ID: 1120008864

View in Genome Browser
Species Human (GRCh38)
Location 14:79390422-79390444
Sequence CTGTAGCAGCAGAAAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120008864_1120008867 29 Left 1120008864 14:79390422-79390444 CCTACCTCTTTCTGCTGCTACAG 0: 1
1: 0
2: 4
3: 29
4: 363
Right 1120008867 14:79390474-79390496 GTAAATGAAAGTCAGAAGTAAGG 0: 1
1: 0
2: 1
3: 39
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120008864 Original CRISPR CTGTAGCAGCAGAAAGAGGT AGG (reversed) Intronic
901857099 1:12051601-12051623 CTGTGGCTGCAGTAAGAGGTGGG + Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903747526 1:25598137-25598159 CTGTAGCAGCAAGAAGAGGCAGG + Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904270452 1:29346517-29346539 CTTTGGCTGCAGACAGAGGTGGG - Intergenic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
904573291 1:31484143-31484165 TGGTGGCAGCAGAAAGGGGTTGG - Intergenic
905431842 1:37930453-37930475 CAATGGCAGCAGAAAGAGGTGGG - Intronic
905948447 1:41924218-41924240 CACCAGGAGCAGAAAGAGGTAGG + Intronic
906241289 1:44243693-44243715 CTGTAGCAGCAGAGAGGGAGTGG + Intronic
906276264 1:44518447-44518469 CTTTGGCATCAGGAAGAGGTGGG - Intronic
906829082 1:49012831-49012853 ATGTAACAGCATTAAGAGGTGGG + Intronic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907418575 1:54331281-54331303 CTGTAGCATCTGGAAGTGGTTGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907739375 1:57149753-57149775 CTGTAGCAGAACACAGAGGTAGG - Intronic
907834073 1:58092743-58092765 CTCTGTCAGCAAAAAGAGGTGGG + Intronic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
909098088 1:71314874-71314896 TTGTGGCAGCATAAAGAGGTAGG - Intergenic
910082887 1:83362909-83362931 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
914360858 1:146934795-146934817 CGGAAGCAGGATAAAGAGGTGGG - Intergenic
914491727 1:148155842-148155864 CGGAAGCAGGATAAAGAGGTGGG + Intergenic
915128541 1:153681681-153681703 CTGTAGGGGCAAACAGAGGTCGG - Intronic
915863865 1:159477223-159477245 TTGTGACAGCAGGAAGAGGTAGG + Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919804956 1:201376008-201376030 CTGATGCAGGGGAAAGAGGTGGG + Intronic
919921224 1:202167736-202167758 CTACAGCATCAGGAAGAGGTGGG + Intergenic
919921390 1:202168494-202168516 CTACAGCATCAGGAAGAGGTGGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
921289598 1:213645190-213645212 ATGACGGAGCAGAAAGAGGTGGG + Intergenic
921628552 1:217405025-217405047 CTGTAGACGCTGAGAGAGGTGGG + Intergenic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
1062815197 10:494210-494232 CTTTGACAGCAGAAAGAAGTGGG + Intronic
1065271889 10:24041607-24041629 CTATGGCAGCCCAAAGAGGTTGG + Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1069248639 10:66242041-66242063 ATGTGGCAGCAGTAAGAGGTGGG + Intronic
1069719107 10:70538829-70538851 CTGTAGCCGCAGAAAGGGTCAGG - Intronic
1069920864 10:71814938-71814960 CTGTATCAGCTGCAAGAGGCCGG - Exonic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070728865 10:78811142-78811164 CTGAAGCATCAGACAAAGGTAGG + Intergenic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1070982529 10:80660910-80660932 TTGTTGCAACAGAAAGAGGAAGG - Intergenic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1073101414 10:101008616-101008638 CTGGAGCAGCATCAAGGGGTTGG + Intronic
1074075249 10:110117389-110117411 CTGTAGCTTCAGAAAAAGATAGG - Exonic
1074627996 10:115215059-115215081 CTCTAGCAGCAGGAACAGGAAGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074776420 10:116771111-116771133 CTGTAGATGGAGACAGAGGTGGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076740332 10:132479667-132479689 CTGTGGCTGCAGAAAGTGCTTGG + Intergenic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1079889159 11:26028753-26028775 CTTTAGCATCTGAAAGAGGCAGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1083007913 11:59366038-59366060 CTGTAGCATAAGAAAGAAGGAGG + Intergenic
1083068043 11:59945938-59945960 CTGGAGCAGGAGGAAGTGGTCGG + Intergenic
1084727398 11:70950569-70950591 GTGTGGCAGCACGAAGAGGTGGG - Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1086269697 11:85046809-85046831 ATGGAGCAGAAGAAAGAGTTAGG - Intronic
1086393663 11:86391929-86391951 CTGGAGCAGGAGTAAGAGGGAGG + Intronic
1087236437 11:95723883-95723905 TTGTAGCAGTATTAAGAGGTGGG - Intergenic
1087328850 11:96754721-96754743 CTGTGGTACCAGAAAGAGATGGG - Intergenic
1087563896 11:99828512-99828534 TTGTAACAGCATTAAGAGGTGGG - Intronic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1089620062 11:119717121-119717143 CTGCAGCAGCACTGAGAGGTGGG + Intronic
1090169151 11:124582905-124582927 CTGTACCAACAGAAAGAGTCTGG - Intergenic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1092197090 12:6555988-6556010 CTGCTGCAGGAGGAAGAGGTTGG + Exonic
1094114734 12:26898904-26898926 CTGTAACAGTATGAAGAGGTGGG + Intergenic
1094746550 12:33350923-33350945 CAGTAGCAGGAGCAAGGGGTGGG + Intergenic
1095381268 12:41596079-41596101 TTGTAACAGTAGTAAGAGGTGGG - Intergenic
1097041926 12:56161007-56161029 CTATAGCAGCAGAATGGGGCAGG - Intronic
1098204230 12:68090272-68090294 CTTTAGCAGATAAAAGAGGTAGG - Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1101683443 12:106991960-106991982 CTGTTGCAGCTGAAATTGGTGGG - Exonic
1103893150 12:124254872-124254894 CTGTTGGAGCTGAAAGAGGAGGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1106042498 13:26106562-26106584 CAGTAGTAGTAGAAAGATGTGGG - Intergenic
1108046253 13:46387234-46387256 CGGTAACAGCAGAAAGGGGAGGG + Exonic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1111296927 13:86291231-86291253 CTGTAGCAGGAGTAAGAGGGTGG - Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1117575983 14:57098234-57098256 GTATAGCAGCTGAAAGAGTTGGG + Intergenic
1117947925 14:61050057-61050079 CTCTAGCACCAAAAAGAAGTAGG + Intronic
1118225592 14:63896099-63896121 CTGTAGCAGCCAAAAAAGGGAGG + Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120662671 14:87269327-87269349 TTGTAGCAGCAGTAACAGGCAGG + Intergenic
1120707904 14:87763320-87763342 CCAGAGCAGGAGAAAGAGGTGGG + Intergenic
1121755326 14:96397797-96397819 CTCTAGCAGCAGGCAGAGCTGGG - Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122271704 14:100571183-100571205 CTGGACCACCAGAAAGAGGTAGG - Intronic
1122326453 14:100883547-100883569 CATGAGCAGCAGGAAGAGGTGGG + Exonic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1123898705 15:24854226-24854248 CTGTAGCAGTATTAAAAGGTGGG - Intronic
1124258976 15:28169866-28169888 CTGTAACTGCAAAAAGATGTAGG + Intronic
1124566703 15:30822312-30822334 CTGTAACTGCAAAAAGATGTAGG - Intergenic
1126634538 15:50767902-50767924 CTGTGGCAGAAGAAATAGGGAGG + Intergenic
1128461645 15:67873026-67873048 TTGTAGCAGTATTAAGAGGTGGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1129151421 15:73690673-73690695 CTGTAACAGTATTAAGAGGTGGG - Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1131694630 15:94863286-94863308 CTGTAGTAGTATTAAGAGGTGGG + Intergenic
1131952656 15:97697522-97697544 TTGTAGCAGTATTAAGAGGTGGG + Intergenic
1132222751 15:100117131-100117153 CTGTAACAGCAGAGAGGGGGTGG - Intronic
1134007499 16:10827990-10828012 CTGTTGGAGCAGCCAGAGGTCGG + Intergenic
1134395271 16:13856668-13856690 CTGCAGCAGGAGAAAGTGCTGGG - Intergenic
1134818654 16:17227743-17227765 ATGGAGCAGGAGAAAGAGTTGGG + Intronic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1138036083 16:53608080-53608102 GAGTGGCAGGAGAAAGAGGTGGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1141235431 16:82211517-82211539 CCAGAGCAGGAGAAAGAGGTGGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1143701718 17:8665476-8665498 TTGTGCCAGGAGAAAGAGGTTGG - Intergenic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144684150 17:17215180-17215202 CTGTAGCTGCAGACCGAGGTGGG - Exonic
1144733368 17:17541324-17541346 CTGGAGGAGCTGAAAGAGCTGGG - Intronic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1145993917 17:29094931-29094953 CTGAAGCAGCAACTAGAGGTGGG - Exonic
1147219523 17:38920219-38920241 CTGTAGCCCCAGACAGAGATGGG - Exonic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1148113634 17:45161922-45161944 CTGCAACTGCAGCAAGAGGTAGG + Intronic
1148241997 17:46005729-46005751 CTGGAGCTGCGGAAGGAGGTGGG - Intronic
1148745326 17:49914787-49914809 CTGTAGCATCAACAAGAAGTGGG - Intergenic
1151664840 17:75540004-75540026 CTGTAGAAGGAGCAAGAGCTTGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1155298247 18:24405289-24405311 CTGTAACAGTATTAAGAGGTGGG + Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156518445 18:37700713-37700735 CTGTAGCAGCAGGTAGGGCTGGG - Intergenic
1157612230 18:48964315-48964337 CTCTAGCAACAGCAAGAGCTGGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1160820892 19:1057269-1057291 CTTTATCAGCCTAAAGAGGTGGG - Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1163394445 19:17051080-17051102 ATGTGGCAGCAGCGAGAGGTGGG + Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1167164688 19:47790578-47790600 GAGTAGCAGAAGGAAGAGGTGGG + Intergenic
1167448405 19:49552963-49552985 CCGTAGCAGAAGAAAGAGACGGG - Intergenic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1167842682 19:52134903-52134925 TTGTTGCAGCAGACAGAGGTGGG + Intronic
1168503343 19:56912199-56912221 CTCTAGAAGCAGAAAGAAGGAGG - Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925656867 2:6158480-6158502 CCTTAGCAGCAGAAAAAGGCAGG - Intergenic
925740656 2:7003287-7003309 CTGTAGCAGCAGTAATGGCTGGG + Intronic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
927167037 2:20333937-20333959 CTGTAGCAGGAGGAAGAGAGGGG - Intronic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG + Intergenic
927431872 2:23033351-23033373 CTGTGGCAGTAATAAGAGGTGGG - Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928612685 2:33005905-33005927 GAGTAGCAGCATAAAGTGGTAGG + Intronic
930149176 2:48040789-48040811 CTATAGCAGAATTAAGAGGTAGG - Intergenic
930381595 2:50636639-50636661 CTCTAGAAGCACAAAGAGGTAGG - Intronic
930667193 2:54111078-54111100 CTCTTTCAGCAGAAAGAGGTTGG + Intronic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
932758857 2:74426575-74426597 CTGTGGCACCAGGAAGGGGTTGG + Intronic
933664721 2:84955718-84955740 CTGTAGGGCCAGAAAGATGTTGG + Intergenic
934157215 2:89214577-89214599 CTGGCCCAGCTGAAAGAGGTAGG - Intergenic
934210099 2:89968167-89968189 CTGGCCCAGCTGAAAGAGGTAGG + Intergenic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935716319 2:105942488-105942510 CTGTAACAGCAGGAAGTGTTAGG - Intergenic
935943364 2:108264635-108264657 CTGTAGCAACACAAAGATGAGGG - Intronic
937292164 2:120788272-120788294 CAGTCACAGCACAAAGAGGTTGG + Intronic
937571311 2:123365691-123365713 CAGTAGCAGCAGAAAGCAGCAGG + Intergenic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938485718 2:131705720-131705742 CTGAAGCAGCTGGAAGAAGTGGG - Intergenic
939026118 2:137015462-137015484 CTGGAGCAGCAGAAAGCTGCTGG - Intronic
939872875 2:147544450-147544472 TTGTAGCAGGAGAAAGGGGGTGG - Intergenic
940149154 2:150579767-150579789 TGGAAGCAGAAGAAAGAGGTGGG + Intergenic
941006313 2:160250860-160250882 TTGTAACAGCACTAAGAGGTGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944908476 2:204286155-204286177 CAGTAGCTGGAGTAAGAGGTAGG - Intergenic
945030542 2:205659277-205659299 CGGTAGAAGTAGAAAGAGATGGG - Intergenic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
946939763 2:224758534-224758556 TTGTAGCAGCAGTAGCAGGTGGG + Intergenic
947103445 2:226645826-226645848 TTGGAGCAGCAGCAATAGGTTGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948217379 2:236241725-236241747 CTGTATCATCACAAAGAGGGTGG - Intronic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
1169815315 20:9650422-9650444 TTGTAGGTGGAGAAAGAGGTTGG + Intronic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1172865108 20:38089903-38089925 TTGTACCAGCAGAAAGAAGAGGG + Exonic
1173225228 20:41158621-41158643 CAATAGCATCAGAAAGATGTTGG - Intronic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1174455793 20:50647954-50647976 CCTTAGCAGCACAAAGTGGTAGG - Intronic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175185820 20:57179154-57179176 CTGTCCCAGCAGAAAGTGGCCGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1177785139 21:25663474-25663496 ATGTAGCAGTATTAAGAGGTAGG + Intronic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1179550259 21:42139336-42139358 CTGGAGCAGGAGGAAGGGGTTGG + Intronic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1180200157 21:46219370-46219392 CTGTGACAGCAGAGAGGGGTGGG - Intronic
1180202167 21:46230491-46230513 CTCTGGAAGCAGAAAGAGGCTGG + Intergenic
1180713730 22:17857595-17857617 ATGTAGAAGCACAAAGAGCTGGG + Intronic
1180723547 22:17927598-17927620 CTGGAGCAGCAGGCAGATGTCGG - Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183376069 22:37466133-37466155 CGTTATCAGCAGTAAGAGGTTGG - Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
949211620 3:1510081-1510103 CTATGGCAGCTGAAAGAGGTGGG - Intergenic
950969921 3:17176082-17176104 CTGTAGAATCAGACAGAGCTGGG + Intronic
953703363 3:45213483-45213505 CTGAAGCAGCAAACAGATGTGGG - Intergenic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955063470 3:55514532-55514554 CTGTAGCAGAAGAGAAAGTTAGG + Intronic
955540738 3:59973402-59973424 CTGTGGCAGAAGAGAGAGGTTGG - Intronic
955545898 3:60029820-60029842 TTGTAGCACCAGAAAGAGGTTGG + Intronic
956367494 3:68520411-68520433 CTGTAGCACAAGAAAGAAATTGG - Intronic
957905335 3:86546107-86546129 AATTAGCAGCTGAAAGAGGTGGG - Intergenic
958716477 3:97788903-97788925 CTCTTACAGCAGAGAGAGGTAGG - Intronic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
960208400 3:114930839-114930861 ATGTTGCAGCAGAAAAGGGTGGG + Intronic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
960466505 3:118002434-118002456 CTGTAACATCAGACAGATGTGGG + Intergenic
960539947 3:118851159-118851181 TATTAACAGCAGAAAGAGGTGGG + Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
962974929 3:140437610-140437632 CTGTGACAACAGAAAGAGGCTGG + Intronic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
966441700 3:179952385-179952407 CTGTAGCAGAAAGAAAAGGTCGG + Intronic
966462881 3:180197212-180197234 CAGTGGCAGCATCAAGAGGTGGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967422509 3:189289362-189289384 CAGTAGGAACAGAAAGAGTTAGG - Intronic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
968649968 4:1756674-1756696 CTTTGGCTGCAGCAAGAGGTGGG - Intergenic
969096894 4:4740002-4740024 CTGCAGCAGCATTGAGAGGTAGG + Intergenic
970289941 4:14561178-14561200 TTTTAGCAGCAGAAAAAGGCAGG + Intergenic
971934687 4:33132511-33132533 CTGAAGCAGGAGACAGAGTTTGG + Intergenic
971935707 4:33144256-33144278 CTGTGGCAGCCCAAAGAGGCAGG + Intergenic
972325168 4:38008285-38008307 CTGTAGGAGCTAAAAGAGGGTGG - Intronic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
972847874 4:43011352-43011374 CTGGAGCAGGATAGAGAGGTTGG + Intronic
972907591 4:43769637-43769659 CTGTAACAGCATTAAGAGATAGG - Intergenic
974985852 4:69025572-69025594 ATGCAGCATCAGAAAAAGGTGGG + Intronic
976071496 4:81245227-81245249 CGGTAGAAGCAAAAAAAGGTAGG + Intergenic
977035695 4:91950206-91950228 CTGTAGCCCCAGCACGAGGTAGG + Intergenic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
979814929 4:125088410-125088432 CTGCAGCAACAGAAAACGGTGGG - Intergenic
980262615 4:130471815-130471837 CTCTAGTAGCAGAAGGTGGTCGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981018210 4:139997454-139997476 CAGTAACAGCACAAAGAGGGTGG - Intronic
982308141 4:153955055-153955077 CTGTGTCAGCAGAATGAGTTGGG - Intergenic
982331290 4:154184660-154184682 CTGTGGCAGTATTAAGAGGTAGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983930580 4:173449167-173449189 GGGAAGCAGCTGAAAGAGGTGGG + Intergenic
983950606 4:173635522-173635544 CTGTAGCAGCATATAGAATTGGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
987377665 5:17251545-17251567 GTCTAGCAGCAGGAGGAGGTAGG + Intronic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
992411041 5:76505372-76505394 TGGTAGCAGCAGAAAGAGCCTGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993591137 5:89796474-89796496 TTGTAGCAGCATTAAGAGGTGGG + Intergenic
993764628 5:91841003-91841025 TTGTAGCTGAGGAAAGAGGTTGG + Intergenic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
995140049 5:108725826-108725848 CTGTGGCATCAGAAAGAGCAGGG + Intergenic
996483654 5:124004290-124004312 CTCTAGAGGCAGAAAGAGCTTGG - Intergenic
998374836 5:141683310-141683332 CTGAGGCAGCTGGAAGAGGTGGG - Intergenic
998520940 5:142799856-142799878 CTCTAACAGTACAAAGAGGTGGG - Intronic
1002283702 5:178148445-178148467 CTGTAGTGGGAGGAAGAGGTGGG - Exonic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004296668 6:14418235-14418257 TTGTAGCAGTATTAAGAGGTGGG + Intergenic
1005557956 6:27007432-27007454 CTGTAGCAGCTGGAAAAGTTGGG - Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1008104491 6:47427668-47427690 CTGGAGCAGGAGCAAGATGTGGG + Intergenic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1014506265 6:122261968-122261990 CTCTATCAGCAGAAAAAGCTGGG - Intergenic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014706902 6:124758808-124758830 ATGTAGCTGGAGAGAGAGGTTGG - Intronic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017690166 6:156956155-156956177 CTCTAGCAGGGGAAGGAGGTGGG + Intronic
1017996599 6:159536969-159536991 CTGTAGCAATATTAAGAGGTGGG - Intergenic
1018282406 6:162200845-162200867 CTTTGGCAGCAAAAAGAGGTTGG - Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019056489 6:169227264-169227286 CTGTAGAACCAGCAAGAGCTGGG - Intronic
1020829990 7:13083312-13083334 CTGTAGGGGCAGAAAAAGTTGGG - Intergenic
1020937377 7:14484506-14484528 CAATAGCAGGAGCAAGAGGTGGG - Intronic
1022622263 7:31996689-31996711 GTGCAGCAGCAGAGAGATGTTGG - Intronic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024767599 7:52678932-52678954 CTGTTACAGCATTAAGAGGTGGG + Intergenic
1026123479 7:67558622-67558644 CTGTAGCACCAAAAACAGGGGGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027299723 7:76819111-76819133 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
1027833048 7:83205121-83205143 ATACAGCAGCAGAAAAAGGTAGG - Intergenic
1029000657 7:97151311-97151333 CTGTAGCTGCAGAAAGAAATAGG + Intronic
1030434697 7:109502015-109502037 CTCTAGCAGGAGAAGGAGATAGG + Intergenic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1031368608 7:120935825-120935847 ATGTAGCAGAAGCAGGAGGTAGG + Intergenic
1031377816 7:121049423-121049445 GGGTAGCAGTAGAGAGAGGTGGG - Intronic
1031420907 7:121550538-121550560 CTCCAGCACCAGAAAGCGGTGGG + Intergenic
1031429647 7:121651330-121651352 CTGGAGCAGGAGCAAGGGGTAGG - Intergenic
1032788584 7:135222660-135222682 CACTAGTAGCAAAAAGAGGTGGG + Intergenic
1033385926 7:140874930-140874952 CTGGAGCAGAAGCAAGAGATGGG - Intronic
1033962081 7:146927304-146927326 CTGTATTTGCTGAAAGAGGTTGG + Intronic
1034012682 7:147547030-147547052 CAGTGGCTGCAGTAAGAGGTGGG + Intronic
1035609138 8:948685-948707 CTGGAGCAGCAGGGAGACGTGGG - Intergenic
1037549289 8:19954579-19954601 CAGTAGCAAGAGAAAAAGGTGGG + Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1039622393 8:39010307-39010329 CTGTGGCAATAGAAAGAGCTTGG + Intronic
1039966211 8:42285868-42285890 CCGTAGAGACAGAAAGAGGTGGG + Intronic
1040702531 8:50084709-50084731 TTGTAACACCATAAAGAGGTGGG + Intronic
1040820879 8:51555368-51555390 TTGTAGCAGCATTAAGAAGTGGG - Intronic
1040859916 8:51988554-51988576 TTTTAGCATCAAAAAGAGGTGGG - Intergenic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1041959292 8:63594220-63594242 TGGTAGGACCAGAAAGAGGTAGG + Intergenic
1042462098 8:69081326-69081348 ATGTGGCAGCAGCAAGAGGCAGG + Intergenic
1042699438 8:71595957-71595979 ATGTAACAGTAGTAAGAGGTAGG + Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1044608645 8:94070305-94070327 CTGTAACAGTATTAAGAGGTAGG - Intergenic
1044941767 8:97350807-97350829 CTGAAGCAGCTGAACGAAGTAGG + Intergenic
1045006297 8:97919535-97919557 CGATAACATCAGAAAGAGGTGGG - Intronic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045976569 8:108136425-108136447 CTTTAGGAGCAAAAAGAGGGAGG + Intergenic
1047764735 8:127981243-127981265 CTCTTGCAGAGGAAAGAGGTTGG - Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1049215590 8:141406412-141406434 GGGTGGCAGCAGAAAGAGGACGG - Intronic
1049675830 8:143888608-143888630 CTGAAGGAGCAGGGAGAGGTCGG + Intergenic
1050423380 9:5490076-5490098 CTCTAGCAGCAGAAGCTGGTGGG + Intergenic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054948041 9:70817731-70817753 CTGTAGTAGCACAGAGAGATAGG - Intronic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1056898208 9:90571365-90571387 CTCTTGCAGCTGAAAGAGGCAGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059815050 9:117902946-117902968 CAATAGCAGGAGGAAGAGGTAGG + Intergenic
1059889248 9:118783042-118783064 TTGTAGCAGGAGAAAGAGATGGG + Intergenic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1061616252 9:131781386-131781408 CTGTAGCAGTAGAACCAGCTTGG + Intergenic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG + Intergenic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1185663538 X:1745988-1746010 CTGTAGGAGCAGAGACATGTCGG + Intergenic
1186679908 X:11862001-11862023 CTGGAGCAGGAGCAAGGGGTTGG + Intergenic
1186689803 X:11963287-11963309 CTGTAGCAGCAGACATCGGTTGG - Intergenic
1188643793 X:32538693-32538715 CAGTAGCAGCAGAATCACGTGGG + Intronic
1194740304 X:97564625-97564647 CTGTAGCTGTATTAAGAGGTGGG - Intronic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1195574717 X:106437030-106437052 TTGTAGCAGCAGAAAGAACCGGG - Intergenic
1196102224 X:111858618-111858640 CTGCAGCTGCACAAAGATGTAGG - Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196547165 X:116975731-116975753 CTGAGGCTGCAGAAAGTGGTGGG - Intergenic
1196551125 X:117026861-117026883 CTGTAGCACCAGAGTGTGGTTGG + Intergenic
1197180050 X:123525133-123525155 CATTAGCAGCAGCAAGAGGGAGG - Intergenic
1197362469 X:125522717-125522739 CTGTAGAACCAGGAAGAGCTGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic
1201576992 Y:15471453-15471475 GTCTAGCAGCAGACAGAGGGAGG - Intergenic