ID: 1120003471

View in Genome Browser
Species Human (GRCh38)
Location 14:79330198-79330220
Sequence GTTAATAGACAGATGAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120003467_1120003471 7 Left 1120003467 14:79330168-79330190 CCTATCACAGAGATAGGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG 0: 1
1: 0
2: 0
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120003471 Original CRISPR GTTAATAGACAGATGAACAA GGG Intronic
900279525 1:1857352-1857374 GTTAATAGAGAGATTCACAGAGG - Intronic
904204483 1:28844589-28844611 GTTAATTAAAAAATGAACAAGGG - Intronic
904367779 1:30026959-30026981 GTTAATAAGCACATGAAAAAAGG + Intergenic
906234446 1:44196332-44196354 GTTAATGGATAAATTAACAATGG - Intergenic
906839922 1:49126110-49126132 GTTAATTGTTAGAGGAACAAAGG - Intronic
907841407 1:58161160-58161182 GTTATTAAATAAATGAACAAAGG - Intronic
908784661 1:67723031-67723053 TTTGATAGATAGATGAACACTGG - Intronic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
909288351 1:73849990-73850012 GTTAATACAGAGAAGAACAATGG + Intergenic
909476296 1:76084669-76084691 GCTAATAGACATATGGCCAATGG + Intronic
909516702 1:76516784-76516806 GCTAATAGAAATCTGAACAAAGG - Intronic
909876984 1:80818723-80818745 TTTAATAAAGAGATAAACAACGG + Intergenic
910054113 1:83010958-83010980 GTTAATAGAAAGGTGCACTAGGG - Intergenic
911518284 1:98895822-98895844 GTTAGCAGACAGATAAACAGAGG + Intronic
911898040 1:103464706-103464728 GTTATTAGACATAGGAAGAAAGG - Intergenic
915452044 1:156012501-156012523 GTTAATAGACATAAAATCAAAGG - Intronic
916188274 1:162154192-162154214 GTTAAGAGCAAGATGAAAAAAGG + Intronic
916478254 1:165190860-165190882 GTAAATAGACAGCTGATCCAGGG + Intergenic
917008536 1:170444449-170444471 GTAAAGAGACAAATAAACAATGG + Intergenic
917729990 1:177865547-177865569 GGTAATGGACAGCTGAACAAGGG + Intergenic
919141499 1:193578202-193578224 GAAAGTAGACAGATGAAAAAGGG - Intergenic
921365787 1:214372477-214372499 GTTAAAAGCCAGATGAAAATGGG + Intronic
922274256 1:224062270-224062292 GTTTATAGACAGGAGAAAAAGGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1068064906 10:52117712-52117734 ATTAAAAGACAGAGGAAGAAGGG - Intronic
1071421918 10:85509034-85509056 GTGAATAGACAAATGAGCATGGG + Intergenic
1073712446 10:106059408-106059430 GTTCATGGACAGAAAAACAATGG + Intergenic
1076825118 10:132963339-132963361 GTTGATAGACAGATGGATGAAGG - Intergenic
1077945862 11:6897635-6897657 GTTATGAGCCAGATGAAGAAGGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078718880 11:13865202-13865224 GTCAATAGACAGAAGATCTATGG + Intergenic
1079766768 11:24403906-24403928 GTTAACAGACAAATGAATAAAGG + Intergenic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1082188322 11:49210883-49210905 GTTAAAAGAAAAATGAAAAATGG + Intergenic
1085596245 11:77813077-77813099 GTTAATAAACAGAAGAAGCAGGG - Intronic
1085821696 11:79800801-79800823 GCTAAAAGATAGATGAACAGAGG - Intergenic
1086678199 11:89635760-89635782 GTTAAAAGAAAAATGAAAAATGG - Intergenic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1089032065 11:115341761-115341783 GTTCAAAAACAGATGAAAAAAGG - Intronic
1089901717 11:121993499-121993521 ATTCAGAGACAGAAGAACAATGG + Intergenic
1089985241 11:122806386-122806408 TGTAATAGAAAAATGAACAAAGG - Intronic
1091095053 11:132812605-132812627 TTTAATAGACAGATAAAAGAAGG - Intronic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1093444174 12:19235735-19235757 GTGAATAGGCATATGAAGAAAGG + Intronic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1097562102 12:61220321-61220343 CTTACTACACAGAGGAACAAAGG + Intergenic
1098258086 12:68638042-68638064 GATAAAACACAGTTGAACAATGG - Intronic
1098345946 12:69503584-69503606 GGTGATAGACAGATGTACAAAGG - Intronic
1101191001 12:102332459-102332481 GATAAGAGACAGTTGAAGAAGGG + Intergenic
1101705014 12:107213479-107213501 GCCAACAGACAGATGAAAAAAGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107468704 13:40671356-40671378 GTTAGTAGACAGATAACCAGAGG - Intergenic
1107607532 13:42075482-42075504 TTTTATATACAGATTAACAATGG - Intronic
1109268259 13:60225341-60225363 ATCAGTAGACAGATGAGCAAAGG - Intergenic
1109980134 13:69896622-69896644 ATAAATAGAAAGATGAAAAAGGG + Intronic
1111777012 13:92676974-92676996 GTTAATAGAGTGATAATCAAAGG - Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116236724 14:42287950-42287972 GTTAAAGAACAGATGAATAAGGG - Intergenic
1116837399 14:49783603-49783625 GTTAAGAGACAGAGGAAAAGTGG + Exonic
1118206208 14:63726348-63726370 GTTCAAAGACAGATAAACATTGG + Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120122004 14:80692323-80692345 GCTAATATAGAGATGACCAATGG - Intronic
1121181108 14:91929742-91929764 AAAAATAGACAGATGAACTAGGG + Intronic
1123693197 15:22856720-22856742 GTTAATAAACAAATGAAAATGGG + Intronic
1123970254 15:25501721-25501743 GTTATTAGAAAGATGAAAGAGGG - Intergenic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG + Intronic
1125785973 15:42318474-42318496 GATTATATACAGAGGAACAAAGG - Intronic
1125959696 15:43819237-43819259 ATAGATAGATAGATGAACAATGG + Intronic
1126305538 15:47251819-47251841 ATTAATAAACACATGAACAGAGG - Intronic
1137507746 16:49069221-49069243 GTGAATAGAGATATAAACAAAGG - Intergenic
1138174570 16:54884918-54884940 GACAAAAGACAGATTAACAAGGG - Intergenic
1138944590 16:61832942-61832964 TCTTATAGACAGATGAAAAAAGG - Intronic
1140999351 16:80293921-80293943 GTAGATAGACAGATGGACATGGG + Intergenic
1143426391 17:6842497-6842519 GATAAAACACAGATTAACAAAGG + Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144467713 17:15509544-15509566 GTTAATAGGCAGAGGAAGGATGG - Intronic
1152872469 17:82764019-82764041 TTTAAAAGCCAGATGTACAAGGG - Exonic
1153032707 18:729958-729980 GTTACTAGATATATGAAGAAGGG - Intronic
1154179302 18:12117743-12117765 GTTATTTGCCAGATTAACAACGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155948326 18:31881284-31881306 AAAAATAGACACATGAACAATGG + Intronic
1156345687 18:36255335-36255357 GTCAAGAGACAGATGATGAAAGG - Intronic
1156748001 18:40415956-40415978 TTCAATAGACAGGAGAACAAAGG - Intergenic
1157517166 18:48318980-48319002 TTTAATAGAGAGATGGACAGAGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158400054 18:57113842-57113864 ATTGATAGACAAATGAATAATGG - Intergenic
1159262194 18:66028633-66028655 GGGAATTGACAGATGGACAAAGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161866773 19:6838579-6838601 GGTAATAGACAGATGATAGATGG - Intronic
1162010122 19:7808110-7808132 GATCATAGACAGATAAAGAAAGG - Intergenic
1164585821 19:29475255-29475277 GTTAAAAGATAGATGGATAATGG + Intergenic
1164670306 19:30068594-30068616 ATTAATAGATAGGTGAATAAAGG - Intergenic
1164957235 19:32397081-32397103 GTTAATATAAAGTTGAACAAAGG + Intergenic
925738164 2:6982118-6982140 GTTCATGGACAGATGAACTGGGG + Intronic
926429023 2:12767163-12767185 GTTATTACACAGAGGGACAAGGG - Intergenic
927686815 2:25177031-25177053 GCTAATAGACAGATTAATAGGGG - Intergenic
929037193 2:37705598-37705620 CTTAATAGACAGATAAATGAAGG - Intronic
929786298 2:44995126-44995148 GTTATGGGATAGATGAACAAGGG + Intergenic
931424320 2:62157195-62157217 ATTCAAAAACAGATGAACAATGG + Intergenic
933260738 2:80128521-80128543 GTTAAAAGACGGATAAATAATGG + Intronic
933847787 2:86339266-86339288 GTTAATAGACTGCTGGAGAAGGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936023113 2:109010370-109010392 GTTACTAGACAGCTGAACTGGGG - Intergenic
936469150 2:112782719-112782741 ATTCAGAGACAGATGATCAATGG + Exonic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943194682 2:184730750-184730772 GTGAATAGACAAATAAACCATGG - Intronic
943568437 2:189543872-189543894 GTTAAAGGACAGAGGAAGAATGG - Intergenic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
945558908 2:211313910-211313932 GTGAATAGCCATGTGAACAAAGG - Intergenic
945899359 2:215520525-215520547 GTTGATAGAAAGATGAACTCAGG + Intergenic
947781436 2:232768549-232768571 GTTAGTGGAAAGATGAAGAATGG + Exonic
947953512 2:234168311-234168333 GCAAATAAACACATGAACAAAGG + Intergenic
1170172255 20:13428397-13428419 GTTAATAAATGGATAAACAAAGG - Intronic
1170298778 20:14858811-14858833 TTTTACAGACAGATGAACTAAGG - Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1171274476 20:23844304-23844326 ATAAATAGACAGATGAGAAAAGG - Intergenic
1172203714 20:33146995-33147017 GTAAACAGAGATATGAACAAAGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177712300 21:24794142-24794164 GTAAATGGACAGATAAACTAGGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180218259 21:46340450-46340472 GATTATATACAGATGAACAGAGG - Intronic
1184035608 22:41916486-41916508 GAAAAAACACAGATGAACAAAGG + Intergenic
1185137485 22:49081030-49081052 GTTCATGGACAGATGCACTATGG + Intergenic
951112255 3:18818340-18818362 GTTACTAAACAAATAAACAAAGG - Intergenic
951338759 3:21458170-21458192 GTTAAGAAACAGATGAAGAGGGG + Intronic
954492362 3:50918521-50918543 GTCAACAGACACATGAAAAAAGG - Intronic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
957157424 3:76562968-76562990 GTAAACAGATAGATGAAGAAGGG - Intronic
960880025 3:122334766-122334788 GTTGGAAAACAGATGAACAATGG + Intronic
961024545 3:123542209-123542231 GCTAATAGGCAAATGAGCAAAGG + Intronic
964188839 3:153979299-153979321 GTTAAGAAACAAATGAAAAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
966347842 3:178998747-178998769 GATAATGGACAGATTAACAGGGG - Intergenic
967011026 3:185434248-185434270 GCTAATAGATAAATGAACAAAGG + Intronic
967831303 3:193922341-193922363 GTAAATAGACAAATAAAAAAGGG - Intergenic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
971135923 4:23868464-23868486 GTTAATGGACAGATTTACAGGGG - Intronic
971202814 4:24528122-24528144 ATTAATATACTGATGAACCAAGG + Intronic
972731052 4:41795780-41795802 GCTCAGAGACTGATGAACAAAGG + Intergenic
973291919 4:48479739-48479761 GTTAACAGAAAGAGGAAAAATGG - Intergenic
974516140 4:62914327-62914349 ATTAATAGACAGCCTAACAATGG + Intergenic
974590302 4:63940007-63940029 ATAAACAGAGAGATGAACAAAGG - Intergenic
976464218 4:85349321-85349343 GTAAAAAGACATATGAACCATGG + Intergenic
977158274 4:93601699-93601721 GTTTAAAGACAGAGGAACAAAGG - Intronic
977231855 4:94460986-94461008 GTGAATACACAGTTGAACAGTGG + Intronic
980518640 4:133900936-133900958 GTTGATAGAGACATGAAGAATGG - Intergenic
981137782 4:141232056-141232078 CTTAATAGCCATATGAAGAATGG - Intronic
983409403 4:167377818-167377840 CTTAATAGACTGAGAAACAATGG - Intergenic
984235471 4:177152381-177152403 GTAAAGAAAAAGATGAACAAAGG - Intergenic
986054719 5:4125061-4125083 AATAATAAAAAGATGAACAAAGG + Intergenic
987944145 5:24582698-24582720 GTCAATAGAAAGATTGACAAAGG + Intronic
988345456 5:30031937-30031959 GTTAATAAACAGATGAGGAGAGG - Intergenic
988916280 5:35896871-35896893 GCTAATAGACAGTTGAAAAGTGG - Intergenic
989030893 5:37117258-37117280 GGTAATAGGAAGATGAGCAAGGG + Intronic
989741380 5:44776996-44777018 GTTATTAGAAAAATGCACAATGG - Intergenic
989992559 5:50784988-50785010 GTTAATAAACAGAGAAACAGGGG - Intronic
990844979 5:60127288-60127310 GTTAATAGTCTTAAGAACAATGG + Intronic
992397280 5:76379595-76379617 TTTAATAGACAGCTAAAAAAAGG - Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
995059775 5:107801359-107801381 GTTAAGAGACAGCTCATCAACGG + Intergenic
998482560 5:142474915-142474937 GTAAATAGACAGATGACACAAGG - Intergenic
999187606 5:149724307-149724329 TTTAATAGATGGATAAACAAAGG - Intergenic
999204942 5:149841075-149841097 GATAATAGACTCATAAACAAAGG + Intronic
999684058 5:154086688-154086710 GGCAATGGACTGATGAACAATGG + Intronic
1000114209 5:158138075-158138097 GTTCCCAGACAGATGAACAGTGG + Intergenic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1001280354 5:170382131-170382153 GTTACTAGACAGAGGAGCCAAGG - Intronic
1002585797 5:180246614-180246636 GTTAAAACACAAATGAAAAAGGG + Intronic
1003120097 6:3312434-3312456 GTAAGTAGGCAGAGGAACAAGGG + Intronic
1005601130 6:27427227-27427249 GTTCTTAGACAGATGGAGAACGG + Intergenic
1005704735 6:28440185-28440207 GGTAATAGCTAGTTGAACAATGG + Intronic
1007256865 6:40535649-40535671 GTTAACAGACAGATCAACCTGGG - Intronic
1008158705 6:48050091-48050113 GTTAATAGAAAAAGGAATAATGG + Intronic
1008819478 6:55613174-55613196 GCCAATAGACATATGAAAAAAGG + Intergenic
1010450616 6:75998173-75998195 TTTACTAGACAGATTAAAAAGGG + Intronic
1010587905 6:77676973-77676995 GTTATTAGAATGATGAACATAGG + Intergenic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012377958 6:98585424-98585446 GCAAATGGACAGATGACCAAAGG + Intergenic
1013138989 6:107312050-107312072 GGTAAGAGTCAGATGAAGAAAGG + Intronic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1015221870 6:130813437-130813459 GTTTATAGAAAAATGAACATTGG - Intergenic
1015657434 6:135535240-135535262 GTTAATAGGATGAAGAACAAGGG - Intergenic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016242627 6:141949122-141949144 ATTAAAAGACAGATGATAAAAGG + Intergenic
1016692078 6:146949657-146949679 GTTATTAGACATAAGAACAAAGG - Intergenic
1016753356 6:147656434-147656456 GTTAAAAGACAAATGACCACTGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1020452152 7:8332374-8332396 CATAATAGACAGATCAACACAGG - Intergenic
1020825641 7:13024755-13024777 CTTTATAGAGATATGAACAATGG - Intergenic
1021762533 7:23915201-23915223 GTTTATAGACAGAAAAACAGAGG - Intergenic
1024391239 7:48814916-48814938 GTTAATTTACAGATTAAAAAGGG - Intergenic
1026425857 7:70292843-70292865 GTTAATAGAAAGCTGCACAAGGG - Intronic
1030419935 7:109296210-109296232 ATGAATAGACAGTTGACCAAGGG + Intergenic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1030806091 7:113921415-113921437 GTAAAGAGACACATTAACAAGGG - Intronic
1032061079 7:128725943-128725965 GGTAATAGACAGCTAAAGAAAGG + Intronic
1032667629 7:134052545-134052567 GATAATATATACATGAACAATGG + Intronic
1034365037 7:150539094-150539116 GTTACTAGAGAGATGAAAAAAGG + Intergenic
1037424381 8:18739540-18739562 GCTATTAGACACATGAAAAATGG - Intronic
1039129086 8:34241278-34241300 GTTAATAGAAAAATAAGCAAAGG + Intergenic
1040555229 8:48472147-48472169 GCTAAAAGTCAGATGAACTAGGG + Intergenic
1041814756 8:61957453-61957475 GTGAATAGACAGATCTACAGAGG + Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042656885 8:71108929-71108951 TTTCATGGAAAGATGAACAAAGG + Intergenic
1043298606 8:78698611-78698633 GTTAAAAGACAAATGAACTTAGG - Intronic
1043953972 8:86340900-86340922 GTTAATAAGGACATGAACAATGG + Intergenic
1044890440 8:96829368-96829390 GTTGAGAGAAAGAGGAACAAGGG - Intronic
1046173789 8:110547816-110547838 TTTAACAGGCATATGAACAATGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049913177 9:290103-290125 GTTAATGGATAAATAAACAATGG - Intronic
1050392812 9:5164462-5164484 GTTAATACAAAAATGTACAAAGG - Intronic
1050458181 9:5853924-5853946 GACAAAAGACAGATGAACAGAGG + Intergenic
1050713002 9:8487427-8487449 GTTAACAGAAAGAAGAAGAAAGG + Intronic
1050777847 9:9289604-9289626 GTAAATAGGGAGATGTACAAAGG - Intronic
1053399395 9:37804473-37804495 CTTAAAAGACAGAGGAAAAAGGG + Intronic
1053594424 9:39545498-39545520 GACAATAGACAGATTAACAAGGG + Intergenic
1053852205 9:42300531-42300553 GACAATAGACAGATTAACAAGGG + Intergenic
1054571833 9:66819469-66819491 GACAATAGACAGATTAACAAGGG - Intergenic
1054846127 9:69800284-69800306 GCTGATAAACACATGAACAAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1185869085 X:3649023-3649045 GTTTAAAGACAGATGTATAAAGG + Intronic
1185999658 X:4994383-4994405 TTTAATAGACAGAATATCAACGG - Intergenic
1186438380 X:9563743-9563765 TTTATTGGACAGAAGAACAATGG + Intronic
1188279195 X:28242361-28242383 GTTCAGAGACAGATGTAGAAGGG - Intergenic
1188593968 X:31874050-31874072 GTAAATCAACATATGAACAATGG + Intronic
1188908694 X:35819786-35819808 GTTATGAGACAAAGGAACAAAGG - Intergenic
1189934239 X:46050255-46050277 GATAATTGACAAAAGAACAAAGG + Intergenic
1192339879 X:70255174-70255196 ATCAATAGTCAGATGAACAAAGG + Intergenic
1194678536 X:96822888-96822910 CCTAATAGAAATATGAACAAAGG + Intronic
1194729554 X:97437937-97437959 GTAAATAGAGAAATCAACAAAGG + Intronic
1194845488 X:98802201-98802223 GTCACTAGACAGAGAAACAATGG + Intergenic
1194933705 X:99920978-99921000 GTTAAAAGACAAATGCAGAAAGG + Intergenic
1196245666 X:113396368-113396390 GGTAACAGACAGAGGAGCAACGG - Intergenic
1196422502 X:115537442-115537464 GGAAATAGACATATCAACAATGG + Intergenic
1198668218 X:139047879-139047901 CCTAATAGATAAATGAACAAAGG - Intronic
1198718664 X:139591498-139591520 GATAATAAACACATGAACTAAGG + Intronic