ID: 1120008914

View in Genome Browser
Species Human (GRCh38)
Location 14:79390957-79390979
Sequence CCTCTCTTGCCCTTTGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 3, 3: 61, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120008914 Original CRISPR CCTCTCTTGCCCTTTGCCTT TGG Intronic
901132622 1:6971745-6971767 CTTCTCTTTCCTTTTTCCTTCGG - Intronic
901405643 1:9043461-9043483 CCTCTGCAGCCCTTTGCCCTGGG - Intronic
901715500 1:11150285-11150307 CCTCTCCTGCCCCTTGGGTTAGG + Intronic
901777210 1:11568368-11568390 CCTCTCCTGCTATGTGCCTTTGG - Intergenic
902089110 1:13888922-13888944 ACTCCCTTGCCCTCTGCCTCAGG + Intergenic
902779384 1:18694596-18694618 CCTCTCTTGACCCTGGCCCTGGG - Intronic
903851868 1:26312097-26312119 CCTCTCTTGCCTTTTCCATTTGG + Intronic
904360994 1:29971720-29971742 TCTCTCTTCTCCTTTGCCTTTGG + Intergenic
905183554 1:36180512-36180534 CCTCTCTGGCCTCTTCCCTTGGG + Exonic
905462191 1:38129181-38129203 CCTCATTTGCCCTTTGCCTGGGG + Intergenic
905512943 1:38537597-38537619 ACTCTCATGCCCTTTGGATTGGG + Intergenic
906562512 1:46769402-46769424 TCTCTCTTGCCTTCTGCCCTAGG - Intronic
907553288 1:55322956-55322978 CCTTTCTTGACCTTTGCTCTAGG + Intergenic
907885225 1:58586658-58586680 ACTTTCTTGCCCTTTGTCTTGGG - Intergenic
909487747 1:76192464-76192486 CCTCTCTTTACCTTCTCCTTCGG - Intronic
909863511 1:80637311-80637333 CCTCTGTTGTCATTTGCCTCTGG - Intergenic
910486483 1:87720708-87720730 GCTCTCTTGCCCTTTGGCTTTGG + Intergenic
910680873 1:89863100-89863122 CCTCACTAGCCATTTGACTTTGG + Intronic
912013079 1:104996013-104996035 CATCTGTTTCCCTTTGCCCTGGG + Intergenic
913484768 1:119323965-119323987 CCTCTCTTGCTCTCTGTCTGAGG + Intergenic
914926880 1:151896443-151896465 CCTCTTTTGCCCACTGCATTAGG - Intronic
915437194 1:155916630-155916652 CCTCTCTCTCTCTTTGCCTGAGG + Exonic
915938159 1:160100982-160101004 CCTCTCTTACCCTGTGGCCTGGG + Intergenic
916056615 1:161072893-161072915 CCTGACTTGCCCTTTGCCCTTGG - Intronic
916166946 1:161973100-161973122 CCTCTCCTCCCCTCTCCCTTGGG - Intergenic
916655874 1:166875272-166875294 CCTTTTTTGCTCTTTGGCTTTGG + Intronic
917674642 1:177307185-177307207 CCTCACTGCCCCTTTTCCTTTGG - Intergenic
918637592 1:186796825-186796847 CTTCTCTTGCCCTTGAACTTTGG - Intergenic
919170320 1:193945875-193945897 CCTCTCTTGCTCTTTTTCTCTGG - Intergenic
920073659 1:203321472-203321494 CCACTCCTGGCCTTTGCCTGGGG - Intergenic
920162611 1:204010845-204010867 GCTCACTCCCCCTTTGCCTTTGG + Intergenic
920365262 1:205444901-205444923 TCTCTTTTGCCCTTTACCTGGGG - Intronic
920934267 1:210416702-210416724 CCTCTCTTGCCTTTGGTGTTTGG + Intronic
921396125 1:214671504-214671526 ACTCTCTTTACCTTTGCTTTGGG + Intergenic
921893292 1:220373763-220373785 CCTCTCTTGCCCTTTCACCATGG - Intergenic
922059096 1:222070338-222070360 CCTCTCTAGCCATTGTCCTTTGG - Intergenic
922364632 1:224852195-224852217 CCCCTCTGCTCCTTTGCCTTCGG - Intergenic
922983886 1:229851174-229851196 CGTCTCCTGATCTTTGCCTTAGG + Intergenic
923008149 1:230067915-230067937 CCTTCTTTGCCCTTTACCTTTGG + Intronic
923017887 1:230140729-230140751 CCTCCCTTCCCCTTTTCCTCAGG + Intronic
923516033 1:234698693-234698715 CCTCCCTTGCCCTTTCACTTTGG + Intergenic
924456571 1:244223433-244223455 ACTCTCATGCCCTTTGGCTTTGG + Intergenic
924494700 1:244575740-244575762 CCTCTCCTTCCCTTTCCCCTAGG + Intronic
924728924 1:246694567-246694589 CTGCTTTTGCCCTTTGCCTTGGG + Intergenic
1062999350 10:1900040-1900062 CCTTCCTTCCCCTCTGCCTTTGG - Intergenic
1063392645 10:5660347-5660369 CCTCTCTTGCCCCTTTGCTGGGG + Intronic
1064870316 10:19929775-19929797 ATTCTCTTGTCCTTTACCTTGGG - Intronic
1067527291 10:47046443-47046465 CCTCCCTTCCCCTGTGCCCTGGG + Intergenic
1068995992 10:63204828-63204850 CCTCTCCTTCACTTTGCCTCTGG + Intronic
1069867483 10:71512670-71512692 CCTCTCCTGCCCTTGGGCTGGGG + Intronic
1070418356 10:76211052-76211074 CCTGTCTTGTCCTTTGTCCTGGG + Intronic
1070853593 10:79587015-79587037 CATCTCAGGCCCTTTGCCATAGG + Intergenic
1070854407 10:79595029-79595051 CCACTCCTAACCTTTGCCTTTGG - Intergenic
1070858256 10:79627321-79627343 CATCTCAGGCCCTTTGCCATAGG - Intergenic
1071012447 10:80954051-80954073 CCTCTGTTACCATTTGCCTCTGG + Intergenic
1072487821 10:95873383-95873405 CTTGCCTTGCCCTCTGCCTTTGG + Exonic
1072636318 10:97180706-97180728 CATCTCTGCCCCTTTCCCTTGGG - Intronic
1072764096 10:98082055-98082077 CCTCCCTTGCCCTTGTCCTCGGG - Intergenic
1075722417 10:124595137-124595159 CCTCTGGTCCCCTCTGCCTTTGG + Intronic
1076731518 10:132441343-132441365 CCGCTCCTGCCCCATGCCTTTGG + Intergenic
1077802255 11:5551806-5551828 CCATTCTTGCCCATTGCTTTGGG - Intronic
1077870314 11:6257257-6257279 ACTCTTTTGACCTTTGCTTTTGG - Intergenic
1078803307 11:14669347-14669369 CCCCCCTTGCCCTCTGTCTTTGG - Intronic
1080721041 11:34848905-34848927 CCTCTTTTGCCTTCTGCCATTGG + Intergenic
1081302950 11:41475944-41475966 CCTTGCTTCCCCTTTGCCTTCGG - Intergenic
1081717512 11:45260895-45260917 CCCCTCTTGCCTTCTGCCCTGGG + Intronic
1081812210 11:45920430-45920452 CCTCTCTTCCCCTGTGACTTGGG - Intergenic
1082132521 11:48507100-48507122 CCTTGCTTTCCCTTTGCCTTCGG + Intergenic
1082565951 11:54677649-54677671 CCTTGCTTTCCCTTTGCCTTCGG + Intergenic
1082907946 11:58333083-58333105 TCTCTCTTGCTATTTTCCTTTGG + Intergenic
1083450536 11:62741738-62741760 CCTCTCCTGTCCTTGGACTTAGG - Intergenic
1083453691 11:62763627-62763649 ACTCTCTTGCCCTCTGAGTTAGG - Intronic
1083545008 11:63542534-63542556 CCTATCTTGCCCTATTTCTTTGG + Intronic
1083805067 11:65068443-65068465 CCTCCCCTGCCCACTGCCTTAGG + Intronic
1084015041 11:66373417-66373439 ACTCTCTTGTCCCTTGTCTTGGG - Intergenic
1084446885 11:69208982-69209004 CCCCTCTTGCCCTGTGTCTATGG - Intergenic
1084935673 11:72585335-72585357 CCTCTCTCGCCCTGTCCCCTGGG + Intronic
1085442164 11:76575179-76575201 ACTCTCAGGCCCTTTTCCTTGGG - Intergenic
1086064871 11:82733674-82733696 CCTTTCGTGCCCTTCGGCTTCGG - Exonic
1086238872 11:84664858-84664880 CCTCCATTGTCCTTTCCCTTAGG + Intronic
1086250094 11:84802414-84802436 TCTCTCTTGCCCTAATCCTTAGG - Intronic
1086772525 11:90785391-90785413 ACTCTCTTGGCCTTTGACTTTGG + Intergenic
1087521298 11:99240190-99240212 CCTCTTTTGGCTTTTGCCTGGGG + Intronic
1087710400 11:101543093-101543115 CATTTCTTGCCCTTTGTTTTGGG - Intronic
1088148087 11:106708464-106708486 CCTGTCTTGGCCTTTGTTTTGGG - Intronic
1088533229 11:110833061-110833083 CCTGACTTGCCCTTTCCATTCGG + Intergenic
1089131358 11:116214859-116214881 CTTCTCTTGCCCTTTCCCATTGG + Intergenic
1089362934 11:117902930-117902952 CTTACCTTGCCCTTGGCCTTTGG - Intronic
1089367215 11:117928279-117928301 CCTCCCTTGCCCTCTGCTCTGGG - Intronic
1089599627 11:119605388-119605410 CCTCTCCTGCCCTCTCCCTGTGG - Intergenic
1090437282 11:126697268-126697290 CCTCTATTGCCCTAGGCCCTGGG + Intronic
1090657935 11:128860041-128860063 CCTCTCTTGCGCAGTGCCCTCGG - Intronic
1090903025 11:131049072-131049094 CCATTCTTTCCCTTTGCATTGGG - Intergenic
1091047842 11:132340967-132340989 CCTCTCTTGCCCCTAGACTCTGG + Intergenic
1091766499 12:3123446-3123468 CCTCCCTTGCCCTTGGCCTGAGG + Intronic
1092103703 12:5905711-5905733 CCTCTCTGGCTCTGTGCCATTGG - Intronic
1092948938 12:13482416-13482438 CTTCTCTTGGCCTTGGACTTTGG + Intergenic
1093310591 12:17577567-17577589 GCTTGCTTCCCCTTTGCCTTCGG - Intergenic
1093377319 12:18446304-18446326 TCTCTCTTGCCCCTGGCTTTTGG + Intronic
1093488924 12:19682636-19682658 CTTCTCTTCCTCTTTGCCTGGGG + Intronic
1093883381 12:24432003-24432025 CCACTCTTTCCATTTGGCTTAGG + Intergenic
1093898488 12:24603476-24603498 ACTTTCTCTCCCTTTGCCTTAGG - Intergenic
1094098227 12:26732037-26732059 CCTCTCTTTACAGTTGCCTTAGG - Intronic
1094426044 12:30318294-30318316 TCTCTCTTCCCCTTAGCCTTTGG - Intergenic
1095429825 12:42121227-42121249 CTTCTCTTGGCCTTTGACTTTGG - Intronic
1096123178 12:49101885-49101907 CCTCACTGGCCCTGTGTCTTTGG + Intronic
1096541157 12:52308109-52308131 CATTTCTTGCCCCTTCCCTTGGG + Intronic
1096616622 12:52836680-52836702 ACTCTCTTGCCCCCTCCCTTTGG - Intergenic
1096664579 12:53154717-53154739 CCCATCTTGCCCTTGGCCTGGGG - Intergenic
1096684159 12:53276883-53276905 CCACTCTTGCTCCTTGCCCTAGG + Intronic
1096961577 12:55583649-55583671 CCTCTCAAGGCCTTTGGCTTTGG + Intergenic
1098213048 12:68186334-68186356 CCTCTCCTTCACTTTGCCCTGGG - Intergenic
1098496284 12:71139333-71139355 CCTGTCTTGCCCTTTGCTTCTGG + Intronic
1099860516 12:88220027-88220049 CCTCTCTTTACCTTTTCATTGGG - Intergenic
1100234228 12:92642568-92642590 CCTCTCTTGCTCCCAGCCTTAGG - Intergenic
1101715207 12:107305287-107305309 TCTCTCTTGCTCTTTTGCTTTGG + Intergenic
1105349001 13:19599647-19599669 CCTTTCTGACCCTTTGTCTTAGG + Intergenic
1105794237 13:23834409-23834431 CCTCTCCTGGGCTTTGCCTTCGG + Intronic
1106730049 13:32531978-32532000 TCTCTCTTGACCTTTGCTTTTGG + Intronic
1106907300 13:34422255-34422277 CCTCTCGTGCCCTTTCTCTCAGG + Intergenic
1107059973 13:36149557-36149579 CCTATGATGCCCTTTGCCATAGG - Intergenic
1107677583 13:42812827-42812849 CCTCTCTTGGGATTTGTCTTGGG + Intergenic
1107884832 13:44866541-44866563 ACTCCCTTGCCCCTTTCCTTTGG - Intergenic
1108742163 13:53349499-53349521 TCCCTCATGCCCTTTGTCTTAGG + Intergenic
1109223401 13:59663909-59663931 CCTCTCCTGCCCTTTCTCATCGG - Intergenic
1110006269 13:70275159-70275181 CCCCTCTTGACCTATGCTTTTGG + Intergenic
1111266327 13:85820090-85820112 CATCTCTATCCCTTTACCTTTGG + Intergenic
1112630736 13:101158790-101158812 CCTCTCTTGCGCTTTGGCAAAGG + Intronic
1113026417 13:105945982-105946004 CCTTTCTTGCCTTTTACCGTGGG - Intergenic
1114042644 14:18693134-18693156 TTTCCTTTGCCCTTTGCCTTTGG + Intergenic
1114391457 14:22312920-22312942 ACTCTTTTGCCCTCTGCCTTTGG - Intergenic
1114578388 14:23733969-23733991 AGTCTCTTGCCCTTTGCTTTTGG - Intergenic
1116390020 14:44380561-44380583 CCTCTATTGTCATTTGCCTCTGG + Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1116922438 14:50594137-50594159 GCCTTCTTCCCCTTTGCCTTCGG - Intronic
1117707888 14:58491662-58491684 CCTCAATGTCCCTTTGCCTTTGG - Intronic
1117739074 14:58797367-58797389 CATCTCTGGGCCTTTACCTTAGG - Intergenic
1118797205 14:69153614-69153636 CCTCTGCTGGCCTCTGCCTTGGG + Intergenic
1118969112 14:70617518-70617540 TCTCTCTTGCCTCTTGGCTTTGG - Intergenic
1119629583 14:76216199-76216221 CCTTTCTTGACCTTGGCCCTGGG + Intronic
1120008914 14:79390957-79390979 CCTCTCTTGCCCTTTGCCTTTGG + Intronic
1120056703 14:79932794-79932816 CCTTTCTTGCCCTTTCAGTTAGG + Intergenic
1120287073 14:82517269-82517291 CCTCTCTTTCACATTGCCTTGGG + Intergenic
1120314256 14:82871772-82871794 CCTCTGTTGTCATTTGCCTCTGG - Intergenic
1120972475 14:90219313-90219335 CCTCTCTTGCTGTCTTCCTTTGG - Intergenic
1121658188 14:95613931-95613953 CCTCACTAGCCCTGTGACTTTGG - Intergenic
1121867449 14:97376236-97376258 CTTGTTTTTCCCTTTGCCTTGGG - Intergenic
1121925955 14:97927550-97927572 CCTCTCTGGCTCTGTGTCTTGGG - Intronic
1121979764 14:98444416-98444438 TCTCTCTGTCTCTTTGCCTTGGG - Intergenic
1122319866 14:100848050-100848072 TCTCTCTTGCACTTTGTCTTCGG - Intergenic
1122901130 14:104782737-104782759 CCTCACGTGGCCTTTGTCTTCGG + Intronic
1124115589 15:26840090-26840112 CCTTTCTTGCCCTTTTGCTTTGG + Intronic
1124693123 15:31842383-31842405 CCTCTCTTTCCCTTAGTCCTTGG - Intronic
1124872157 15:33553903-33553925 CGTCTCTTGCCACTTGCCTGAGG + Intronic
1125125463 15:36214967-36214989 CCTCTCTTGCCCTTAGACATTGG + Intergenic
1126235720 15:46381978-46382000 CTTCCCTTGCCCTGTGACTTTGG - Intergenic
1126928242 15:53615790-53615812 TCTGTCTTGCCTTTTGCCATGGG - Exonic
1127713157 15:61621319-61621341 CCTCTCCCACACTTTGCCTTAGG + Intergenic
1128037809 15:64541874-64541896 CTTCTCTTGCCCTTCCCTTTTGG + Intronic
1128051540 15:64669066-64669088 TACCTCTTGCCCTTTTCCTTTGG - Intronic
1128455337 15:67828530-67828552 CCTCTCTTCTCCTCTTCCTTGGG - Intronic
1128751118 15:70149885-70149907 CCTCCCTTGCACCTTTCCTTAGG - Intergenic
1128806563 15:70535617-70535639 CCTCTCTTTCCCATTGGCTGGGG + Intergenic
1128950898 15:71880447-71880469 CTTCGCTTGCGCTTAGCCTTTGG + Exonic
1130176279 15:81574592-81574614 CCTCTCCAGCCCTTGGCCTCTGG + Intergenic
1130720121 15:86378394-86378416 CCTCTCTTGCCACTTTCTTTTGG + Intronic
1131532473 15:93205531-93205553 CCTCTCTTCAGTTTTGCCTTCGG + Intergenic
1132143059 15:99410501-99410523 ACTCTATGGGCCTTTGCCTTAGG - Intergenic
1132230772 15:100182207-100182229 CCTTGCTTCCCCTTTGCCTTTGG - Intronic
1132608338 16:802747-802769 CTCCTCCTGCCCTTGGCCTTGGG - Intergenic
1132675014 16:1117965-1117987 CCTCCCTTGCTCTTGGCCTTGGG - Intergenic
1133115570 16:3576312-3576334 CCTCTCCTGCCCACAGCCTTGGG - Intronic
1133221255 16:4320067-4320089 CTCCTCGTGCCCTTTGTCTTCGG + Intronic
1134072667 16:11270351-11270373 CCTGTCTTGGCCGATGCCTTTGG + Intronic
1134331503 16:13255376-13255398 TCTCTCTTGCCCTCTATCTTTGG + Intergenic
1135698372 16:24610299-24610321 CCCCTCCTCTCCTTTGCCTTTGG + Intergenic
1136124115 16:28164165-28164187 GCTCTCCTGCCCTGTGTCTTAGG - Intronic
1136670165 16:31849454-31849476 CCTCTCTTTCCCCTTCCCCTAGG - Intergenic
1136881530 16:33905735-33905757 GCCCCCTTGCCCTTAGCCTTCGG - Intergenic
1137722098 16:50633413-50633435 ACACTCTTGCCCTGGGCCTTGGG - Exonic
1138001133 16:53281068-53281090 GCTCTCTTACCTTTTTCCTTAGG + Intronic
1138537713 16:57668559-57668581 CTTCTCTAGCCCTGTCCCTTTGG + Intronic
1138898398 16:61238308-61238330 GCTCACTTGCCCTTTCCCCTTGG - Intergenic
1139321050 16:66114394-66114416 CCAGTCTGGCCCTTTGCCCTGGG - Intergenic
1139350578 16:66332576-66332598 TCTCTCTGGCCCTTTGGTTTAGG - Intergenic
1140893288 16:79303491-79303513 TCTCTCTTGCCTTTGACCTTAGG + Intergenic
1203090484 16_KI270728v1_random:1209711-1209733 GCCCCCTTGCCCTTAGCCTTCGG + Intergenic
1143210033 17:5179214-5179236 CCTCTCTCTCTCTGTGCCTTGGG + Intergenic
1143467311 17:7146142-7146164 CCTCTCTTTTCCTTGGGCTTGGG - Intergenic
1144419740 17:15085362-15085384 TCTCTCTTGCTTTTTGGCTTTGG - Intergenic
1145116660 17:20216615-20216637 CCTCTGCTGCCATATGCCTTGGG + Intronic
1145339858 17:21944792-21944814 CCTTTCTAGCCCTTTACATTTGG - Intergenic
1145865696 17:28240250-28240272 CCTCTCTCCCTCTTGGCCTTGGG - Intergenic
1146039199 17:29434782-29434804 CCTCTGTTGTCATTTGCCTCTGG + Intronic
1146466982 17:33094163-33094185 ACTCTGTTGCCCTCTGGCTTGGG + Intronic
1147878162 17:43636390-43636412 CCCCTCTAGGCCTTTTCCTTTGG + Intergenic
1149025635 17:52024540-52024562 CCTCTGCTTCCCTTTGGCTTGGG - Intronic
1149335663 17:55633195-55633217 CCTCTCTTACTCTTGGGCTTTGG - Intergenic
1149578139 17:57728399-57728421 CTGCTTTTGCCCTCTGCCTTAGG - Intergenic
1149640290 17:58198559-58198581 CCTCTCTTCCTCTTTCCCTCTGG + Intronic
1150212217 17:63447377-63447399 CCTATCTTGCCCACTGCCTGTGG - Intergenic
1150352746 17:64458601-64458623 CCTCTCTTGCCCTGAGCCAAGGG - Intronic
1151169651 17:72235984-72236006 CCTTTCTTGCTACTTGCCTTGGG - Intergenic
1151227314 17:72656698-72656720 CTTCTCTTTTCCTTTTCCTTAGG + Intronic
1152113362 17:78369717-78369739 CCTTCCTTGCCCTTTAGCTTGGG - Intergenic
1152198090 17:78929292-78929314 CCTCTCTTGCCCTGGGCATGGGG - Intergenic
1152984917 18:312530-312552 ACTTTCCTGCCCTTTGACTTGGG - Intergenic
1153018810 18:608147-608169 CCTGTCTTGCTCTGTGCCTTTGG + Intronic
1153741181 18:8130252-8130274 CCTCTCCTCCCCTTTTCCTAAGG - Intronic
1154112300 18:11580430-11580452 CCACACTTGTCCTCTGCCTTTGG + Intergenic
1154336220 18:13467073-13467095 CCTCTCTTGTTCCTTGTCTTAGG - Intronic
1154412393 18:14148463-14148485 CCTCTCTTGGCCTCTGCTTCGGG + Intergenic
1155285725 18:24287336-24287358 CCTCTCTTGACCTTGGCCATAGG - Intronic
1155677092 18:28441963-28441985 CATCTCTTGCTCTTTGATTTTGG + Intergenic
1155784626 18:29880865-29880887 CCTCTGTTGCCATCTGCCTCTGG + Intergenic
1156026124 18:32656545-32656567 CCTCTCTTACCCTTAACCCTCGG - Intergenic
1156698562 18:39796461-39796483 CCTCTGTTGTCATTTGCCTCTGG + Intergenic
1157724278 18:49951845-49951867 ACTCTCTTTCCCTGTGCCTTGGG + Intronic
1157979404 18:52363486-52363508 CCTCTCTTGCTCTTTGCTTCTGG + Intronic
1159053155 18:63440531-63440553 CTTTTCTTTCCCTTTCCCTTGGG + Intergenic
1159452742 18:68623541-68623563 CCCCTCTTGGCCTTTGCAGTGGG + Intergenic
1159587627 18:70296386-70296408 CCTCCCTTGGCCTCTTCCTTTGG + Intronic
1159648259 18:70944856-70944878 CCTTTCTTTCCCTTGACCTTTGG - Intergenic
1161414034 19:4134679-4134701 CCTCTCTTGCTCTCAGCCTGTGG + Intergenic
1162331832 19:10034687-10034709 GCCCTGATGCCCTTTGCCTTTGG + Intergenic
1162922152 19:13909603-13909625 GGTCTCTTGCCCTTTGCCCCAGG + Intronic
1163976620 19:20858845-20858867 CCTCTCCTTCCCTTTCCCCTAGG - Intronic
1166141733 19:40808785-40808807 GCTTTCATGCCCTTTGCCTCAGG - Intronic
1166830871 19:45639050-45639072 CCTCTCTGGGCCTGTGTCTTAGG - Intronic
1167167714 19:47810657-47810679 CCTCTTTTACCCTATGCCTGTGG + Intronic
1167268830 19:48497217-48497239 CCTCTCTAGCTCTTTGGCCTTGG - Intronic
1167568425 19:50271684-50271706 CCTCTCCTTCCCATTCCCTTGGG - Intronic
1167682177 19:50930522-50930544 CCTCTCTTCCCCCATGCCTTGGG - Intergenic
1168600906 19:57717939-57717961 CCTCTCTTGCCTCTTGCTTCAGG + Intronic
925223998 2:2166598-2166620 CCTCACTGGCCCTTTGTTTTAGG - Intronic
926307192 2:11646846-11646868 CCTCACTTACCCTTTGCCATGGG - Intergenic
927085618 2:19671876-19671898 CCTCTCTAGCTGGTTGCCTTGGG + Intergenic
928116625 2:28549783-28549805 TCTCTCTTGCTCTTTACCCTGGG - Intronic
930100780 2:47601238-47601260 CCTGTGTTGCCCTTTGACCTAGG + Intergenic
930670569 2:54146045-54146067 CCTCTCATGCACCTTTCCTTCGG - Intronic
931234246 2:60399931-60399953 CGTCTCTTGGTCTTTGCCTGTGG - Intergenic
931694625 2:64862462-64862484 ACTTTCTTGCCCCTTGACTTTGG + Intergenic
931996993 2:67848193-67848215 ACCCTCTTGACATTTGCCTTTGG - Intergenic
933373621 2:81449980-81450002 CTTCCCTTGCCTTTTGCATTTGG - Intergenic
934513733 2:94970519-94970541 CCTCACTGGACCTCTGCCTTGGG + Intergenic
936341731 2:111639771-111639793 CCTCTCTTCCTCTTCGCCTTTGG + Intergenic
936629571 2:114187182-114187204 CCTCTCTTCCTCTTTTCCTGAGG - Intergenic
937624704 2:124030593-124030615 ACTCTCATGCCCTTTGCCATGGG - Intronic
937934633 2:127232929-127232951 CCTGTCTTGCACCTGGCCTTGGG - Intergenic
938081863 2:128374455-128374477 CCTCTCTGGCTCTCTGCTTTTGG + Intergenic
938267525 2:129939111-129939133 TTTCCTTTGCCCTTTGCCTTTGG - Intergenic
939374326 2:141344424-141344446 CCTCTCTTGGCCTTTGGCGTAGG + Intronic
939939938 2:148337105-148337127 CCTTTCTTAGCCTTTGTCTTTGG + Intronic
941253768 2:163201242-163201264 ACTCACTTGCCCATTGCTTTTGG - Intergenic
941718280 2:168786656-168786678 GCTGGCTTGACCTTTGCCTTAGG - Intronic
942383532 2:175418642-175418664 CCCCTCTTGCCTCTGGCCTTGGG - Intergenic
943683115 2:190788742-190788764 CCTCTCCTGCCCTCTCACTTTGG - Intergenic
945611522 2:212010578-212010600 CTGCTTTTGCCCTTTGCCTTGGG - Intronic
945931054 2:215855017-215855039 CCTCTCTGCCCCTGTGGCTTTGG - Intergenic
947527678 2:230889184-230889206 CCTTGCTTCCCCTTCGCCTTCGG - Intergenic
947894323 2:233655478-233655500 CTTCTCTTGTCTTCTGCCTTAGG + Intronic
948019928 2:234723703-234723725 CCTCTCTTGGGGTTTGGCTTGGG - Intergenic
948055343 2:235006256-235006278 TCTTTCCTGCCCTTTTCCTTTGG + Intronic
948229973 2:236342389-236342411 CCTCTGCTGCCCTTGGCTTTTGG + Intronic
948570464 2:238914239-238914261 CCTCTTAAGCCCTTTGGCTTGGG + Intergenic
948760862 2:240190148-240190170 CCCATCTTGACCTTTCCCTTTGG - Intergenic
949022321 2:241748627-241748649 CCCCTCTCGCCCATTGCCTCCGG + Intronic
1169816248 20:9659955-9659977 CCATTCTTGCCCTTTCCCTTTGG - Intronic
1169941139 20:10938599-10938621 CCTCTCTTGCCATTTTCTGTTGG + Intergenic
1170847090 20:19971467-19971489 CGTCTTTTCCCCATTGCCTTGGG + Intronic
1171354636 20:24534457-24534479 CCTCTGCTGGCCTTTGCCTCAGG + Intronic
1171990016 20:31688960-31688982 CATCTCTGACCCTTTGTCTTTGG + Intronic
1172175033 20:32966960-32966982 CCCCCTTTGCCCTATGCCTTAGG - Intergenic
1172447907 20:35002738-35002760 CCTCCCTTGTCCCTGGCCTTTGG - Exonic
1172753269 20:37266098-37266120 CCACTCTTGCCCCCTGCCCTAGG + Intergenic
1173159917 20:40644758-40644780 CCTCCCTTTCCATTTGCTTTTGG - Intergenic
1173684864 20:44916172-44916194 ACCCTTTTGCCCATTGCCTTAGG + Intronic
1173796783 20:45866429-45866451 CCCCCCTTGCCCTTGACCTTGGG + Intronic
1173804693 20:45916624-45916646 CCTCTCTTGCCCTTTGCATTCGG + Intergenic
1174261543 20:49299268-49299290 CCTTTCTTCCCCTTTACCATAGG + Intergenic
1174380429 20:50152626-50152648 CCTCTCTGTCCCTTTCCCTCAGG - Intronic
1174384758 20:50180631-50180653 CCTCTCTTGCCCTTTCCATGTGG - Intergenic
1174919020 20:54682505-54682527 CATTTCTTGCCCTTCGCCATTGG + Intergenic
1175231028 20:57473419-57473441 CCTCTCTTCCTCTCTGCCTGCGG + Intergenic
1175373864 20:58511315-58511337 CTTCTCCTTCCCTTTGCATTGGG + Intronic
1175988337 20:62775488-62775510 TCTCTGTTGCCCTTGTCCTTGGG - Intergenic
1176306552 21:5126571-5126593 CTTCTGTTGCCCTTGCCCTTGGG - Intronic
1176860610 21:14009794-14009816 CCTCTCTTGGCCTCTGCTTCGGG - Intergenic
1177138670 21:17334113-17334135 CCCCGCTTTCCCATTGCCTTGGG + Intergenic
1178525546 21:33325319-33325341 CCTCTCTTGCCGCTTGCCTGTGG + Intronic
1178741492 21:35206298-35206320 CCTGGCTTTCCATTTGCCTTGGG + Intronic
1178898419 21:36579814-36579836 TCTCTCTTGCCCTTTGTCCATGG - Intergenic
1179097675 21:38330088-38330110 GCTCTCTTGTCCTCTGCCTGGGG - Intergenic
1179576725 21:42312726-42312748 CCTCTCTTGCCCTTTGTCCTAGG - Intronic
1179850507 21:44135459-44135481 CTTCTGTTGCCCTTGCCCTTGGG + Intronic
1179948781 21:44698080-44698102 CCTCTCTTCCCCTAAGCCCTGGG + Intronic
1180340976 22:11618353-11618375 CCTCTCTCACTCTTTGCCTAGGG + Intergenic
1181469736 22:23130737-23130759 CCTCTCCTGCCCAGTGCCTCTGG - Intronic
1182182875 22:28370042-28370064 ACTCTCTTGCTCTGTGGCTTTGG + Intronic
1182772240 22:32803879-32803901 TCCCCCTTGCCCTTTGCTTTGGG + Intronic
1183096757 22:35556733-35556755 ACTCTCTTCCCCTATCCCTTCGG - Intergenic
1183096942 22:35557973-35557995 ACTCTCTTCCCCTATCCCTTCGG + Intergenic
1184597714 22:45524344-45524366 CCTCTCCTGCTCATTGCCTTTGG + Intronic
1184684504 22:46090055-46090077 CTTCTCTTCCCCTTTCCCTGGGG - Intronic
1184750578 22:46484136-46484158 CTTCTCTTGCCCTGTACCCTTGG - Intronic
1185157110 22:49199792-49199814 ACTCTCTTCCCCTTTGCCCTGGG + Intergenic
1185365882 22:50436525-50436547 CCTCCCTTGGCCTCTGCCTCAGG - Intronic
949252883 3:2008577-2008599 CCTCTCTTGGTCTTTTGCTTTGG - Intergenic
950481657 3:13247964-13247986 CCTCTCCTGCCTTGTGCCTGTGG + Intergenic
950777448 3:15362881-15362903 CCTTTCTAGCCCTATGCCCTTGG - Intergenic
951246000 3:20342306-20342328 CCTGCCTTACCCTTTGCCTTAGG + Intergenic
951246818 3:20350627-20350649 CCTTTCTTGCCCTTGGACATTGG + Intergenic
951774347 3:26292611-26292633 CTACTCATGCCCTTTGGCTTTGG - Intergenic
951993661 3:28703487-28703509 CCTTTCTTGACTTTGGCCTTTGG + Intergenic
952193267 3:31046403-31046425 CCTCTGTTGTCATTTGCCTCTGG - Intergenic
952307173 3:32156537-32156559 CCTCTCTTGCCCTCTCCCACGGG - Intronic
952416655 3:33096461-33096483 CGTCGCCTGCCCTTTGGCTTGGG - Intronic
953156650 3:40381248-40381270 CATCTCCTGCCTTTTGGCTTGGG + Intergenic
953876724 3:46670900-46670922 CCTGTCCTGCCCCTTGCCTTGGG + Exonic
954698668 3:52440649-52440671 TCTCTCTTTGCCTTTGCCTTGGG - Intronic
954826701 3:53379871-53379893 CCGCTCCTGCCACTTGCCTTGGG - Intergenic
955360715 3:58272100-58272122 CCTCTCTCTCCCTCTCCCTTTGG + Intronic
955445067 3:59001131-59001153 CCTTTCTTTCTCTTTCCCTTTGG - Intronic
956541288 3:70342829-70342851 TCTCCCTTGCCCTTTTTCTTTGG + Intergenic
957598928 3:82306594-82306616 CCTCTTCTGGCCTTTGCCTGTGG - Intergenic
958065884 3:88544587-88544609 GCTCTGTTTCCCTTTCCCTTTGG - Intergenic
958450433 3:94266464-94266486 CATCTTTGGCCCTTTGCATTGGG - Intergenic
958816261 3:98919562-98919584 CCTTCCTTTCTCTTTGCCTTAGG - Intergenic
959497806 3:107071853-107071875 CCTCTCTTTTCCTCTGCCATAGG + Intergenic
959826537 3:110803680-110803702 CTTCTCTTGCCCTCTGACATTGG - Intergenic
960027062 3:113021336-113021358 GCTCTCTTGCCCTCTAACTTTGG - Intergenic
960816303 3:121676700-121676722 CATTTCTTGTCCTTTGCCCTTGG - Intronic
962370769 3:134819261-134819283 CCTCCCTCTCCCTATGCCTTAGG + Intronic
963530359 3:146467501-146467523 CCTTTCATGCTCTATGCCTTTGG - Intronic
963540701 3:146583952-146583974 CTTCTCTTGTCCTTTACTTTTGG - Intronic
963690421 3:148493432-148493454 GCTCTCTTGCCTTCTGCCATGGG + Intergenic
964980231 3:162669357-162669379 CCTCTGTTGCCATTTGCCTCTGG - Intergenic
966314015 3:178625246-178625268 CCTCTCTCTGCCTTTTCCTTGGG - Intronic
966671910 3:182536794-182536816 CCTCAATTGTCCTTTGTCTTGGG - Intergenic
967512973 3:190334582-190334604 TCTCTCTTGCTCTCTGGCTTTGG + Intronic
967863006 3:194166973-194166995 CCCCTGTTGCCATCTGCCTTTGG - Intergenic
968536792 4:1136187-1136209 CCTCTCTTCCCCTTGGCCTCTGG - Intergenic
969516948 4:7653151-7653173 CCTCTCCAGCCCTGTGCCCTCGG - Intronic
969947003 4:10793638-10793660 CTTGGCTTGGCCTTTGCCTTTGG - Intergenic
970264943 4:14271866-14271888 CAGCTCTTGTCCTTTGCCTCTGG - Intergenic
970883374 4:20958376-20958398 TTTCTATTGCCCTTTGACTTTGG - Intronic
971485110 4:27151351-27151373 CCTCTCTTGTTCTTTGTGTTTGG + Intergenic
971805239 4:31350300-31350322 ACTCTGTTGGCCTTTGCCATAGG + Intergenic
972575343 4:40346104-40346126 GTTCCCTTGCCCTTTGGCTTGGG + Intronic
974535358 4:63167408-63167430 CTTCTCTTCCCCTTTCCCCTGGG + Intergenic
974776257 4:66486328-66486350 CCTATTTTGACCTTTGCCTGTGG - Intergenic
975043901 4:69778894-69778916 CCTCCCTTCCCCTTAGCCCTTGG - Intronic
975051055 4:69865532-69865554 CTTCTCTTGCCCTTGGACATAGG + Intergenic
975955174 4:79828121-79828143 ACTCTCTTGCCACTTGACTTCGG - Intergenic
976345254 4:83993050-83993072 CCTCTGTTGTCATTTGCCTCTGG - Intergenic
976871902 4:89804572-89804594 CCTCACTAGCCCTGTGACTTTGG + Intronic
979234099 4:118379978-118380000 CTTCTCTTGCTCTCTACCTTTGG + Intergenic
980656312 4:135792005-135792027 CCTCTTTCACCCTTTGCCTCAGG + Intergenic
981798126 4:148622418-148622440 CCTCTCTTGCTTTATTCCTTTGG - Intergenic
983288165 4:165765803-165765825 CCTATTTTCCCCTTTACCTTGGG - Intergenic
983515840 4:168655785-168655807 CATCTCCTGTCCTTTGACTTTGG + Intronic
984214216 4:176888054-176888076 CCTTGCTTCCCTTTTGCCTTCGG + Intergenic
984511073 4:180679394-180679416 CCTCTCTTGCTTTCTGCTTTAGG - Intergenic
984648690 4:182246247-182246269 TCTTTCTTCCCCTATGCCTTGGG - Intronic
985780917 5:1871409-1871431 CCTGTCCTGCCATTTGCCCTGGG + Intergenic
986326478 5:6679022-6679044 CCTCTTTTGCACATGGCCTTTGG - Intergenic
987472141 5:18345320-18345342 ACTCTCTTGCCTTCTGCCATGGG - Intergenic
987620238 5:20330772-20330794 CCTGGCTTGACCTTTGACTTGGG - Intronic
988601621 5:32645329-32645351 CCTGTCTAGCCCTTGGCCTGGGG - Intergenic
990176803 5:53116778-53116800 ACTCTTTTGCTCTTTGCCTCTGG - Intergenic
990872990 5:60454152-60454174 ACTCTCTAGCTCTTTGACTTCGG + Intronic
991411354 5:66348521-66348543 CCTCCCTTGCAGATTGCCTTTGG + Intergenic
992429258 5:76691707-76691729 CCTCCCTTCCCCCTAGCCTTTGG - Intronic
992737306 5:79735264-79735286 CCTTTCTTTCCCTTTTCCTCAGG - Exonic
992905814 5:81344787-81344809 CCTCTTTGGCTCTTTCCCTTTGG - Intronic
993598850 5:89894379-89894401 CTTCTCTTGCTGTTTTCCTTTGG - Intergenic
994627188 5:102234904-102234926 CCTCTCTTGCCCTATTTCTTTGG + Exonic
995142400 5:108748827-108748849 CCGCTCTTGCCCATTGGCTGAGG + Intronic
995393587 5:111664363-111664385 CCTCTGTTGTCATTTGCCTCTGG + Intronic
995761150 5:115563625-115563647 CTTCTCATACCCTTTGCCTGAGG + Intergenic
995896981 5:117025877-117025899 CATTTCTTCCCCTTTGCTTTTGG - Intergenic
996796095 5:127350130-127350152 ACTCTCTTCCACTTTGCCTTTGG + Intronic
996796252 5:127351767-127351789 ACTCTCTTCCACCTTGCCTTTGG - Intronic
998471428 5:142386810-142386832 CCTCTCTTGGCCTCTGTCTCTGG - Intergenic
999022069 5:148177450-148177472 TCTCTCTCTCCCTCTGCCTTTGG + Intergenic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1000016866 5:157285544-157285566 CCTCCCCTTCCCTCTGCCTTAGG - Intronic
1000793669 5:165638058-165638080 CCTTTCTTGCTCTTTGCCCTTGG - Intergenic
1001265725 5:170273246-170273268 CCTCTCTTGTGCTGTGCCTGAGG - Intronic
1002136371 5:177110306-177110328 CCTGTCTTGTCACTTGCCTTAGG - Intergenic
1002831157 6:822343-822365 CCTCTCTTTCCGTTTCCCTAAGG + Intergenic
1003025650 6:2553088-2553110 CCACTTTTTCCCTTTGCTTTTGG - Intergenic
1003261796 6:4524054-4524076 CCTCTGTTGTTGTTTGCCTTTGG - Intergenic
1003350225 6:5309789-5309811 ACTCTGTTGCCCTTTGAATTAGG - Intronic
1003387379 6:5681647-5681669 CCTTTCTTCCCCTCTGACTTTGG + Intronic
1004100235 6:12602170-12602192 CCTGTCCTGGCCTGTGCCTTTGG - Intergenic
1004260958 6:14107309-14107331 CCTCTCTTGGACTCTGCCCTAGG + Intergenic
1005020938 6:21418235-21418257 CTTCTCTTGCCCTTGGACTACGG - Intergenic
1005316112 6:24604297-24604319 CTTCTCTTGCCCTTTGGTTAGGG - Intronic
1005991548 6:30905982-30906004 CCTCTCTTCCCCTCTCCTTTTGG + Intergenic
1006016037 6:31081740-31081762 CCTCCCTTGCCCCTTTCCTTAGG + Intergenic
1006374181 6:33662787-33662809 CCTCTCTGGCCTTTTGACTCTGG - Intronic
1007227386 6:40324748-40324770 CCTATCTTACCATTTGCCTTGGG + Intergenic
1007260689 6:40561148-40561170 TCTCAGTTGCCCTTTCCCTTGGG - Intronic
1007943419 6:45803457-45803479 CTTCTCTTGGCCTTCACCTTGGG + Intergenic
1008425343 6:51349937-51349959 CCTCTCTTTCCCTTATCCCTTGG + Intergenic
1008632513 6:53376759-53376781 ACTCTCTTGCCTTTTGTCTCAGG + Intergenic
1009399526 6:63237853-63237875 GCTCTTTTGCCTTTTGCCATGGG - Intergenic
1009659187 6:66588024-66588046 CCTCTCTGTTCCTTTGTCTTTGG + Intergenic
1010049132 6:71482742-71482764 ACTCTCTTTCCCTTTCCTTTTGG - Intergenic
1010403655 6:75477749-75477771 CCTCTCTTCGCCTTTTCCTCTGG - Intronic
1014110869 6:117617396-117617418 CCTCTCTTTCCCCTTCCCCTAGG - Intergenic
1014316767 6:119876577-119876599 CTTCTCTTGCCCTTGGACATTGG + Intergenic
1014988123 6:128037089-128037111 CCTCCCTCGCCTTTTTCCTTTGG + Intronic
1015148769 6:130016987-130017009 CTTCTCCTGCAGTTTGCCTTTGG + Intronic
1015926410 6:138314171-138314193 GCTCTCTTGCCCTTCCTCTTGGG - Intronic
1017423347 6:154295750-154295772 CCTCTCTTGCCCAGGGCTTTGGG + Intronic
1018000069 6:159571078-159571100 CCTCTGTTGCCCATAGACTTTGG + Intergenic
1018476779 6:164150579-164150601 CCTCTCTTTCCCTTTTGCTTAGG + Intergenic
1019054753 6:169215045-169215067 CCTCTCTTCCCCTTTCTCTCTGG + Intergenic
1019054765 6:169215092-169215114 CCTCTCTTCCCCTTTCTCTCTGG + Intergenic
1019054777 6:169215139-169215161 CCTCTCTTCCCCTTTCTCTCTGG + Intergenic
1019224778 6:170500848-170500870 CCTCTCATTCCCTTTGGCTCTGG - Intergenic
1019224874 6:170501313-170501335 CCTCTCATTCCCTTTGGCTCTGG - Intergenic
1019660581 7:2221570-2221592 CCTCTCCTGTCCTTTGTCTGTGG - Intronic
1021598930 7:22344601-22344623 ACTCTGTTGCCCTCTGGCTTAGG - Intronic
1022318776 7:29268421-29268443 CTTCTCTTGATCTTTGCATTTGG + Intronic
1022833678 7:34093556-34093578 CTGGTCTTGCCCTCTGCCTTTGG - Intronic
1024262196 7:47581406-47581428 CGTCTCTTTCCCTTTCCCTTTGG - Intronic
1027134136 7:75612146-75612168 CTTCTCTGGCCCCTTGCCTGGGG - Intronic
1027523904 7:79243981-79244003 CCTCTGTAGCCCTCAGCCTTTGG + Intronic
1028154211 7:87410937-87410959 CTTCTCTTGCCTTTAGGCTTAGG + Intronic
1030969778 7:116041897-116041919 CATCTCTCGCCCTTTGTTTTGGG - Intronic
1031146779 7:118005482-118005504 CCTCTCTTGCCCTGGACTTTAGG + Intergenic
1032345339 7:131110944-131110966 CCTCCCTTGCCCTTTGCCACAGG + Intronic
1032568566 7:132974565-132974587 CTTTTTTTGTCCTTTGCCTTTGG - Intronic
1033616814 7:143024288-143024310 CCTCTCTTGCCCTCTCACTCTGG + Intergenic
1033671774 7:143500026-143500048 CATCTCTTGGCCTTTGGCGTGGG - Intergenic
1034295635 7:149969846-149969868 CCCCTCTTCTTCTTTGCCTTTGG - Intergenic
1034810425 7:154127059-154127081 CCCCTCTTCTTCTTTGCCTTTGG + Intronic
1035816777 8:2549896-2549918 CTTCCCTTGCACTCTGCCTTGGG - Intergenic
1036042882 8:5105961-5105983 CCAATCTTGCCCTTTGTCTCTGG + Intergenic
1038054229 8:23843117-23843139 CCTCTCTTGACATTGACCTTTGG + Exonic
1038412702 8:27370517-27370539 CCTCTCTTGTCCCTTACCTGTGG + Intronic
1038469170 8:27797634-27797656 CCTCTCTTGCTGTCTTCCTTGGG + Intronic
1038815816 8:30902959-30902981 CCTCTCTTGCCTTTTCCCTGAGG - Intergenic
1039467511 8:37795246-37795268 CTTCTCTTGCCCGTTGGCGTTGG - Intronic
1042541817 8:69915109-69915131 ACTCTCTTGCCTTGTGCCTTGGG - Intergenic
1044422745 8:92016684-92016706 CCTTTCTTGCCCTTTTTTTTGGG - Intronic
1046339134 8:112828512-112828534 CCTGGCTTCCCCTTTGCTTTCGG + Intronic
1047338544 8:123958322-123958344 GGTCTCTTACCCTCTGCCTTTGG + Intronic
1048457723 8:134593058-134593080 CCTCCTCTGCCCTTGGCCTTGGG + Intronic
1048993995 8:139778070-139778092 TGTTTCTTGCCCTTAGCCTTGGG - Intronic
1051098563 9:13494897-13494919 CCTCTCTGCCCCTCTGACTTAGG - Intergenic
1051608435 9:18938999-18939021 CCTCTCTTCCACCTTGCCCTAGG - Intronic
1052127413 9:24794427-24794449 CCTCTCTTGCCCTTCTGCCTTGG + Intergenic
1053107927 9:35428862-35428884 CCTCTCTTGCTGTCTTCCTTTGG - Intergenic
1055725804 9:79227380-79227402 CCTCCCTTACCCTTTGATTTTGG + Intergenic
1056090114 9:83197030-83197052 TCTGTCTTGGCCTTTGCCATGGG - Intergenic
1056246208 9:84697639-84697661 CCTCTCCTGCTCTCTGCCTCAGG - Intronic
1056930697 9:90874214-90874236 ACTCTCTTGCCGGTTCCCTTGGG - Exonic
1057332737 9:94130760-94130782 GCTCTCTTCCCCTTTGCCTTTGG + Intergenic
1058372398 9:104285009-104285031 CATCCCTTGCCCTTGGCCATGGG - Intergenic
1059372448 9:113853492-113853514 GGTCTATTGCCCTTTGACTTGGG - Intergenic
1059779805 9:117514530-117514552 CCTCTAGTGCCAGTTGCCTTGGG + Intergenic
1059871615 9:118584526-118584548 CCTGTCTTGGCATTTGCTTTGGG - Intergenic
1059901425 9:118930597-118930619 CCTCATTTGACCTTTGACTTGGG - Intergenic
1060010673 9:120040616-120040638 CCTCACTTTCCTTATGCCTTAGG + Intergenic
1060258146 9:122050742-122050764 CCTCACTCCCCCTTTGCTTTGGG + Intronic
1060718464 9:125956702-125956724 CTTCCATGGCCCTTTGCCTTGGG + Intronic
1060867062 9:127008874-127008896 CTTCTCTTCCTCTTTTCCTTCGG + Intronic
1060969705 9:127731084-127731106 CCTTTCTGGGCCTCTGCCTTGGG - Exonic
1185743229 X:2550700-2550722 TCTCTCTGACCCTTTGGCTTCGG - Intergenic
1185865560 X:3620730-3620752 CCTCTCTTGCCCTAAGCCAGCGG - Intronic
1186283878 X:8023540-8023562 CCTCTCTTGTCCTTGGACATTGG + Intergenic
1186526827 X:10256646-10256668 CAGCTCTTGCCCTCTCCCTTTGG + Intergenic
1186689846 X:11963764-11963786 TTGCTCTTGCCCTTTGCCTTAGG - Intergenic
1189153316 X:38729779-38729801 CCTCTGTTGTCATTTGCCTCTGG - Intergenic
1189462014 X:41250620-41250642 CCAGTCTTGTTCTTTGCCTTGGG + Intergenic
1190703489 X:53005904-53005926 CCCCTGTTGCCCTTTTCTTTTGG - Intergenic
1191178031 X:57527620-57527642 TCTTTCTTTCACTTTGCCTTTGG + Intergenic
1191729195 X:64315220-64315242 CCTCTCTTGCCATGGGCCTCTGG - Intronic
1192201295 X:69068381-69068403 TCTCCCTTGCCCTTTGACTCTGG - Intergenic
1192545503 X:72009371-72009393 GCTCCCTTGCCCTCTGGCTTCGG - Intergenic
1192585372 X:72314632-72314654 CCTCTCTTGGCCCTTAACTTTGG + Intergenic
1193842161 X:86419433-86419455 GCTCTCTTGCTTTTTGCCTGTGG - Intronic
1194027430 X:88770370-88770392 CCTCTGTTGTCATTTGCCTCTGG - Intergenic
1194066429 X:89267432-89267454 CCTCTGTTGTCATTTGCCTCTGG + Intergenic
1194532841 X:95072130-95072152 GCTCTATTGCCCTTTGTCTTTGG - Intergenic
1195009155 X:100718494-100718516 CCTCAGTTGCCCTTTGGTTTTGG - Intronic
1195720529 X:107863413-107863435 CCACTTTTGCACTTTTCCTTTGG + Intronic
1196395654 X:115259282-115259304 CCTCTCTTGGATTTGGCCTTAGG - Intergenic
1196693485 X:118585724-118585746 GTTCTATTGCCTTTTGCCTTTGG + Intronic
1198553811 X:137771948-137771970 CCTCTCTGGCCCCTTTCCTGTGG - Intergenic
1199312616 X:146338826-146338848 CCTTTCTTGCCTTTAGACTTGGG + Intergenic
1199541661 X:148964630-148964652 CCCCATTTACCCTTTGCCTTAGG - Intronic
1199802781 X:151268031-151268053 CCTCTCAGGCCCTTTGCTTTGGG - Intergenic
1200069307 X:153519889-153519911 CCTGGCATGCTCTTTGCCTTAGG - Intronic
1200720599 Y:6601553-6601575 CCTCTGTTGTCATTTGCCTCTGG + Intergenic
1200798142 Y:7360745-7360767 CCTCTCTTGCCCTAAGCCAGTGG + Intergenic
1200951582 Y:8903598-8903620 GCTCTCTTGTCCTATGCCCTGGG - Intergenic
1201586573 Y:15567660-15567682 CCTCGCTTGCCTTTTTCCTGTGG - Intergenic
1201726091 Y:17153621-17153643 CCTTTCTCCCCCTTTGCCATTGG - Intergenic