ID: 1120007453

View in Genome Browser
Species Human (GRCh38)
Location 14:79375437-79375459
Sequence GACACTCCTGAGACTTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120007453_1120007457 30 Left 1120007453 14:79375437-79375459 CCTGCTGAAGTCTCAGGAGTGTC 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1120007457 14:79375490-79375512 AAAAGCAGAGTGCCTTTTGGAGG 0: 1
1: 1
2: 3
3: 19
4: 269
1120007453_1120007456 27 Left 1120007453 14:79375437-79375459 CCTGCTGAAGTCTCAGGAGTGTC 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1120007456 14:79375487-79375509 TTAAAAAGCAGAGTGCCTTTTGG 0: 1
1: 0
2: 0
3: 32
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120007453 Original CRISPR GACACTCCTGAGACTTCAGC AGG (reversed) Intronic
900565560 1:3330235-3330257 AACACTTCTGAGAGCTCAGCAGG + Intronic
902570080 1:17341733-17341755 CACCCTTCTGGGACTTCAGCCGG + Intronic
902580832 1:17406421-17406443 CCCACTCCCCAGACTTCAGCAGG - Intergenic
903930549 1:26859494-26859516 GATATTCCTGTGACCTCAGCAGG - Intergenic
906129591 1:43448182-43448204 GAGGCTCCTGGGAGTTCAGCTGG + Exonic
911275462 1:95853382-95853404 GACACCCCTGAGGCTGCAGGGGG - Intergenic
912333018 1:108836353-108836375 GACTCTCCTGGGCTTTCAGCTGG + Intronic
913510328 1:119555311-119555333 GACACTCCTGAGACTGGGGTAGG + Intergenic
914785465 1:150825389-150825411 GACACTACTGAGACTTAAAGAGG + Intronic
915559830 1:156680469-156680491 GACACTCCCTACTCTTCAGCCGG - Intergenic
915828839 1:159106115-159106137 GGCACTTCTGAGACTGCAGGGGG + Intronic
916120255 1:161523248-161523270 GACATTTCTGAGACTTCTGAAGG - Intronic
916140555 1:161693474-161693496 GCCATTACTGAGACTTCAGTAGG + Intergenic
921045720 1:211476663-211476685 GACACTCCTCAGACTACTACAGG - Exonic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
924119620 1:240783058-240783080 AATAAACCTGAGACTTCAGCTGG + Intronic
1062853698 10:767570-767592 GGTTCTCCTGAGTCTTCAGCTGG + Intergenic
1066478081 10:35767319-35767341 GATAATCCTGAGAGTTCAGATGG + Intergenic
1067223184 10:44358529-44358551 GACACCACTGAGGCTGCAGCAGG - Intergenic
1067223549 10:44361084-44361106 GACACTTCTTTGACTTCTGCTGG - Intergenic
1068534210 10:58222473-58222495 GCCAGTCCTTAGACTTCTGCAGG - Intronic
1068938679 10:62659813-62659835 GGCACTACTGAGACTTGTGCCGG + Intronic
1069867941 10:71515159-71515181 GCCACCTCTGAGACTCCAGCAGG - Intronic
1078224393 11:9379095-9379117 GAAACCCCTGAGACTGTAGCAGG + Intergenic
1078378586 11:10818531-10818553 GACACACTTGAGCCTTAAGCAGG + Intronic
1078415633 11:11162487-11162509 GAAACTGCTGAGGATTCAGCTGG + Intergenic
1078512589 11:11996751-11996773 GACAGTCCTGAGAATGCAGGTGG - Intronic
1078620231 11:12900473-12900495 GACACTCCACAGACTTCATCAGG - Intronic
1080062048 11:27967179-27967201 GACACTACTGAGCCATCATCAGG - Intergenic
1080081369 11:28222231-28222253 GCCATTGCTGAGGCTTCAGCAGG - Intronic
1081520724 11:43878712-43878734 GACACTGCTAAGCCCTCAGCTGG - Intergenic
1081779330 11:45699112-45699134 GCCATGCCTGAGACTTCACCTGG + Intergenic
1083162939 11:60866976-60866998 GGCTCTCCTGAGGATTCAGCCGG - Intergenic
1085544447 11:77303943-77303965 CACGCTCCAGAGAATTCAGCTGG - Intergenic
1086484383 11:87282721-87282743 TTCACTGTTGAGACTTCAGCAGG + Intronic
1086794081 11:91078602-91078624 CACACTTCTCATACTTCAGCTGG - Intergenic
1087280124 11:96200653-96200675 GAAGCTCCTGAGAAGTCAGCAGG - Intronic
1088790789 11:113224395-113224417 GCCATTGCTGAGACTTCAGTAGG + Intronic
1090216293 11:124968341-124968363 GCCATTCCTGAGGCTTCAGTAGG - Intronic
1092554752 12:9545413-9545435 GCCAATCCTGAGACGGCAGCAGG + Intergenic
1094013239 12:25831295-25831317 GCCACTCAGGAGACTACAGCAGG - Intergenic
1094805210 12:34083689-34083711 GCCATTGCTGAGGCTTCAGCAGG + Intergenic
1096525492 12:52207729-52207751 GTCACTCCTGAGGCTGCTGCAGG - Intergenic
1096989609 12:55788979-55789001 GACCCTCCTGAGAATGTAGCTGG - Intronic
1098078132 12:66755669-66755691 GAGAATCCAGAAACTTCAGCTGG - Intronic
1101009710 12:100436920-100436942 GACACTACTGAGCCATCATCAGG + Intergenic
1101167374 12:102052477-102052499 GACTGTCCTGAGCCTTGAGCTGG - Intronic
1101193933 12:102363371-102363393 GAGACTCCTGTGCCTTCTGCTGG + Intergenic
1101314088 12:103613365-103613387 GCCATTCCTGAGGCTTCAGCAGG - Intronic
1104115594 12:125746359-125746381 GCCACTACTGAGACTTGAGTAGG - Intergenic
1104228712 12:126862809-126862831 GAAACTCTTGAGATTTCAGTTGG + Intergenic
1106509248 13:30398858-30398880 GACACTCCGGAGACTCTGGCAGG - Intergenic
1111646396 13:91037048-91037070 AATAGTCCTGAGACATCAGCTGG + Intergenic
1112633221 13:101184240-101184262 GAGACTTCCCAGACTTCAGCAGG - Intronic
1117528939 14:56639946-56639968 GCCATTGCTGAGGCTTCAGCAGG + Intronic
1119521847 14:75292291-75292313 AAGACTCCAGAGCCTTCAGCTGG + Intergenic
1120007453 14:79375437-79375459 GACACTCCTGAGACTTCAGCAGG - Intronic
1120359458 14:83479482-83479504 GACACTACTGAGATTTCAGATGG + Intergenic
1121206430 14:92172500-92172522 GACACTCCTAAAACTTAAGTGGG - Intergenic
1121710850 14:96038494-96038516 GAGACTCCTTAGAGTACAGCTGG + Intergenic
1122134699 14:99626173-99626195 GACATTCCTGTGACCCCAGCAGG + Intergenic
1129114230 15:73356297-73356319 GCCACTCCAGAGACTCAAGCAGG - Intronic
1129126305 15:73444091-73444113 CACTCACCTGAGCCTTCAGCAGG + Intronic
1129744535 15:78008595-78008617 GACAAACCAGAGACTTCGGCGGG - Intronic
1133783472 16:8956995-8957017 GACACTCCTGAGACAGAGGCTGG - Intronic
1133982958 16:10647146-10647168 GACATTACTGAGGGTTCAGCGGG + Intronic
1138618486 16:58192095-58192117 AACAATCCTGTGACTTAAGCAGG + Intronic
1139527886 16:67528027-67528049 GACACCCCTGAGGCTTCTCCAGG - Intronic
1143376761 17:6471683-6471705 GTCACTCCTGGGACCTCAGCTGG - Intronic
1144297309 17:13888341-13888363 GACACAGCTGAGACTCAAGCTGG + Intergenic
1150224970 17:63519530-63519552 GACATTCCTGAGTCTGAAGCTGG + Intronic
1151217699 17:72589101-72589123 GACACACCTGCTACTCCAGCCGG + Intergenic
1151346165 17:73503072-73503094 GGCACTTCTGAGAGTCCAGCCGG - Intronic
1155258336 18:24017672-24017694 GTCACTGCTGAGCCTTCAGCAGG - Intronic
1156484441 18:37456039-37456061 GACACTCCAGAGGCCTCAGGAGG - Intronic
1157415288 18:47497391-47497413 GACTCTCCTGAGGCTAGAGCTGG - Intergenic
1159464213 18:68759838-68759860 CACACTTCTGAGAGTTCTGCAGG + Intronic
1162015851 19:7846173-7846195 GACACCCCTGAGGCTGGAGCAGG - Intronic
1162739550 19:12766215-12766237 GACGCTCCTGCGGCTTCAGCTGG - Exonic
1163233418 19:16018375-16018397 GAGACTCCAGAGACCCCAGCAGG + Intergenic
1164853879 19:31505610-31505632 GACACTCCACAGACATCTGCCGG + Intergenic
1167385043 19:49158042-49158064 GAGACTCCTGAGTCTGGAGCGGG + Intronic
927110403 2:19860389-19860411 GCCAGTCCTGGGACTTCTGCAGG + Intergenic
933093199 2:78146345-78146367 GACACCCCTGAGCCTGCAGGGGG - Intergenic
933648858 2:84832985-84833007 GTGACTCCTGAGACTACAGTGGG - Intronic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
943332790 2:186579942-186579964 GCCACTCAGGAGACTTAAGCAGG - Intergenic
948484027 2:238268522-238268544 GTCACTCCTGACAGTGCAGCTGG + Intronic
948893823 2:240919143-240919165 GACAGTCCTGGGCCTGCAGCTGG + Intronic
1169154246 20:3315927-3315949 GACACACCTGAGATGTCTGCTGG + Intronic
1170742459 20:19070129-19070151 GCCATTCCTGAGTCTTCAGCAGG + Intergenic
1170903999 20:20495210-20495232 AACACTCCAGAGACTACCGCAGG - Exonic
1171141625 20:22748768-22748790 GACCTTCCTGAGCCTTCAGCTGG + Intergenic
1171393046 20:24813699-24813721 GTCACTCTGGAGGCTTCAGCCGG - Intergenic
1172039448 20:32033755-32033777 GACAGTACTCAAACTTCAGCAGG + Intergenic
1173298416 20:41779616-41779638 GGCACTCCTGAGAAGTCAGTAGG - Intergenic
1176248213 20:64107475-64107497 GAAACTCCTGAAACCTCAGCTGG - Intergenic
1176427408 21:6557337-6557359 GACTCCCCTGAGCCTCCAGCAGG + Intergenic
1178511831 21:33211853-33211875 GTCACCCCTGAGACCTCAGTCGG + Intergenic
1179060097 21:37971901-37971923 GACCCTCCAGAGACTGCAGCAGG - Intronic
1179354176 21:40643027-40643049 TTCACTCCAGAGACTGCAGCAGG - Intronic
1179702899 21:43165654-43165676 GACTCCCCTGAGCCTCCAGCAGG + Intergenic
1179955478 21:44735878-44735900 GGCACTCCTGACATCTCAGCTGG - Intergenic
1180899155 22:19358430-19358452 GACACCCCTTAGCCCTCAGCTGG + Intronic
1182141851 22:27966464-27966486 GACCCTCCTGGGGCTTCAGCAGG + Intergenic
1183640308 22:39088770-39088792 GACACTGCTGAGACCTGGGCTGG + Intergenic
1184708464 22:46232381-46232403 GTCACTGCTGAGAATTCAGTGGG + Intronic
1184762511 22:46552566-46552588 CACATTCCTGGGACCTCAGCTGG - Intergenic
950788906 3:15456719-15456741 GACACTCCTCTCACTTCAGAAGG - Intronic
951033583 3:17908627-17908649 GACACTCTTGAGACGATAGCAGG - Intronic
951087273 3:18528118-18528140 TACACTCCTGAAGCTTCATCTGG + Intergenic
952007143 3:28855011-28855033 GACTCTCCTGAGAATTCATATGG + Intergenic
952646698 3:35668412-35668434 TACACTTCAGAGACTCCAGCAGG - Intronic
953038172 3:39231472-39231494 GAAAGTCCTGACTCTTCAGCAGG + Intergenic
953350414 3:42211096-42211118 GACATTCCTGAGGATTCACCAGG + Intronic
953520705 3:43639937-43639959 GACACTCCAGTGAGTTCAGCTGG - Intronic
954533327 3:51339291-51339313 GTCACCCTTGAGACTTCAGAGGG - Intronic
955646880 3:61149357-61149379 GACACTTCTGAGACTGAAGCAGG + Intronic
956038427 3:65120337-65120359 GCCATTGCTGAGACTTGAGCAGG + Intergenic
963467498 3:145701687-145701709 GAAACTCCTGAGACCCCAGGAGG + Intergenic
968687685 4:1972516-1972538 GGCATTCCTGTGACTCCAGCGGG + Intronic
968691074 4:1990479-1990501 GACACTCCTGAGACACGAACGGG + Intronic
969888370 4:10236900-10236922 GACCATTCTTAGACTTCAGCTGG - Intergenic
971009497 4:22417881-22417903 AAAATTCATGAGACTTCAGCTGG + Intronic
973535120 4:51873234-51873256 CTCACTCCTGAGACCTCAGGAGG + Intronic
973974451 4:56248151-56248173 AACACTCCTGATTCTTCAGTGGG - Intronic
974975022 4:68881086-68881108 AAAACTCCTGAGACTCTAGCAGG - Intergenic
975149400 4:71004772-71004794 GCCATTACTGAGACTTCAGTAGG - Intronic
975763126 4:77636859-77636881 CACTCTCCTCAGACCTCAGCTGG - Intergenic
976633679 4:87265916-87265938 GAAACTCCTGATGATTCAGCAGG - Intergenic
979800310 4:124899891-124899913 GCCACTCTTGAGACTCAAGCAGG - Intergenic
983125954 4:163950453-163950475 GGCACTTCTGAGCCTGCAGCAGG + Intronic
983583678 4:169333941-169333963 GAAACTCCAGAGATGTCAGCAGG - Intergenic
985308410 4:188570653-188570675 GACATTCTTGACACTTCACCTGG - Intergenic
986842254 5:11711165-11711187 GCTACTCCAGAGACTTAAGCAGG - Intronic
991185645 5:63803626-63803648 AACACAGCTGAGCCTTCAGCTGG - Intergenic
994125531 5:96166095-96166117 GGCGCTCCTGAGTCTTCAGCTGG + Intergenic
995633805 5:114162680-114162702 GCCATTGCTGAGGCTTCAGCAGG - Intergenic
997002639 5:129780672-129780694 GACCTTCCTGGGTCTTCAGCTGG + Intergenic
999500443 5:152141712-152141734 GACACTTTTGAGAGTTAAGCAGG - Intergenic
999909916 5:156186506-156186528 GGCACTCCTAAGACTTTATCTGG + Intronic
1002526926 5:179820244-179820266 GACACTCAGGAGACCTTAGCTGG + Intronic
1006288703 6:33117426-33117448 GAGACCCCTGGGACTTCATCAGG + Intergenic
1008836158 6:55833002-55833024 GATACTCCAGAGACTCAAGCAGG + Intronic
1010837905 6:80612539-80612561 GCCACTGCTGAGGCTTGAGCAGG + Intergenic
1015046270 6:128779930-128779952 GTCATTCCTGAGGCTTCAGTAGG - Intergenic
1016760711 6:147733560-147733582 TTCACTCCTGAGACTACAGTTGG - Intronic
1016835573 6:148473363-148473385 GACACTCAGGAGACTGAAGCAGG - Intronic
1017159998 6:151355876-151355898 GACAATCCTGAGGCTTCATCAGG + Exonic
1019596943 7:1862459-1862481 GAGAGTCCCGAGACTGCAGCAGG + Intronic
1019727928 7:2613217-2613239 GACACTGCTGAGGCTGAAGCTGG + Exonic
1022497854 7:30864537-30864559 GACCTTCCTGAGAATGCAGCTGG - Intronic
1023875077 7:44282460-44282482 GACACTGCAGAGGGTTCAGCAGG - Intronic
1035929449 8:3764516-3764538 GTCACACCTGAGACATCACCAGG + Intronic
1036943038 8:13069513-13069535 GAGTCTACTGAGACTTCTGCAGG - Intergenic
1038712083 8:29956789-29956811 GTCACTCCTGAATATTCAGCTGG - Intergenic
1038779411 8:30557456-30557478 GAGAATCCCCAGACTTCAGCTGG + Intronic
1041688360 8:60665231-60665253 GACACTCCTGAGCATTCTCCTGG + Intergenic
1043274531 8:78376833-78376855 CACTCCCCTCAGACTTCAGCTGG - Intergenic
1044053839 8:87543054-87543076 GGCACTTCTGAGCCTTCAGGGGG + Intronic
1044672170 8:94693291-94693313 GACACTCATGAGTCTTTAGGTGG + Intronic
1047102124 8:121688671-121688693 CCCACCCCTGAGACTTCAGCAGG + Intergenic
1048434905 8:134407164-134407186 CACACTCCTGAGCCTTCAGTGGG + Intergenic
1048679716 8:136827074-136827096 TACACACCTGTAACTTCAGCAGG - Intergenic
1049037084 8:140085189-140085211 GTCACTCCTGTAACTACAGCAGG - Intronic
1049293687 8:141818147-141818169 GACACAGCTTAGAGTTCAGCAGG - Intergenic
1049797959 8:144505154-144505176 GACATTCCTGACACTGCAGAGGG + Intronic
1050204879 9:3186076-3186098 CACTCTCCTCAGACCTCAGCTGG - Intergenic
1054988189 9:71287330-71287352 GAAATGCCTGAGACTTCAGAAGG - Intronic
1055480843 9:76707928-76707950 GAAACTACTGAGACTTCAGATGG - Exonic
1058508960 9:105695058-105695080 GTCAGTCCTGGGACTTCTGCGGG - Intronic
1059058139 9:111005821-111005843 GAGACTCCTGAGACATCAGCTGG - Intronic
1060030981 9:120214590-120214612 GTTGCTCCTGAGACTCCAGCTGG + Intergenic
1060788894 9:126472202-126472224 CACACACCTCAGACTTCTGCAGG - Intronic
1062726864 9:138079146-138079168 GCCACTCCCGAGACTGCATCAGG + Intronic
1187829153 X:23363338-23363360 GCCACTGCTGAGGCTTGAGCAGG - Intronic
1192961908 X:76139954-76139976 AATACTCCTGAGACTTCATTGGG + Intergenic
1193619649 X:83736756-83736778 GACATACCAGAGACATCAGCTGG + Intergenic
1200329192 X:155278009-155278031 CAGACTCCTGAGAATTCTGCTGG + Exonic
1201784927 Y:17764953-17764975 GACACTCCTCAGATTTCACTAGG + Intergenic
1201816625 Y:18141034-18141056 GACACTCCTCAGATTTCACTAGG - Intergenic