ID: 1120011733

View in Genome Browser
Species Human (GRCh38)
Location 14:79423213-79423235
Sequence ACATATCAACTACTCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120011729_1120011733 -9 Left 1120011729 14:79423199-79423221 CCCATGTGTAGCAAACATATCAA 0: 1
1: 0
2: 2
3: 15
4: 197
Right 1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1120011727_1120011733 13 Left 1120011727 14:79423177-79423199 CCTTCATCCAATTTAATGCTCTC 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1120011728_1120011733 6 Left 1120011728 14:79423184-79423206 CCAATTTAATGCTCTCCCATGTG 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1120011730_1120011733 -10 Left 1120011730 14:79423200-79423222 CCATGTGTAGCAAACATATCAAC 0: 1
1: 0
2: 1
3: 3
4: 106
Right 1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1120011725_1120011733 28 Left 1120011725 14:79423162-79423184 CCAGGGGTAAAATGCCCTTCATC 0: 1
1: 0
2: 1
3: 19
4: 121
Right 1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1120011726_1120011733 14 Left 1120011726 14:79423176-79423198 CCCTTCATCCAATTTAATGCTCT 0: 1
1: 0
2: 0
3: 19
4: 220
Right 1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120011733 Original CRISPR ACATATCAACTACTCTGGGT TGG Intronic
905535335 1:38717011-38717033 AGGGATCAACTATTCTGGGTGGG + Intergenic
906856249 1:49308263-49308285 ACATTTAAACTACTCTGTTTGGG - Intronic
907669747 1:56464109-56464131 ACAAATGAACTCATCTGGGTGGG + Intergenic
908187545 1:61667082-61667104 ACTCATCACCTACTCTGTGTCGG - Intergenic
908994529 1:70135438-70135460 AAATATCATCTAGGCTGGGTTGG + Intronic
912643722 1:111371268-111371290 ACATATCTACAACTCAGGATGGG + Intergenic
916435586 1:164775003-164775025 ACATATAAACAACTCTTGCTAGG - Intronic
917993049 1:180403078-180403100 ACATATGTACTCCTCTGTGTAGG - Intronic
924138944 1:241002018-241002040 ACAAATGTACTACTCTGGTTGGG + Intronic
1064724393 10:18263179-18263201 ACCTATCTTCCACTCTGGGTTGG - Intronic
1064933814 10:20657493-20657515 ACAAATACACTACTCTGGTTGGG - Intergenic
1065677049 10:28187538-28187560 ACATATCATTTGCTTTGGGTGGG - Intronic
1072141054 10:92589546-92589568 ACATATAAAGTACACTGGCTGGG - Intergenic
1073477099 10:103761546-103761568 AAATATCAATTACTCTGTGCTGG + Intronic
1074054473 10:109909903-109909925 ACAAATGTACTACTCTGGTTGGG - Intronic
1084536873 11:69762546-69762568 ACAAGTCAATTACTCTGTGTAGG + Intergenic
1087660488 11:100982035-100982057 ACATAGCAATTACTCTGTATAGG + Intronic
1091206723 11:133826525-133826547 AAATTTCAACCACTCTGGATGGG + Intergenic
1093087788 12:14885998-14886020 AGATATTATCTACTCTGAGTGGG + Intronic
1093274622 12:17108913-17108935 ATATATAAACTAATATGGGTAGG + Intergenic
1093929465 12:24940658-24940680 ACACATCAACTATTCATGGTTGG - Intronic
1096820181 12:54227706-54227728 ACATTTCAGCTATTCTTGGTAGG - Intergenic
1097478389 12:60088045-60088067 ACATATCAAATACTCAGGAAAGG + Intergenic
1099903274 12:88738981-88739003 CCATCACAACTACTCTGTGTGGG + Intergenic
1101835756 12:108294085-108294107 ACATAGCAGGTACTCTGTGTGGG - Intronic
1113279295 13:108771444-108771466 ACAAATGAACTACTCTGGTGGGG - Intronic
1113422154 13:110179179-110179201 ACATATCAAATATACTCGGTAGG + Intronic
1115610474 14:35044416-35044438 ACAAATCAACAACTCGGGCTGGG - Intergenic
1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG + Intronic
1126563807 15:50073922-50073944 GCATACCAACTACTCTTAGTGGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1133580952 16:7144271-7144293 ATATATCAATTCCTCTGGGGAGG - Intronic
1134396652 16:13871323-13871345 ACAAATGAACCACTCTGGGCCGG + Intergenic
1134584619 16:15399051-15399073 ACAGATTAACAACTCTGGCTTGG + Intronic
1135920993 16:26648939-26648961 AGATAGCACCTCCTCTGGGTGGG - Intergenic
1138812978 16:60172252-60172274 ACAGATGAACCACTCTGGTTTGG + Intergenic
1146097987 17:29951039-29951061 ACTTATTAACTGCTTTGGGTGGG - Intronic
1155535747 18:26815613-26815635 AAATATCAACAACCCTGAGTTGG - Intergenic
1157414045 18:47487436-47487458 ACATATCAACTACGCCTGATGGG - Intergenic
1158904321 18:61997397-61997419 AGATAACAACAACTCAGGGTGGG + Intergenic
1160104076 18:75953135-75953157 ATCTATAAACTACTTTGGGTAGG + Intergenic
1164766062 19:30771173-30771195 ACATTTCAACTAATGTTGGTGGG - Intergenic
926263594 2:11292454-11292476 ACATATAAGCTATTCTGGCTTGG - Intronic
930262578 2:49164958-49164980 ACATAACAACATCTCAGGGTAGG + Intergenic
936724418 2:115295485-115295507 ACTTCTCAACTACTCTGTGACGG - Intronic
936832949 2:116671262-116671284 ACATATAAACTTCTTTGGTTGGG + Intergenic
937554942 2:123142317-123142339 ACTCATCAACTACACTAGGTTGG + Intergenic
943031998 2:182696659-182696681 ACAAATCTACCACTCTGGGAGGG + Intergenic
944380656 2:199106144-199106166 ACATATTAATTACTCTTGGAAGG - Intergenic
946619960 2:221550116-221550138 ACTTATCCACTACGCTGGGCTGG + Intronic
947186563 2:227460608-227460630 ACATATCCAATACTATGGATTGG - Intergenic
947674325 2:231963189-231963211 ACATTTAAACTACTGTTGGTGGG - Intronic
1182294290 22:29304120-29304142 GCATATCCACTTCTCTGGGGAGG - Intergenic
1182896937 22:33866835-33866857 ACAGAGCACCTACTATGGGTAGG + Intronic
954842287 3:53522383-53522405 ACAGACCATCTAGTCTGGGTAGG - Intronic
955680500 3:61495527-61495549 ACAAATAAACAACTTTGGGTAGG + Intergenic
955874656 3:63476443-63476465 ACAAATCACCTACTCTGCTTTGG + Intronic
956478610 3:69650258-69650280 ACATACCAACAACTTTGGCTTGG - Intergenic
959615390 3:108341719-108341741 ACATTTAAACTACTGTGAGTTGG - Intronic
961026036 3:123558448-123558470 ACAAATGTACTACTCTGGTTGGG + Intronic
961066618 3:123882124-123882146 AAACAGCAACTACTCTGGCTGGG + Intronic
964499923 3:157337967-157337989 ACATAATAACTATTCTGGGGAGG - Intronic
964799888 3:160544304-160544326 ACATATAACCTTCTCAGGGTTGG + Intronic
967278048 3:187795706-187795728 ACAGATCAATTAACCTGGGTGGG + Intergenic
967976696 3:195039407-195039429 ACATAGCACCTGCTGTGGGTGGG - Intergenic
972864290 4:43211350-43211372 ACAAATTAACCACTCTGGTTGGG + Intergenic
980951972 4:139389331-139389353 ATATTTCAACTAATCTGTGTTGG + Exonic
985088772 4:186342506-186342528 GCAGATCAGCTACACTGGGTAGG + Intergenic
990052973 5:51530953-51530975 AGATATCAACTATGCTGGGCAGG + Intergenic
992909348 5:81380178-81380200 ACATAACAACTGCTCTGGAGAGG + Intronic
993826821 5:92698918-92698940 AAATGTCAACTACTCTGACTTGG + Intergenic
995184658 5:109259308-109259330 AAACATGAACTACTCTGGGCTGG - Intergenic
995588772 5:113676537-113676559 ACATAGGAAATACTGTGGGTGGG + Intergenic
999305586 5:150517434-150517456 ACAAATTTACCACTCTGGGTTGG - Intronic
1004120657 6:12818390-12818412 TCATATGAACAAGTCTGGGTTGG - Intronic
1004470938 6:15928627-15928649 ACACATCAAGTACTGGGGGTCGG - Intergenic
1008857197 6:56103829-56103851 CCATATCAGGAACTCTGGGTTGG - Intronic
1008960744 6:57262941-57262963 ACTTATCAACCACTGTGGGATGG + Intergenic
1010110416 6:72222339-72222361 ACAATTCAGCTACTCTGTGTGGG + Intronic
1010717212 6:79243534-79243556 ACATTTCCAATCCTCTGGGTAGG + Intergenic
1011434078 6:87318817-87318839 TCATATCAACTACTTTGGCTTGG + Intronic
1014489576 6:122045566-122045588 ACATATCAACTTCTTTGGGATGG + Intergenic
1015664012 6:135606766-135606788 ACACTACAACTTCTCTGGGTTGG - Intergenic
1020740465 7:12009769-12009791 ACCTATCAATTGCTTTGGGTAGG - Intergenic
1021132059 7:16923258-16923280 GCTTATCAACTACAGTGGGTGGG - Intergenic
1021301251 7:18975711-18975733 ACTTAACAACTGCTCTGAGTTGG + Intronic
1026894149 7:74000346-74000368 TCATGTCAACTGCCCTGGGTTGG - Intergenic
1027046440 7:74994317-74994339 ACATGTCAACAACTCTGGCAGGG + Intronic
1028737517 7:94234278-94234300 ACATATCAACTAATCTCAGAAGG + Intergenic
1028874722 7:95808015-95808037 ACATATGAACTAGTCAGGGCAGG + Intronic
1037362711 8:18090850-18090872 GCATATCTACTACTGTGGGGAGG - Intergenic
1047740195 8:127800507-127800529 ACATAGTAACTACTATGTGTGGG - Intergenic
1051275260 9:15392358-15392380 TCACTTTAACTACTCTGGGTTGG - Intergenic
1052624272 9:30954936-30954958 AAATATTTACTACTCTGGATGGG + Intergenic
1190617667 X:52252833-52252855 ACAAATGTACTACTCTGGGGGGG - Intergenic
1199593170 X:149486738-149486760 ACATCTCCCATACTCTGGGTGGG - Intronic