ID: 1120009969

View in Genome Browser
Species Human (GRCh38)
Location 14:79402673-79402695
Sequence GAGATCTAATTCTTCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120009969_1120009974 -3 Left 1120009969 14:79402673-79402695 CCACCATTGAAGAATTAGATCTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1120009974 14:79402693-79402715 CTCAAACTAAAGGGATTGTCGGG 0: 1
1: 0
2: 1
3: 6
4: 110
1120009969_1120009975 1 Left 1120009969 14:79402673-79402695 CCACCATTGAAGAATTAGATCTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1120009975 14:79402697-79402719 AACTAAAGGGATTGTCGGGATGG 0: 1
1: 0
2: 0
3: 5
4: 85
1120009969_1120009976 2 Left 1120009969 14:79402673-79402695 CCACCATTGAAGAATTAGATCTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1120009976 14:79402698-79402720 ACTAAAGGGATTGTCGGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1120009969_1120009973 -4 Left 1120009969 14:79402673-79402695 CCACCATTGAAGAATTAGATCTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1120009973 14:79402692-79402714 TCTCAAACTAAAGGGATTGTCGG 0: 1
1: 0
2: 2
3: 23
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120009969 Original CRISPR GAGATCTAATTCTTCAATGG TGG (reversed) Intronic
901672660 1:10865491-10865513 GAGAGATAATTCTTCAATGTGGG + Intergenic
903985604 1:27225759-27225781 CAGATCTAACTCTTCTAGGGGGG + Intergenic
905965773 1:42093954-42093976 GACATCTAATTGTTAAAAGGAGG - Intergenic
910924111 1:92380792-92380814 TAGATGTAATTCTTCAAGGAGGG - Exonic
912064759 1:105723419-105723441 GAGATTTAATCCTTCAATTCTGG + Intergenic
913299854 1:117359237-117359259 TAGATCTAATTCTAGAATAGAGG - Intergenic
913999118 1:143677713-143677735 CAGCTCTAATGCTTTAATGGTGG + Intergenic
915837501 1:159189105-159189127 ATGATCTGTTTCTTCAATGGTGG + Intronic
917232166 1:172849793-172849815 GAGTTATAATTTTGCAATGGTGG - Intergenic
918356593 1:183710705-183710727 GAGATCTGATACTTCAAAAGTGG - Intronic
918469663 1:184859056-184859078 GAGTTCTAATTCCTCTATGGAGG + Intronic
919106443 1:193157465-193157487 AAGCTCTAATTTTTAAATGGTGG - Intronic
919449755 1:197756608-197756630 TAAATCTAATTGTTTAATGGGGG - Intronic
920042817 1:203114169-203114191 GAGATCTAATCCTCTAAAGGTGG - Intronic
921090934 1:211842039-211842061 GGGATTTAAATCTTCAATGGAGG - Intergenic
921175341 1:212588377-212588399 GAGATGTGATTCTTTATTGGTGG - Intronic
922326152 1:224530275-224530297 GAGAAATAATTCCTGAATGGAGG - Intronic
923708561 1:236366624-236366646 TAGCTCTATTTCTTCAATGCAGG + Intronic
1068031294 10:51708578-51708600 GAGATCTGATCCTTCAACAGAGG - Intronic
1075201634 10:120409409-120409431 GGGAGCTAATGCTTTAATGGGGG - Intergenic
1078820081 11:14869965-14869987 GAGCTCTTATTTTTCACTGGGGG + Exonic
1080052389 11:27870744-27870766 GGGATCTCATTTTTCAGTGGTGG - Intergenic
1081960872 11:47136330-47136352 GAGGTCTTGTTCTTCAAGGGAGG - Intronic
1084133928 11:67160465-67160487 AAGATCTATTTCTTAAATGAAGG - Intronic
1089767000 11:120775238-120775260 GAGTCCAGATTCTTCAATGGAGG - Intronic
1092646694 12:10582188-10582210 GAGATCTAATTTTTTGATGTAGG - Intergenic
1095406043 12:41868492-41868514 GAGATCTTATTCTAGAATAGAGG + Intergenic
1097639208 12:62159432-62159454 GAGTTGTAATTCCTAAATGGGGG - Intronic
1099469895 12:83034796-83034818 CAGATCCAATTCTAGAATGGAGG - Intronic
1107644852 13:42483295-42483317 GATTTCTATTTCTTCAATGGAGG + Intergenic
1108746108 13:53396330-53396352 GAGATCTAATTCTTCTACAATGG - Intergenic
1111812307 13:93106247-93106269 GATATCTTATCCTTGAATGGTGG + Intergenic
1112511593 13:100014259-100014281 GAGAACTAATTCATCCATGTGGG - Intergenic
1114493150 14:23115609-23115631 GAGATCTGAACCTTCAGTGGAGG - Intergenic
1116134816 14:40908903-40908925 GAATTCTAATTACTCAATGGAGG - Intergenic
1116549270 14:46214019-46214041 GAGATCTTATTTTTTAATGTAGG + Intergenic
1116784759 14:49275378-49275400 GGGCTTTAATTCTTCCATGGAGG - Intergenic
1120009969 14:79402673-79402695 GAGATCTAATTCTTCAATGGTGG - Intronic
1121543559 14:94746688-94746710 GACATCTTATTCTTAAATGGTGG + Intergenic
1121719490 14:96099235-96099257 GGCATCTAATTAATCAATGGAGG - Intergenic
1126309630 15:47300997-47301019 AAGATATAATTTTTCCATGGAGG - Intronic
1129710286 15:77817320-77817342 GAGATCTAAATGTGCACTGGGGG - Intronic
1129846839 15:78771706-78771728 GAGAAGTACTTCCTCAATGGTGG - Exonic
1130255062 15:82322185-82322207 GAGAAGTACTTCCTCAATGGTGG + Intergenic
1130599912 15:85267821-85267843 GAGAAGTACTTCCTCAATGGTGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149405231 17:56342405-56342427 GAGATCTAACTTCTTAATGGGGG + Intronic
1152776785 17:82206810-82206832 GAGTTATAATTTTGCAATGGTGG - Intronic
1156739072 18:40301805-40301827 GAGATCTATCTTTTCGATGGAGG + Intergenic
1156942006 18:42779239-42779261 GAGATGTAAATCTTCAACGCAGG + Intronic
1157508945 18:48254000-48254022 GAGATTCACTTCTTCTATGGGGG - Intronic
1158688848 18:59642396-59642418 GAGAACTATTTCTCCAGTGGTGG - Intronic
1158789359 18:60758075-60758097 GAGAACTATTTCTTCAAAGAGGG + Intergenic
1158970986 18:62666263-62666285 GAAATCTAATTCTTCAGGGAAGG - Intergenic
1159107244 18:64016381-64016403 ATGATATAATTCTTCAATGCAGG + Intergenic
1159740847 18:72168158-72168180 GAGGTCTAATATTTCAGTGGAGG + Intergenic
1163922203 19:20301094-20301116 GGGATATAAATCTTCAATGTTGG + Intergenic
1164084083 19:21886029-21886051 GAGATCTTTTTTATCAATGGGGG - Intergenic
926280727 2:11443661-11443683 GAGATCTAATGGTTTAATAGAGG - Intergenic
928955783 2:36865859-36865881 GAGATCTAATTTTTTGATGTGGG + Intronic
930341614 2:50123163-50123185 TAGCTTTAATTCTACAATGGAGG + Intronic
930530564 2:52583220-52583242 GAGATCTGATTGTTTAATAGTGG - Intergenic
930948631 2:57109123-57109145 GGGATTCAATACTTCAATGGAGG - Intergenic
934670508 2:96209234-96209256 CAGTTTTAATTCTGCAATGGCGG - Intergenic
935510655 2:103968601-103968623 GAGATCTTATTCTTTGCTGGTGG - Intergenic
936508293 2:113125586-113125608 GAGAGTTAATCCTTCAAAGGAGG - Intronic
944163560 2:196692434-196692456 GAGATCTAATTTTTTGATGTGGG + Intronic
945753344 2:213815512-213815534 GAGTTCAAATTCTCCAATTGTGG + Intronic
945930245 2:215847699-215847721 GAGATATAATTGTTAAAAGGGGG - Intergenic
1170035302 20:11983165-11983187 GTGATCTACTTCTTCATAGGTGG - Intergenic
1174111002 20:48197783-48197805 GAGATGTAATTCTTCAACCCAGG + Intergenic
1177721246 21:24909460-24909482 AGGATCTAATTATTCAATGTAGG + Intergenic
1181019341 22:20090762-20090784 GAGAACTAAGACTTAAATGGCGG - Intronic
1183830675 22:40417073-40417095 GAGATAAAAATCTTGAATGGGGG + Intronic
949937988 3:9131744-9131766 AAGAACTAATTCTTCAATCCAGG + Intronic
950873915 3:16253056-16253078 GAAATACAATTCTTCCATGGAGG - Intergenic
952675368 3:36023495-36023517 GCGATGGAATTTTTCAATGGGGG - Intergenic
956001395 3:64733722-64733744 GAGATGTAATTGTGCAATGAGGG - Intergenic
957168228 3:76703205-76703227 GAGATCTTAATAATCAATGGAGG + Intronic
957215989 3:77320129-77320151 GAAATCTATTTCATGAATGGTGG - Intronic
957940784 3:87000991-87001013 GAGATTTAATTCTACAAAGTTGG - Intergenic
958522968 3:95214894-95214916 CAGTTATAATTCTGCAATGGTGG + Intergenic
961908788 3:130292190-130292212 GACTTCTAAATATTCAATGGGGG - Intergenic
970293774 4:14605645-14605667 GAGCTGTAGTTCTTAAATGGTGG + Intergenic
970303885 4:14710631-14710653 GATATCTAATTCTTCTCTTGTGG - Intergenic
973851646 4:54966818-54966840 GAGATCTTTTTCTGCACTGGAGG - Intergenic
973927783 4:55757297-55757319 GAGATCTTATTCAACAATGGAGG + Intergenic
974266041 4:59587018-59587040 GAGATCCCATTTTTCAATGTTGG - Intergenic
974966182 4:68762872-68762894 GAGATCTAATTGTTCTATAAAGG - Intergenic
979712816 4:123800738-123800760 GAGATCTTATTTTTTAATGTAGG + Intergenic
979908279 4:126325784-126325806 GGGATTTAAGACTTCAATGGAGG - Intergenic
980748756 4:137059773-137059795 GAAATGTAAGTCTTCAAGGGAGG + Intergenic
982857613 4:160405302-160405324 GAAATTTAATTCTGCAATGTTGG + Intergenic
984097901 4:175454072-175454094 GAGTTATAATTTTGCAATGGTGG + Intergenic
986456834 5:7928095-7928117 GGGATTTAATTGTCCAATGGGGG - Intergenic
987255798 5:16149608-16149630 GAAATGCATTTCTTCAATGGAGG - Intronic
988736845 5:34031130-34031152 CACAGCTCATTCTTCAATGGTGG - Intronic
989134644 5:38141770-38141792 CAGGTCTAATTCTAAAATGGAGG - Intergenic
991226778 5:64282640-64282662 GAGATCTAATTTTTTTATGTGGG + Intronic
993055480 5:82975106-82975128 GGGGTCTAATTCTTCCTTGGGGG - Intergenic
995437700 5:112156541-112156563 GAGATGTACTTCCTCAATGTGGG - Intronic
996595555 5:125198318-125198340 TAGATCAAATTCATAAATGGGGG - Intergenic
996655529 5:125929349-125929371 GAGAGTCAATACTTCAATGGAGG + Intergenic
997842732 5:137256911-137256933 GAAACTTAATTCTTCAATGCTGG - Intronic
999083246 5:148864048-148864070 GAAATCTAAGTTTTTAATGGTGG - Intergenic
1003789684 6:9530889-9530911 GAAATCAAAGTCTTCAGTGGTGG + Intergenic
1005309850 6:24548950-24548972 GAAATCTAATGCCTAAATGGTGG + Intronic
1007977611 6:46117334-46117356 TAGATCCAAATCTTCAAAGGAGG + Intergenic
1013217065 6:108037241-108037263 GATTTCAAATTCTTCAGTGGTGG - Intergenic
1016531969 6:145068572-145068594 GAGATACAATTCTGCAATGCTGG - Intergenic
1016616465 6:146054415-146054437 CAGATTTAATTTTTCTATGGAGG + Intronic
1020352668 7:7238741-7238763 CAGTGCTAAGTCTTCAATGGAGG - Exonic
1024952771 7:54882070-54882092 GACACCTCATTCTTCAATGTTGG + Intergenic
1028324126 7:89501249-89501271 GAGATCTAATTCTTGAGTACTGG - Intergenic
1028351298 7:89852909-89852931 GAGATCTAATTATTTAAAAGTGG + Intergenic
1029060584 7:97793701-97793723 GAGATCTAATTCATTGCTGGTGG - Intergenic
1033594356 7:142845592-142845614 GAAATGTAATCCTTCAATGCTGG + Intergenic
1034364070 7:150530694-150530716 GAGATCTAACTTTTTAATGTGGG + Intergenic
1035681959 8:1494850-1494872 GAGATCTAACTCTTCTGTGGCGG + Intergenic
1036588271 8:10145127-10145149 GAAGTCTAATTTTTCACTGGCGG + Intronic
1038264652 8:26029101-26029123 GAGAACTAAGTCCTTAATGGAGG + Intronic
1041945681 8:63439491-63439513 CAGATCTTTTTCCTCAATGGGGG + Intergenic
1042028068 8:64444919-64444941 GAGAACTGATTCTTCAATTCTGG - Intergenic
1042766336 8:72326110-72326132 TAGATCTAATTTGTCAATGTTGG - Intergenic
1043824572 8:84910255-84910277 AATATCTAATTTTTCCATGGTGG - Intronic
1049128433 8:140813678-140813700 GAGATCTAACTTTTCGATGTGGG - Intronic
1053054944 9:34988623-34988645 GAGATCTAATGACTTAATGGGGG + Intergenic
1053103508 9:35390980-35391002 GAGATGAAATTCTCCCATGGTGG + Intronic
1060002571 9:119971751-119971773 GAGATCCTTTTGTTCAATGGAGG - Intergenic
1187101968 X:16202375-16202397 GAGATATAAGTCTTCTTTGGTGG + Intergenic
1190595400 X:52048346-52048368 TAGATGTAATGCTTCAATAGAGG + Intergenic
1190613424 X:52205727-52205749 TAGATGTAATGCTTCAATAGAGG - Intergenic
1191735728 X:64386238-64386260 TAGATCTAATTCATGAATTGGGG - Intronic
1193130003 X:77909987-77910009 TTGATGTAATTTTTCAATGGAGG + Intergenic
1197168321 X:123403807-123403829 GAAACCTAATTCTTCATTGTGGG + Intronic
1198319658 X:135507311-135507333 AAGATCTAAATCCTCACTGGAGG - Intergenic
1201477684 Y:14400829-14400851 AAAAAGTAATTCTTCAATGGTGG + Intergenic
1201745676 Y:17370531-17370553 GAGAATTAATTCTTTGATGGTGG + Intergenic