGGGG - Intergenic
984140001 4:175993144-175993166 AAGAAAGAGGGGAGGGAGAGAGG - Intronic
984164203 4:176288179-176288201 AAGAAGGAAGGTAGGGGAAGGGG - Intergenic
984224956 4:177023529-177023551 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
984224965 4:177023602-177023624 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
984224990 4:177023784-177023806 AAGAAAGAAAGGAGGGAAGGAGG + Intergenic
984416531 4:179467277-179467299 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
984762851 4:183377377-183377399 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
984837104 4:184032470-184032492 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
984886601 4:184455275-184455297 AAGAAGGAAGGGAGGGGGAGGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985106936 4:186509333-186509355 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
985238062 4:187898513-187898535 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
985261417 4:188118276-188118298 AACAAGGACAGGAGAGGAAGAGG + Intergenic
985797405 5:1973164-1973186 AGGAAGGACAGGAAGGAAGGAGG - Intergenic
985855536 5:2421715-2421737 AAGAGGGAGTGGTGGGGAAGAGG - Intergenic
985857738 5:2443216-2443238 GAGAAGGACGGGAGAGGAAGCGG - Intergenic
985958046 5:3278994-3279016 AGGAAGGAATGGAGGGATGGTGG - Intergenic
987330417 5:16852112-16852134 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
987471549 5:18336466-18336488 AAGAAGGAATGGAGGAAAAGTGG + Intergenic
987510872 5:18836429-18836451 AAGAAGGAAGGGAAGGCAAGGGG - Intergenic
987723840 5:21671753-21671775 AAGGAGGAATGGAGGGAGGGAGG - Intergenic
987749176 5:22017747-22017769 AAAAAAGAATGGAGGGAAACTGG - Intronic
988251557 5:28764791-28764813 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
988331809 5:29850953-29850975 AAGAAGGAGGAGAAGGAAAGAGG + Intergenic
988346074 5:30039471-30039493 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
988350581 5:30101073-30101095 GAGAAGGGCTGGAGAGGAAGAGG - Intergenic
988561252 5:32283607-32283629 AAGAAGGAATGAAAGGAAAAAGG + Intronic
988640662 5:33037709-33037731 AAGAAGGACCAGAGATAAAGTGG + Intergenic
988705841 5:33725268-33725290 AAGATGAACTGGAAGGAAATCGG - Intronic
988830135 5:34978927-34978949 ATTCAGCACTGGAGGGAAAGTGG + Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
988841362 5:35086979-35087001 AAGAAAAAGTGAAGGGAAAGGGG - Intronic
988924595 5:35976862-35976884 AAGAAGGGACGGAGGGAGAGAGG + Intronic
989007057 5:36826801-36826823 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
989182807 5:38595450-38595472 CCCAGGGACTGGAGGGAAAGAGG + Intronic
989218575 5:38930023-38930045 AGAAAGGGCTGGAGGAAAAGTGG - Intronic
989784074 5:45305824-45305846 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
989972361 5:50540363-50540385 AAGAAAGAAAGGAAGGAAAGAGG + Intergenic
990136880 5:52655987-52656009 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
990254355 5:53950424-53950446 AATAAGGACTGGAGACAGAGGGG + Intronic
990259638 5:54007741-54007763 AAGAAGGTCTATAAGGAAAGAGG - Intronic
990759551 5:59113104-59113126 AAGAAGGAAGTGAGGGAAGGTGG - Intronic
991024352 5:62014131-62014153 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
991172298 5:63642588-63642610 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
991517532 5:67455270-67455292 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
991597573 5:68321302-68321324 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
992186434 5:74249021-74249043 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
992256728 5:74928762-74928784 AAAAAGGAATGGAGGGAGAAAGG - Intergenic
992865891 5:80956862-80956884 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
992873172 5:81026068-81026090 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
992996292 5:82337184-82337206 AGGAAGGGAGGGAGGGAAAGAGG - Intronic
993204584 5:84863328-84863350 AGGAAGGAATGGAGGAGAAGAGG - Intergenic
993257282 5:85607585-85607607 AAGAAAGAAGGGAGGTAAAGAGG + Intergenic
993379107 5:87185832-87185854 AAAAAGGACTGGAGGTGAAGTGG + Intergenic
993536970 5:89098578-89098600 AGGAAGGAATGAAGGGAAGGAGG - Intergenic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
993699288 5:91099319-91099341 AACAAGGAGAGGAGGCAAAGAGG - Intronic
993700060 5:91108583-91108605 AAAAAAGACTGTAGAGAAAGAGG - Intronic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
994422636 5:99540164-99540186 AAGGAGAACTGGAAAGAAAGAGG + Intergenic
994459735 5:100057341-100057363 AAGGAGAACTGGAAAGAAAGAGG - Intergenic
994523938 5:100880104-100880126 AAGAAGAAAGGGAGGGAAAGAGG - Intronic
994842288 5:104941102-104941124 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
995314629 5:110754502-110754524 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
995404070 5:111774238-111774260 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
995418697 5:111938077-111938099 TAGAAGGACTGGATGGACACAGG - Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995947696 5:117669662-117669684 AAGAAGGACTGAAGGGAGAATGG - Intergenic
996092682 5:119366095-119366117 AAGTAGGAGTGGAGAGAGAGAGG + Intronic
996575929 5:124976471-124976493 AGGAAGGTGTGGAGGGAGAGGGG - Intergenic
996592004 5:125158584-125158606 AAGAAGGAAGGAAGGGGAAGGGG - Intergenic
996924809 5:128811896-128811918 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
997191601 5:131942026-131942048 AAGAAGGACTGGAAAGAATCAGG - Intronic
997411847 5:133696715-133696737 AAGAAGGGCTGTGGGGAAGGAGG + Intergenic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
997905311 5:137810831-137810853 AATAAGGGAAGGAGGGAAAGAGG - Intergenic
998056555 5:139083138-139083160 AAGAGGGTGTGGAGGGGAAGGGG + Intronic
998080676 5:139273013-139273035 AAGAGCCACTGGAGGGGAAGTGG - Intronic
998108189 5:139481736-139481758 CAGAAGGGCAGGAGGGCAAGGGG - Intronic
998152842 5:139766896-139766918 AGGAAGGAAGGGAGGGAAAGAGG - Intergenic
998473669 5:142403117-142403139 AAGAAAGAGAGGAGAGAAAGAGG - Intergenic
998638919 5:143987484-143987506 AGGAGGGAATGGAGGGAATGAGG - Intergenic
998765111 5:145477877-145477899 AAGAGGAATAGGAGGGAAAGGGG + Intronic
998836661 5:146208395-146208417 AGGAAGGACAGGAGGGAGACAGG + Intronic
999423555 5:151466182-151466204 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000115289 5:158148636-158148658 AAGAAGGGAAGGAGGGAGAGAGG - Intergenic
1000222553 5:159227842-159227864 AAGAAGCAAGGGAGGGAGAGAGG - Intergenic
1000304594 5:159983885-159983907 AAGAACGCGGGGAGGGAAAGTGG - Intergenic
1000378951 5:160611739-160611761 AAAAAGGAAAGGAGGGAGAGAGG - Intronic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1000626422 5:163544596-163544618 AAGAAGGGAGGGAGGGAGAGAGG + Intergenic
1000800007 5:165714097-165714119 AGGAAGGAGAAGAGGGAAAGGGG - Intergenic
1000827081 5:166058417-166058439 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1000841042 5:166219030-166219052 AGGAAGGAATGGAGGAAGAGAGG + Intergenic
1000903738 5:166937772-166937794 AAGAAAGGATGGAAGGAAAGAGG + Intergenic
1000976815 5:167774179-167774201 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1000984882 5:167855816-167855838 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1001003807 5:168031790-168031812 AAGGAGGAAGGGAGGGAGAGAGG + Intronic
1001170168 5:169411780-169411802 AAAAAAGATTGGAGGGGAAGAGG + Intergenic
1001235474 5:170025779-170025801 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1001280477 5:170382958-170382980 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1001408704 5:171495287-171495309 AGGAAGGAAAGGAGGGACAGAGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001483029 5:172101672-172101694 AAGAAGTAGGGCAGGGAAAGGGG + Intronic
1001558456 5:172652687-172652709 AAGAAAGTCAGGAGGGATAGAGG + Intronic
1001647013 5:173289716-173289738 AAGGAGGAAGGGAGGGAAGGGGG - Intergenic
1001802823 5:174558675-174558697 AAGAAGGAAGGAAGGGAAGGAGG - Intergenic
1001929172 5:175660494-175660516 AAAAAAGACTGGAAGGAAATAGG + Intronic
1001951951 5:175822536-175822558 AAGATGGCCTGAAGGGAAAAGGG + Intronic
1002214180 5:177618119-177618141 AAGAAAGAAGGGAGGGAAGGAGG - Intergenic
1002726089 5:181297519-181297541 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1002863970 6:1104852-1104874 AAAAAGGAAGGCAGGGAAAGAGG + Intergenic
1002913853 6:1512517-1512539 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1003147407 6:3520350-3520372 AAGAAGGAAGGAAGGGACAGAGG - Intergenic
1003287237 6:4745413-4745435 AAGAAAGGAGGGAGGGAAAGAGG - Intronic
1003538868 6:7000602-7000624 AAAAAGGAAGGGAGGGAAGGAGG + Intergenic
1003554698 6:7129296-7129318 AAGATGGGTTGGAGGGATAGTGG + Intronic
1003672908 6:8176414-8176436 AAGAAGGAATGAAGGGAGGGAGG - Intergenic
1003843665 6:10149702-10149724 AAGAAGGAGTGGAGGTAGACAGG - Intronic
1003866344 6:10366271-10366293 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1003872214 6:10412452-10412474 GAGGAGGAAGGGAGGGAAAGAGG + Intronic
1003878806 6:10462083-10462105 AGGAAGGAAAGGACGGAAAGAGG + Intergenic
1003942115 6:11039900-11039922 AGGAAGGAATGGAGAGAATGTGG + Intronic
1004131236 6:12921761-12921783 AAGAAGGAAGGGAGAGAAACAGG + Intronic
1004131259 6:12921824-12921846 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1004751289 6:18565404-18565426 AAGAAGGAAGGGAGAGAAGGAGG - Intergenic
1004751325 6:18565584-18565606 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1005024707 6:21451435-21451457 GAGAAGGACTGGTGGTAAAGAGG - Intergenic
1005176250 6:23047922-23047944 AATAATGACAGGAGAGAAAGGGG - Intergenic
1005471561 6:26166410-26166432 AAGAAGGAATAAAGGGAAGGAGG - Intronic
1005569793 6:27133655-27133677 AAGAAAAACTAGAGGGAAGGTGG + Exonic
1005730752 6:28694490-28694512 CAGAAGAAGTTGAGGGAAAGGGG + Intergenic
1005986937 6:30881495-30881517 AACAGAGAGTGGAGGGAAAGAGG - Intronic
1006000673 6:30962783-30962805 AAGAAAGACAGGAAGGAAGGAGG + Intergenic
1006088668 6:31615198-31615220 AGGAAGGAATGAGGGGAAAGGGG + Exonic
1006149504 6:31979153-31979175 GAGAGAGACAGGAGGGAAAGAGG + Intronic
1006215860 6:32442224-32442246 AAGAAGGACTGGTTATAAAGAGG - Intronic
1006228278 6:32559016-32559038 CAGAGAGACTGAAGGGAAAGAGG + Intronic
1006513562 6:34534138-34534160 AAGGAGGACTGAGGGGAAACAGG - Exonic
1006716334 6:36123089-36123111 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1007079951 6:39092908-39092930 AAAAAGGGCTGTAGTGAAAGAGG + Intergenic
1007104100 6:39271648-39271670 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1007179798 6:39921694-39921716 AGGAAGGAATGGAGGGAGCGAGG + Intronic
1007348692 6:41252394-41252416 AAGAAGGAAAGGAGGAAAGGAGG - Intergenic
1007679803 6:43626195-43626217 AAGGAGAACTGGTGGGGAAGGGG + Intronic
1007874513 6:45080784-45080806 ATGAAGAAGTGGAGGTAAAGTGG + Intronic
1007928203 6:45667306-45667328 TGGAAGGACTGGAGGAACAGTGG + Intergenic
1008013025 6:46489236-46489258 AAGAAAGAGTGGAGGGAATCTGG - Intronic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1008418609 6:51271709-51271731 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1008628638 6:53343194-53343216 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
1008672483 6:53785656-53785678 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1008762915 6:54875712-54875734 AAGAAGAGGTGGAGGGGAAGAGG + Intronic
1009828387 6:68897575-68897597 AAGAAGGAAGGGAGGGATAGGGG + Intronic
1009828881 6:68904028-68904050 AACAAGGAAGGGAGGGAAGGAGG + Intronic
1009924968 6:70109471-70109493 AAGAAGGGTTGGGGGGCAAGTGG + Intronic
1010084551 6:71901621-71901643 GTGAAGGACTGGCTGGAAAGGGG + Intronic
1010168131 6:72941399-72941421 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
1010168151 6:72941471-72941493 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1010390856 6:75335513-75335535 AAAAAGGAATGAAGGGAAGGAGG - Intronic
1010922788 6:81704749-81704771 AGGAAGGGAGGGAGGGAAAGAGG + Intronic
1011222226 6:85066896-85066918 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1011695734 6:89911187-89911209 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1011822798 6:91272655-91272677 AAGAAGGAAGGAAGGGAAAGAGG - Intergenic
1011923304 6:92610239-92610261 AAGAAGGAGGGGAAGGAAAGAGG - Intergenic
1011923314 6:92610288-92610310 AAGAAGGAGGGGAAGGAAAGAGG - Intergenic
1011958679 6:93057738-93057760 AAGAAGGAAGGAAGGAAAAGAGG + Intergenic
1011973521 6:93260844-93260866 AAGAAGGAGTATAGGGAAAAGGG + Intronic
1012601075 6:101097661-101097683 CAGAAGGACTGGAGTGATAGTGG + Intergenic
1012734180 6:102918007-102918029 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012734207 6:102918105-102918127 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012902037 6:105017738-105017760 GAGAAGGAGGGGAGGGAGAGGGG + Intronic
1013520466 6:110928184-110928206 AAGAAGGAATGAAGGGAAGGAGG - Intergenic
1013536911 6:111071385-111071407 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1013548937 6:111188270-111188292 AAGAAGGAAGGGAGGGAGAGAGG - Intronic
1013628412 6:111960135-111960157 AAGACGAATGGGAGGGAAAGTGG + Intergenic
1013663136 6:112319073-112319095 AAGAAGACCTGGAGTGACAGTGG - Intergenic
1013751397 6:113410801-113410823 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1014097864 6:117480101-117480123 AATAAGGACTGGATGGCAAGTGG + Intronic
1014212342 6:118720191-118720213 AAGAAGAAAAGGAGGGAAAAAGG - Intergenic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1014730438 6:125025569-125025591 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1014963028 6:127710946-127710968 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1014963057 6:127711044-127711066 AAGAAGAAAGTGAGGGAAAGTGG - Intronic
1015163944 6:130182549-130182571 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1015208409 6:130667838-130667860 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1015383942 6:132600886-132600908 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015384012 6:132601106-132601128 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015818573 6:137236081-137236103 AAGAAGTGGCGGAGGGAAAGAGG - Intergenic
1015820214 6:137252835-137252857 AAGAAGGAATGAAGGGAGAGAGG - Intergenic
1015890496 6:137965346-137965368 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1015893969 6:137998566-137998588 ATGAAGGAAGGGAGGGAAAGAGG + Intergenic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016126909 6:140414933-140414955 GAGAAGGACTGGGGAGAAGGAGG - Intergenic
1016163970 6:140916959-140916981 AAAGTGGACTGGAGGGAAAGAGG + Intergenic
1016244842 6:141969196-141969218 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1016534232 6:145092692-145092714 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1017052825 6:150409157-150409179 AAAAAGGAAAGGAGGGAACGGGG - Intergenic
1017266794 6:152455456-152455478 AGGAGGGCCTGGAGGAAAAGGGG - Exonic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017380254 6:153820426-153820448 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017773977 6:157665460-157665482 GAGAAAGGCTGGTGGGAAAGAGG + Intronic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1017839198 6:158207962-158207984 AAGAATGAATGGAGTGGAAGTGG + Intergenic
1018111536 6:160541031-160541053 AAGAAGGGATGGAGGAAGAGAGG + Intronic
1018455784 6:163951179-163951201 AAGATGGTCTGTAGGGAAGGTGG + Intergenic
1018474626 6:164128510-164128532 AAGAAGGACAGGAAAGACAGAGG - Intergenic
1018577108 6:165270542-165270564 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1018577302 6:165273129-165273151 AAGAAGGCCTGAAGGGTCAGGGG + Intergenic
1018728824 6:166633922-166633944 AGGAAGGACTAGAGGGACACGGG + Intronic
1018904920 6:168070354-168070376 AAGAAGGAAGGAAGGGAGAGAGG + Intronic
1018961232 6:168450490-168450512 GAGAAGGACTGGCTGGGAAGGGG - Intronic
1019162118 6:170075806-170075828 AGGGAGGGCTGGAGGAAAAGGGG + Intergenic
1019273939 7:166180-166202 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1019495469 7:1337718-1337740 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1019730520 7:2627189-2627211 AAGAAGGAAGGGAAGGAGAGAGG + Intergenic
1019730587 7:2627413-2627435 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1019908633 7:4083790-4083812 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1019937715 7:4267257-4267279 AGGAAGGAAGGGAGGGAAGGAGG - Exonic
1020129047 7:5549162-5549184 AAGGAGGAAGGGAGGGAGAGAGG + Intronic
1020173830 7:5866446-5866468 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1020386860 7:7616045-7616067 AAAAAGGATCTGAGGGAAAGTGG - Intergenic
1020394932 7:7703953-7703975 AAGAAGGAAGGAAGGGAAGGAGG + Intronic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021725882 7:23547872-23547894 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1021925034 7:25526048-25526070 AACTGGGGCTGGAGGGAAAGGGG + Intergenic
1021971057 7:25966583-25966605 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1021983515 7:26077560-26077582 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1022143502 7:27514122-27514144 AGGAAGGATTGGAGGAAATGAGG - Intergenic
1022278736 7:28883318-28883340 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1022327017 7:29341599-29341621 GAGAAGGATGGGAGGGAGAGAGG + Intronic
1022341214 7:29469935-29469957 AAGAAGGGAGGGAGGGTAAGAGG + Intronic
1022541803 7:31144455-31144477 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1022633400 7:32107341-32107363 AAGAAGGAAGGGAGAGAAGGAGG + Intronic
1022797300 7:33742385-33742407 AGGCAGGACTGGAGAGTAAGGGG + Intergenic
1022935333 7:35169569-35169591 CAGAAAGGCTGGAAGGAAAGGGG - Intergenic
1023259002 7:38340085-38340107 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1023533333 7:41182240-41182262 AAGAAGGAAGGAAGGGAAGGAGG - Intergenic
1023549327 7:41352435-41352457 AAGAAGGGCTGGTAGCAAAGAGG - Intergenic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1023641341 7:42262252-42262274 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1023737507 7:43248030-43248052 AAGAAGGGAGGGAGGGAGAGAGG + Intronic
1023918015 7:44605088-44605110 GAGAAGGACAGGAGGAGAAGGGG + Intergenic
1024035724 7:45506124-45506146 AAGAGGAACTGGAGAGGAAGAGG - Intergenic
1024070975 7:45785063-45785085 AAGGAGGAAGGGAGGGAGAGAGG - Intergenic
1024330422 7:48149253-48149275 AAGAATGCATGGAGGGAGAGAGG - Intergenic
1024791142 7:52966102-52966124 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1024833363 7:53487637-53487659 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1025135297 7:56406689-56406711 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1025773433 7:64535409-64535431 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025847841 7:65216803-65216825 AAGAAGGAAGGGAGAGAGAGGGG - Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025898090 7:65722674-65722696 AAGAAGGAAGGGAGAGAGAGAGG - Intergenic
1026007419 7:66610999-66611021 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1026277754 7:68895049-68895071 AAGAAGGAGGGTAGGGAAGGAGG - Intergenic
1026340551 7:69430498-69430520 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1026403774 7:70043536-70043558 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1026408555 7:70094509-70094531 AAGAAGGGCTAGAGTGAAAAGGG - Intronic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1026643594 7:72148955-72148977 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1026847678 7:73706887-73706909 AGGAAGGGCAGGAGGGAGAGAGG - Intronic
1026886160 7:73947687-73947709 AAAAAGGAAGGGAGGGGAAGGGG - Intergenic
1026979057 7:74516026-74516048 AAGAAGGTGTGGAGGGGATGAGG - Intronic
1026997348 7:74626516-74626538 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1027265106 7:76490455-76490477 AATAAGAACTGGAAGCAAAGTGG - Intronic
1027316477 7:76988558-76988580 AATAAGAACTGGAAGCAAAGTGG - Intergenic
1027331267 7:77096952-77096974 AATAAAGATAGGAGGGAAAGAGG + Intergenic
1027565647 7:79789967-79789989 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1027610865 7:80358969-80358991 AAGAATGAAAGGAGGGAGAGAGG - Intergenic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1028403198 7:90446752-90446774 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1028519332 7:91712344-91712366 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1028742627 7:94293394-94293416 AAGAAGGAAGGGAGGGAGACAGG - Intergenic
1028845728 7:95477857-95477879 AAAGAGGAGTGGAGAGAAAGGGG - Intergenic
1028849074 7:95515966-95515988 AGGCAGGACTGGAGTGAAACAGG - Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1028947651 7:96599070-96599092 AAGAAGGAAGGGAAGGAAAAAGG + Intronic
1029084933 7:98004032-98004054 AAGAAGGAAGGGAGGGAGGGGGG - Intergenic
1029184460 7:98728709-98728731 AAGAAGAAGGGGAGGGAGAGGGG - Intergenic
1029245585 7:99197876-99197898 AGGAAGGAGAAGAGGGAAAGAGG + Intronic
1029253826 7:99255481-99255503 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1029478485 7:100799348-100799370 AATAAGGAAGGGAGGGACAGAGG - Intergenic
1029634151 7:101772781-101772803 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1029784509 7:102774391-102774413 AATAAAGATAGGAGGGAAAGAGG - Intronic
1029831287 7:103262345-103262367 CAGAAAGGCTGGAAGGAAAGGGG - Intergenic
1030011321 7:105170774-105170796 AGGAAGGACGGGAGGGAGGGAGG + Intronic
1030329594 7:108257041-108257063 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1030796809 7:113798793-113798815 AAGGAGAACAGGAGGGAAGGAGG + Intergenic
1030816822 7:114049127-114049149 AGGAAAGAATGAAGGGAAAGGGG + Intronic
1030925021 7:115441067-115441089 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1031008958 7:116503832-116503854 AAGAAGGAAGGGAAGGGAAGAGG + Intronic
1031769093 7:125820478-125820500 AGGAAGGACGGAAGGGAGAGAGG + Intergenic
1031837876 7:126700989-126701011 AAGAAGGAATGGAAGAGAAGGGG - Intronic
1031970126 7:128058827-128058849 AGGAAGGAGGGGAGGGAAGGAGG - Intronic
1032034039 7:128508515-128508537 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1032188265 7:129746361-129746383 ACCAAGGACTAGATGGAAAGAGG - Intronic
1032579173 7:133088171-133088193 AAGAAGGAAAAGAGGGAGAGAGG + Intergenic
1032763236 7:134964649-134964671 AGTAAGGGCTGGGGGGAAAGAGG + Intronic
1032827626 7:135587718-135587740 AATAATGAAAGGAGGGAAAGAGG - Intronic
1032844074 7:135737619-135737641 AAAAAGGACTGACTGGAAAGTGG + Intronic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033083817 7:138323425-138323447 AAGAAAGAAGGGAGGGAAGGAGG + Intergenic
1033096257 7:138433908-138433930 AAGAAGGGAAGGAGGGAGAGAGG + Intergenic
1033113953 7:138608725-138608747 TAGAAGGCCTGGAAGAAAAGAGG + Intronic
1033258669 7:139823374-139823396 AAGAAGGACTGAAGGAACAGAGG + Intronic
1033914764 7:146309859-146309881 AAGAAGGAAGGAAGGGAAAGAGG + Intronic
1033981312 7:147169645-147169667 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1034263302 7:149770329-149770351 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1034520720 7:151617265-151617287 AAGGAGGGAGGGAGGGAAAGAGG + Intronic
1034825865 7:154261998-154262020 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1034895696 7:154875151-154875173 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1035341478 7:158165313-158165335 GAGAGGTGCTGGAGGGAAAGTGG + Intronic
1035574587 8:696584-696606 AGGAAGGAGTGGAGGGTAAGAGG - Intronic
1035613640 8:986587-986609 AGGAAGGACTGGAGGAGAAAAGG + Intergenic
1035862011 8:3039301-3039323 AAGAAGGAAGGGAGGGAGAGAGG - Intronic
1036065684 8:5379227-5379249 AAGGAGGGCTGAAGGGCAAGAGG + Intergenic
1036384886 8:8270289-8270311 GAGAAGGCCTGCTGGGAAAGGGG + Intergenic
1036834408 8:12048926-12048948 AAGAAGGGCTAGAGGTGAAGAGG - Intergenic
1036856252 8:12295490-12295512 AAGAAGGGCTAGAGGTGAAGAGG - Intergenic
1037071531 8:14656326-14656348 GAGAAGGAAGGGAGGGATAGAGG - Intronic
1037071553 8:14656435-14656457 AAGAAGGAAGGGAGGGATAGAGG - Intronic
1037248740 8:16867660-16867682 TGGAATGAGTGGAGGGAAAGAGG + Intergenic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037274203 8:17159884-17159906 GAGAGGGACAGGAGGGACAGGGG - Intronic
1037344436 8:17883930-17883952 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1037344460 8:17884084-17884106 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1037657483 8:20897747-20897769 GAGAAAAACTGGAGGTAAAGAGG - Intergenic
1037680592 8:21094033-21094055 AAGAAGGAACAGAGAGAAAGAGG + Intergenic
1037781057 8:21869337-21869359 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1037817881 8:22121272-22121294 AAGAGGGCCTCGAGGGGAAGAGG - Intronic
1037949449 8:23009187-23009209 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1038340324 8:26680516-26680538 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1038379680 8:27080788-27080810 AATACGTATTGGAGGGAAAGTGG + Intergenic
1038503932 8:28068086-28068108 AAGAAGGAAAGAAGGGAGAGAGG + Intronic
1038765434 8:30423542-30423564 AAGAAGAAATGGATGGGAAGTGG - Intronic
1038951200 8:32416365-32416387 AAGAAGGAAGGAAGGGAAGGAGG - Intronic
1039142738 8:34411126-34411148 AAAAAGGAAGGGAGGGAGAGAGG + Intergenic
1039187701 8:34935237-34935259 AGGAAGGAAGGGAAGGAAAGAGG + Intergenic
1039273993 8:35914923-35914945 AGCAAGAACTGGTGGGAAAGAGG - Intergenic
1039364592 8:36916480-36916502 GAGAAGAAAAGGAGGGAAAGAGG + Intronic
1039455907 8:37706399-37706421 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1039518196 8:38150427-38150449 AAGAACGAATGAAGGAAAAGGGG + Intronic
1039808840 8:41026794-41026816 AGGAAGGGAAGGAGGGAAAGAGG + Intergenic
1039819639 8:41124503-41124525 AAGGAGGACAGGTGGGAAAAAGG + Intergenic
1039977563 8:42380334-42380356 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1040030000 8:42815260-42815282 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1040063448 8:43124530-43124552 AAGGAGGACTGGAGAGACAATGG + Intergenic
1040277273 8:46020487-46020509 ATGAAGGACCCCAGGGAAAGGGG - Intergenic
1040277847 8:46023066-46023088 AAGAAGGCCAGCAGGGAAAGGGG - Intergenic
1040278495 8:46025897-46025919 AAGAAGTCCTGCAGGGGAAGGGG - Intergenic
1040278551 8:46026114-46026136 AAGAAGGCCCCCAGGGAAAGGGG - Intergenic
1040620058 8:49082000-49082022 AAGAAGGAAGGGAAGGGAAGGGG + Intergenic
1041155773 8:54985360-54985382 GGGAAGGAATGGAGGGAGAGAGG + Intergenic
1041444207 8:57931994-57932016 AAGAAGGAAGGAAGGGAAGGAGG + Intergenic
1041802325 8:61813512-61813534 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1042006784 8:64189470-64189492 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1042397676 8:68310977-68310999 AGGAAGGAAGGAAGGGAAAGAGG - Intronic
1042593960 8:70425517-70425539 TAAAAGGAATGGAGTGAAAGTGG - Intergenic
1042893349 8:73637191-73637213 CAGAAGGAGAGGAGGAAAAGGGG + Intronic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1043250986 8:78072683-78072705 AAGAAGGAAAGGTGGGAAAAGGG - Intergenic
1043417266 8:80063969-80063991 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1043503866 8:80883869-80883891 AAATAGCACTGGAGGCAAAGGGG - Intergenic
1043685108 8:83074700-83074722 AAGCAGTAATGGAGGAAAAGGGG + Intergenic
1043927120 8:86049860-86049882 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1043941862 8:86205161-86205183 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1043963431 8:86444742-86444764 AAGAGAGAATGGAGGGAGAGTGG + Intronic
1044013797 8:87026360-87026382 AAGAAGGGAGGGAGGGAGAGAGG - Intronic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1044562155 8:93623088-93623110 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1045511800 8:102817367-102817389 ATGAAGGAAGGGAGGGAGAGAGG + Intergenic
1045523272 8:102921569-102921591 AAGAAGGGAAGGAGGGAAGGAGG - Intronic
1045628168 8:104082176-104082198 ATAAAGGACGGAAGGGAAAGGGG + Intronic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1045755135 8:105533780-105533802 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1045789379 8:105964116-105964138 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1045831665 8:106469194-106469216 AAGAAGGGAGGGAGGGAAAGAGG - Intronic
1045875709 8:106978501-106978523 AAGATGGACGGGAGTGAAGGAGG + Intergenic
1046117823 8:109805169-109805191 AAAAATCACTGGAGGTAAAGAGG - Intergenic
1046178517 8:110611167-110611189 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1046360849 8:113153173-113153195 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1046547890 8:115674472-115674494 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1046893683 8:119450196-119450218 AAGCAAGACTGAATGGAAAGGGG - Intergenic
1047054911 8:121153143-121153165 AAGAAAGGCTGGAGGGATAGGGG - Intergenic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061820 8:121235684-121235706 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061826 8:121235700-121235722 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061832 8:121235716-121235738 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061845 8:121235748-121235770 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1047106693 8:121739324-121739346 AAGAAAGAATACAGGGAAAGAGG - Intergenic
1047163179 8:122404811-122404833 AAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1047300820 8:123612228-123612250 AAGAAGGGAAGGAAGGAAAGAGG - Intergenic
1047591041 8:126328016-126328038 AAGAAGGAATAAAGGAAAAGAGG + Intergenic
1047655153 8:126969364-126969386 AAGAAGGGAGGGAGGGAGAGAGG - Intergenic
1047696201 8:127406203-127406225 AAGAAGGAAGGGAAGGGAAGGGG + Intergenic
1047857721 8:128930538-128930560 AGGAAGGAAAGGAGAGAAAGAGG - Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1047923681 8:129661139-129661161 AAGTAGGACTCTATGGAAAGTGG + Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1047927648 8:129697024-129697046 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1048044035 8:130756571-130756593 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1048074248 8:131051991-131052013 AAGAAGAGGTGGAGGAAAAGAGG + Intergenic
1048209109 8:132440331-132440353 ATGAAGGACAGCAGGGAAAACGG - Intronic
1048315091 8:133355916-133355938 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
1048503915 8:135003752-135003774 AAGAAAGACTGGAGGTAAAAGGG + Intergenic
1048513198 8:135080784-135080806 AATAAGGATGGGAGAGAAAGAGG - Intergenic
1048513271 8:135081159-135081181 ATGAGGGAAAGGAGGGAAAGGGG + Intergenic
1048517481 8:135124036-135124058 AAGAAAGACTAGAGAGAGAGGGG + Intergenic
1048522157 8:135166431-135166453 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049349031 8:142154265-142154287 ATAAAGGAAGGGAGGGAAAGAGG - Intergenic
1049361164 8:142213115-142213137 AGGAAGGATTGGAGAGAAGGTGG - Intronic
1049388666 8:142357135-142357157 AAGAAGGACAGGAGGGCCAGGGG + Intronic
1049396146 8:142402038-142402060 AAGAAATACTGTAGGGAGAGCGG + Intronic
1049439554 8:142602871-142602893 AGGCAGGGCTGGGGGGAAAGGGG + Intergenic
1049469797 8:142770203-142770225 AGGAAGGTCTGGTGGGAAGGAGG + Intronic
1049526023 8:143127433-143127455 AAGAAGCACTGGAGAAAGAGGGG + Intergenic
1050356575 9:4789113-4789135 AGGAAGGACGGGAGGGAGGGAGG + Intergenic
1050598052 9:7223795-7223817 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1050643168 9:7690996-7691018 ATGAAGGACTGTAGGTACAGTGG - Intergenic
1050664953 9:7925459-7925481 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1050665419 9:7930441-7930463 AAGAAGAACTGAAGGCAATGAGG + Intergenic
1051245788 9:15109451-15109473 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1051411978 9:16799239-16799261 AAAAATGACTGGAAGGAAATAGG - Intronic
1051473418 9:17475533-17475555 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1051512417 9:17893145-17893167 AAGAAGTTCAGGTGGGAAAGTGG + Intergenic
1051524158 9:18024019-18024041 AAGAAGAAAGGGAGGGAAGGGGG - Intergenic
1051543462 9:18247764-18247786 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1051803968 9:20970294-20970316 CAGAAGGATAGGAGAGAAAGGGG - Intronic
1051858760 9:21600240-21600262 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1051873171 9:21762697-21762719 AGGGAGGACTGGAGGGAATCAGG + Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052386260 9:27827139-27827161 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1052433965 9:28402552-28402574 AAGAAGGAAGGGAGGAGAAGTGG - Intronic
1052433973 9:28402582-28402604 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1053141129 9:35683281-35683303 GAAAGGGAGTGGAGGGAAAGAGG + Intronic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1053346802 9:37384211-37384233 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1054736617 9:68758577-68758599 AAAAAGGATTGCAGGGAGAGGGG + Intronic
1054778227 9:69141522-69141544 AAGAAGGACAGATGGGAGAGAGG + Intronic
1054784694 9:69199719-69199741 AAGAAGGAAAGGAGGGAGAAAGG - Intronic
1055591325 9:77817411-77817433 AAGAAGGAAGGAAGGGAAGGAGG + Intronic
1055595054 9:77857535-77857557 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1055702288 9:78958398-78958420 AAGGAGGTGTGGAAGGAAAGAGG - Intergenic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1055824533 9:80307235-80307257 AAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1056368225 9:85928014-85928036 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1056497721 9:87176566-87176588 AAGAAGGAAAGGAGAAAAAGAGG + Intergenic
1056592667 9:87975950-87975972 AAGAGGGACTGGGAGGACAGGGG + Intergenic
1056597670 9:88021026-88021048 AAGAAGGAAGGAAGGAAAAGAGG - Intergenic
1056614550 9:88152721-88152743 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1056697632 9:88873382-88873404 AAGAAGAAAGGGAGGGAGAGAGG + Intergenic
1056817901 9:89815045-89815067 AACAAGGAAAGCAGGGAAAGCGG - Intergenic
1056965166 9:91159365-91159387 AAGAAAGAGAGGAGGGAAGGAGG + Intergenic
1057006316 9:91563739-91563761 AGGAAGGAAGGAAGGGAAAGAGG + Intronic
1057174284 9:92984743-92984765 ACCAGGGACTGGTGGGAAAGTGG + Intronic
1057292897 9:93818534-93818556 AGGAAGGAATGAAGGGAAAGAGG + Intergenic
1057416802 9:94870997-94871019 AAAAAGGAGTGGAAAGAAAGAGG - Intronic
1057875666 9:98752432-98752454 AGGAAGGAAGGAAGGGAAAGAGG - Intronic
1057899754 9:98939276-98939298 AAGAAGCACTGGAAGGGGAGTGG + Intergenic
1058369261 9:104246034-104246056 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058666496 9:107322105-107322127 AACAAGTTCTGGAGGTAAAGCGG + Exonic
1058713565 9:107702440-107702462 AAAAAGGAAAGGAAGGAAAGAGG + Intergenic
1058930495 9:109714485-109714507 AAGAAGGAATGGGGTGAAATTGG - Intronic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059309908 9:113381199-113381221 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1059670479 9:116486408-116486430 ACGAATGGATGGAGGGAAAGAGG + Intronic
1059735263 9:117094097-117094119 AAGAAAGAAAGGAGGGAGAGAGG + Intronic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1059803467 9:117773787-117773809 AAGAAGGAAGGAAGGGAAGGAGG - Intergenic
1059929842 9:119249882-119249904 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1059965443 9:119609367-119609389 AAGAAGGAAGAGAGGGAAAGAGG + Intergenic
1060068551 9:120526511-120526533 AAGTAGGAATGGAGGGGGAGGGG - Intronic
1060129880 9:121085985-121086007 AAGGAGAACTGGAAGGAAGGTGG + Intronic
1060446144 9:123690043-123690065 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060446156 9:123690075-123690097 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060446177 9:123690131-123690153 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG + Intergenic
1060476763 9:123992914-123992936 CAGAGGGACTGGAGGGAGTGAGG - Intergenic
1060729908 9:126030748-126030770 AGGAAGGAGTGGGGAGAAAGGGG - Intergenic
1060851071 9:126876218-126876240 AAGAAGGAAGGAAGGGGAAGGGG - Intronic
1060931499 9:127492136-127492158 AAGAAGGCCTGGAGGGGCAGAGG - Intronic
1061057716 9:128233173-128233195 CATAAGAACTGGGGGGAAAGAGG + Intronic
1061142306 9:128774954-128774976 AAGAAGGGAAGGAAGGAAAGAGG + Intergenic
1061211957 9:129198829-129198851 AGGATGAAGTGGAGGGAAAGGGG + Intergenic
1061278816 9:129585370-129585392 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1061432541 9:130540394-130540416 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1061471770 9:130832542-130832564 AAAACTGACTGGAGGGAGAGGGG - Intronic
1061653171 9:132067548-132067570 AAGAAGAAGAGCAGGGAAAGTGG + Intronic
1061862958 9:133477234-133477256 AACACGGACTGCAGGGGAAGGGG + Exonic
1061977641 9:134078585-134078607 AAGAAGCAGTGGAGGAACAGGGG + Intergenic
1062051811 9:134451320-134451342 AGGAAGGGATGGAGGGAGAGAGG - Intergenic
1062227201 9:135459416-135459438 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1062372621 9:136247836-136247858 AACAAGGAGTGGAGGAAAGGAGG + Intergenic
1062751223 9:138255165-138255187 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1203365132 Un_KI270442v1:249508-249530 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1203562882 Un_KI270744v1:73100-73122 AGGGAGGATTGGAGGGACAGAGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1185562497 X:1070490-1070512 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1185584241 X:1233309-1233331 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1185598704 X:1324515-1324537 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1185623420 X:1466895-1466917 AGGAAGGACGGGAGGGAGGGAGG - Intronic
1185726749 X:2427705-2427727 AAGAAAGACTGAGGGAAAAGTGG + Intronic
1185739286 X:2517938-2517960 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1185765681 X:2724024-2724046 AGGAAGGAAGGGAGGAAAAGTGG + Intronic
1185861554 X:3584112-3584134 GAGAAGGACAGGAGTGAGAGAGG + Intergenic
1185882674 X:3755396-3755418 AAGAAGGAAGGGAGGGAAGGGGG - Intergenic
1186019140 X:5234859-5234881 AGGAAGGAAAGGAGGGAGAGAGG - Intergenic
1186069989 X:5808915-5808937 AGGAAGGAATGAAGGGAGAGAGG - Intergenic
1186246621 X:7622495-7622517 AAGAAGGAAAGGAGGAAGAGGGG - Intergenic
1186559675 X:10598132-10598154 AAGAAGCACTGGAAGGCAGGTGG - Intronic
1186756579 X:12678037-12678059 AAAAAAGACTGGAAGGAAATAGG - Intronic
1186838433 X:13460911-13460933 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1186838440 X:13460940-13460962 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1187865855 X:23722746-23722768 AATAAGAACTGCAGGGAAACAGG + Exonic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188901747 X:35741268-35741290 AAGAAGGAAAGGAGAGATAGAGG + Intergenic
1189159248 X:38793819-38793841 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1189222249 X:39382491-39382513 AAGATGGCCTGGAGGGAAGGGGG - Intergenic
1189256360 X:39642669-39642691 GAAAAGGAATGGAAGGAAAGGGG + Intergenic
1189364903 X:40380742-40380764 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1189534417 X:41922803-41922825 GAGAAGGACGAGAGGGGAAGAGG + Intronic
1190296753 X:49032034-49032056 AATAAAGACTGGAAGGAAAATGG - Intronic
1190439475 X:50463196-50463218 GAGAAGGAGGGGTGGGAAAGAGG - Intronic
1190739540 X:53280176-53280198 AGGGAGGACGGGAGGGGAAGGGG + Intronic
1190953142 X:55165535-55165557 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1191671906 X:63755587-63755609 AAGAAGGAATGGGGGAAAAACGG + Intronic
1192109517 X:68350443-68350465 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1192117172 X:68422533-68422555 AAGAAGGAAGGAAGGGAAGGAGG + Intronic
1192190063 X:68985574-68985596 GAGAAGGACAGGGGGGAAGGGGG + Intergenic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192430341 X:71107469-71107491 AAAGAGGAAGGGAGGGAAAGAGG + Exonic
1192459492 X:71304765-71304787 AAGGAAGAGGGGAGGGAAAGAGG - Intronic
1192688938 X:73339358-73339380 AAGATGGAGTGGAGGAAGAGAGG + Intergenic
1193494201 X:82190120-82190142 CACAAGGTGTGGAGGGAAAGTGG + Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1193873853 X:86835917-86835939 AAGAAGGATTTGTGGGATAGAGG + Intergenic
1194305827 X:92246872-92246894 AAGGAGGAATGGAGAGAAAGAGG + Intronic
1194831268 X:98625232-98625254 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1195269671 X:103216774-103216796 AATAAGGACTGGAATGAAAAAGG - Exonic
1195350168 X:103988008-103988030 AGGAAGGAGTTGAGGGAAATGGG - Intergenic
1195351751 X:104003082-104003104 AGGAAGGAGTTGAGGGAAATGGG + Intergenic
1195357274 X:104050831-104050853 AGGAAGGAGTTGAGGGAAATGGG + Intergenic
1195505629 X:105653514-105653536 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
1195892717 X:109712989-109713011 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1195892729 X:109713041-109713063 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1195966611 X:110435017-110435039 CAGAAGGAAGGGAGGGACAGAGG + Intronic
1195970019 X:110462884-110462906 AAGAGGGAAGAGAGGGAAAGTGG + Intergenic
1196234190 X:113260753-113260775 AACCAGCACTGGAGTGAAAGAGG - Intergenic
1196398273 X:115288934-115288956 AAGAAGGAAGGGAGGGACAGAGG + Intergenic
1196423609 X:115547238-115547260 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1196650063 X:118159329-118159351 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1196651667 X:118174140-118174162 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1196986980 X:121284607-121284629 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1197316031 X:124966935-124966957 AAGAGGGGCTGGAGAGAACGTGG + Intergenic
1197597401 X:128482112-128482134 AAAAAGGACTTGAGGGAATCTGG - Intergenic
1198000078 X:132424758-132424780 AAGGAGGAAAGGAGGGAGAGAGG - Intronic
1198257455 X:134936855-134936877 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1198405305 X:136306197-136306219 AAGAAGGAAGGAAAGGAAAGAGG - Intronic
1198957152 X:142145912-142145934 AAGAAGGAAGGGAGGGACGGAGG + Intergenic
1199063869 X:143390753-143390775 AAGAAAGAACGGAGGGAGAGAGG + Intergenic
1199510337 X:148614581-148614603 GAGAAGGGAGGGAGGGAAAGAGG - Intronic
1199595780 X:149504907-149504929 AAGAAGGAATGGTAGGAGAGAGG + Intronic
1199598897 X:149528857-149528879 AAGAAGGAATGAAGGAAAAGAGG + Intronic
1199672920 X:150161745-150161767 AAGAAGCAATGGAGGGAGAGGGG - Intergenic
1199849398 X:151714730-151714752 AGGAAGGAAGGGAGAGAAAGTGG - Intergenic
1199922675 X:152425792-152425814 AAGAAGTACATCAGGGAAAGGGG - Intronic
1200374715 X:155767580-155767602 AAGAAGGGGAGGAGGGAAAGGGG + Intergenic
1200782322 Y:7227918-7227940 AAGAAGGAAGGGAGGGAAGGGGG + Intergenic
1200880383 Y:8206400-8206422 AATATGGACTGGACTGAAAGAGG - Intergenic
1200908558 Y:8511020-8511042 AAGAAGGGAAGGAGGGAAAGCGG - Intergenic
1201146435 Y:11067547-11067569 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1201160543 Y:11161375-11161397 AGGGAGGATTGGAGGGACAGAGG + Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201256514 Y:12112927-12112949 AAGAAGGAAGGGAGGGAGGGTGG - Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1201365756 Y:13204744-13204766 GAGGAGAACTGGAAGGAAAGGGG - Intergenic
1201550406 Y:15211864-15211886 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1201558696 Y:15292080-15292102 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1201559234 Y:15298609-15298631 AAGAAGGGTTGGAGGTAAACTGG + Intergenic
1202386942 Y:24335447-24335469 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1202483844 Y:25334681-25334703 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic