ID: 1120014186

View in Genome Browser
Species Human (GRCh38)
Location 14:79451486-79451508
Sequence CCAATTAAATAGATGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120014186 Original CRISPR CCAATTAAATAGATGGATCA TGG Intronic
903046761 1:20570115-20570137 ACAAATAAATAGATGAATGAGGG - Intergenic
905111951 1:35601916-35601938 TCCATTAAATTGATGTATCATGG - Exonic
907841037 1:58157768-58157790 GCAATGAAGTAGAAGGATCATGG - Intronic
910092396 1:83480579-83480601 CCAAAAAAATAGAAGTATCAAGG - Intergenic
910290945 1:85599868-85599890 CCATTTAAATAAATAGAACATGG + Intergenic
916237930 1:162609018-162609040 CATATTAAATAGTTGGATCAAGG - Intergenic
916348861 1:163826148-163826170 ACAATTAAATGAATGGATTAAGG - Intergenic
917014718 1:170517117-170517139 CTAATTAAATATATGTATAATGG - Intergenic
919405728 1:197180630-197180652 GCTATAAAACAGATGGATCAAGG - Intronic
920863383 1:209730423-209730445 CCAATAAATTAGATGGATTCAGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921455714 1:215368614-215368636 CCAATTAAATAGATGTTCCTTGG - Intergenic
922400486 1:225249244-225249266 GAAATAAAAAAGATGGATCAAGG + Intronic
923827270 1:237514625-237514647 CCAATTAAATAAGTGAATAAAGG - Intronic
1068244987 10:54353666-54353688 AGAATAAAATAGATGGACCAAGG - Intronic
1069408616 10:68128854-68128876 CCAATTAACTTGCTGCATCAAGG - Intronic
1071012037 10:80950879-80950901 GCAATTAAATCCATGCATCATGG + Intergenic
1071770353 10:88722331-88722353 CCAATAAAATGGATGGATGAAGG - Intergenic
1071870838 10:89792650-89792672 ACAAATAAATAGATGGAAAAAGG - Intergenic
1071998434 10:91169912-91169934 AAAATTAAACAAATGGATCATGG + Intronic
1078579402 11:12526923-12526945 ACCAGTAAATAGATGGATGAAGG + Intronic
1079313139 11:19384015-19384037 TCAATTAAATAGATGCACCATGG - Intronic
1079814191 11:25034653-25034675 CCAATTCAATAAATGGAACTGGG - Intronic
1081926841 11:46837187-46837209 ACAATTAAATAAATGGATGGTGG + Intronic
1083147909 11:60772604-60772626 CCATTTAAAAAGAAGAATCAGGG + Intronic
1084114383 11:67033320-67033342 GCAAATAAATAGACAGATCAGGG - Intronic
1087248532 11:95870150-95870172 CCAGATAAATAGATGGATAGAGG + Intronic
1089869355 11:121658272-121658294 CCAATTGAATCCATGGATGAAGG - Intergenic
1090637666 11:128701232-128701254 CCAATTGAAAAGATTGCTCATGG - Intronic
1091878751 12:3959576-3959598 ACAAATAAATGGATGGATCACGG - Intergenic
1094388541 12:29921923-29921945 TCAGTTGAATAGATGGATGAAGG + Intergenic
1095545569 12:43363868-43363890 CCAATTAAATAGAGGCCCCATGG - Intronic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1099770594 12:87048721-87048743 ACAATTAAGTAAATGGATGATGG + Intergenic
1099818450 12:87678116-87678138 ACAAATAATTAGATAGATCAAGG - Intergenic
1103533918 12:121621604-121621626 CTAAATAAATAAATGAATCATGG - Intergenic
1107324029 13:39221128-39221150 CTAATTTAATAGATGAATCTTGG - Intergenic
1109083017 13:57931529-57931551 TCAATTATAAAGAAGGATCATGG - Intergenic
1109433327 13:62266055-62266077 CCAATTCTCTAGATGGATAATGG + Intergenic
1109579079 13:64302103-64302125 TCAATTCAATAGATGTATAATGG - Intergenic
1110355916 13:74567260-74567282 ACAATTAAATAGACAGAACATGG - Intergenic
1110680037 13:78299423-78299445 CCAGTTACATATTTGGATCAAGG - Intergenic
1110811508 13:79816154-79816176 TCAATTATTTAGATTGATCAAGG - Intergenic
1111084340 13:83353868-83353890 GCAATTAAATACATGTATCCAGG - Intergenic
1111650416 13:91083618-91083640 TTAATTAAATAAATGGATCTTGG + Intergenic
1111674885 13:91375019-91375041 CCAATTAAAATGCTGGTTCATGG - Intergenic
1114358659 14:21944244-21944266 CCATTCAAATAGGTGTATCATGG + Intergenic
1116723192 14:48527512-48527534 CCTATTCAATAGATGGTTCTGGG - Intergenic
1116983356 14:51194367-51194389 CCAAGTAAATAAATGCATTAAGG + Intergenic
1119905770 14:78300641-78300663 CCAATTAAGTAGAGGAAGCATGG - Intronic
1120014186 14:79451486-79451508 CCAATTAAATAGATGGATCATGG + Intronic
1120201796 14:81545520-81545542 CCTATTTAATAGATGGTTCTGGG + Intergenic
1120368119 14:83596124-83596146 ACAATTAAATAGATGTTTCCAGG + Intergenic
1121281015 14:92698191-92698213 CTAATTAAATAGATGGTGGATGG + Intergenic
1125923219 15:43539245-43539267 CCAATGAAATAGAAGGAACATGG + Intronic
1126034614 15:44535363-44535385 CCATTTATAAAGGTGGATCAGGG - Intergenic
1126739551 15:51763917-51763939 CCAATTCATTTGATGGATAAGGG + Intronic
1129526147 15:76215957-76215979 CCAACTAAATACATGGAGCTGGG + Exonic
1130357492 15:83147007-83147029 CCAATTTAATGGATGAACCAAGG + Intronic
1135738614 16:24954428-24954450 GCAATTTAAAATATGGATCATGG + Intronic
1135896702 16:26412060-26412082 ACAATTAAATAGATGGACGATGG + Intergenic
1138880750 16:61012193-61012215 CCAATTAACTAAGTGGATGATGG - Intergenic
1144416726 17:15054961-15054983 ACAATTAAATAAATGGATAGTGG + Intergenic
1144795139 17:17886283-17886305 CAAATTAAATAAGTGCATCAGGG - Intronic
1147491425 17:40870885-40870907 GAAATTAAACAAATGGATCATGG - Intergenic
1151211629 17:72548796-72548818 CCAATTGAATAGATGGCTCTTGG - Intergenic
1155080941 18:22409051-22409073 CCAATTCAGTCCATGGATCAAGG - Intergenic
1164295583 19:23906800-23906822 CCCATCAAATAGATGGGTCCAGG - Intergenic
925535484 2:4911778-4911800 TCGACTAAATAGATGCATCAAGG + Intergenic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
926769965 2:16362230-16362252 CCAAATGAATAAATGGATGAGGG + Intergenic
928779169 2:34800550-34800572 ACAATTAAATATATGGTTGATGG - Intergenic
931183770 2:59929948-59929970 TCAGTTACATAGATGCATCATGG - Intergenic
931416909 2:62090130-62090152 ACAATTAAAGAACTGGATCATGG - Intronic
931428893 2:62194959-62194981 CCAATTATCTAGATGGGTCCAGG + Intergenic
935846619 2:107172805-107172827 ACAATTAAATAGATAGCTGATGG - Intergenic
936589457 2:113789247-113789269 CCAAATTAATTGATGGATCAAGG + Intergenic
936740080 2:115494452-115494474 TCAGTTAAATATATGGATCCTGG + Intronic
938777257 2:134552958-134552980 CAATTTAAAAATATGGATCAAGG - Intronic
941274233 2:163470651-163470673 GCAATGAAATAGATGCACCAAGG + Intergenic
941382050 2:164805480-164805502 ACAAATAAATAGATAGATCATGG - Intronic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
943881139 2:193145198-193145220 ACAAATAAATAAATGGATAATGG - Intergenic
944045442 2:195405841-195405863 CTCATTAAATACCTGGATCATGG + Intergenic
945918770 2:215732944-215732966 CCTATTAAATAGATGTATCTTGG - Intergenic
946691755 2:222313443-222313465 CCAATTAAATATATGTCTCTGGG + Intergenic
1170805539 20:19627503-19627525 CCAAGTAAATATAAGAATCAAGG - Intronic
1175004314 20:55666107-55666129 CCAATTAAATAGAAGCTTCTGGG - Intergenic
1175656172 20:60772906-60772928 CCAGCTAAAGAGATGGAGCAGGG + Intergenic
1177559928 21:22737464-22737486 ACAATTAAATAGAAAGATAATGG - Intergenic
1177739672 21:25138841-25138863 CCATTCTAATAGATGGATGAAGG + Intergenic
1178140160 21:29673622-29673644 CCAATTAATTAGCTGGTTAAGGG - Intronic
1178962433 21:37078077-37078099 CCAATTCAATACATGGTACAGGG - Intronic
1183851856 22:40596339-40596361 CCAATTAAATAAATGAATTGTGG + Intronic
949302137 3:2596205-2596227 CCAAGTAAATACATAAATCAAGG - Intronic
949932443 3:9089369-9089391 CCAATCAAAAAGATGAATCTTGG - Intronic
954700360 3:52447665-52447687 CCAATTTCATGGATGGAACAGGG + Intergenic
955625508 3:60914372-60914394 TTAATTAAATAAATGGTTCATGG - Intronic
958472453 3:94537917-94537939 CCCATTTAAAAGAGGGATCATGG + Intergenic
959821558 3:110741085-110741107 CCAATCAAATGAATGGATGAAGG - Intergenic
960105814 3:113795575-113795597 CTAATCAAATAGATGAAGCAAGG - Intronic
963413966 3:144971019-144971041 TCATTTAAATAAATGCATCAGGG + Intergenic
963616178 3:147541269-147541291 ACACTTAAACATATGGATCAGGG - Intergenic
965420053 3:168446838-168446860 AGAATTAAATAGAGTGATCAGGG + Intergenic
966218551 3:177527695-177527717 CCACTTAAAGAGAAGAATCAGGG + Intergenic
966603158 3:181795416-181795438 ACAATTAAATAGTTGGTTCTGGG + Intergenic
967562202 3:190929094-190929116 ACTATTAAATAGAAGAATCATGG - Intergenic
967640202 3:191853490-191853512 ATAATTAAATGGATGAATCATGG + Intergenic
970938277 4:21600824-21600846 CCAATTTTATAGATGTAGCAAGG - Intronic
971506344 4:27370145-27370167 CCAATTAATTAACTGGAGCATGG + Intergenic
971512196 4:27440628-27440650 GCAATTAAATAAATTGCTCAAGG + Intergenic
972360192 4:38319397-38319419 CCACTTAGATAGATGGAAAAGGG + Intergenic
972985597 4:44760673-44760695 GCAGTGAAATAGATGGAACAGGG + Intergenic
976545874 4:86335199-86335221 CCAATTCAAAACATGTATCAGGG - Intronic
977961367 4:103088822-103088844 TCAAATAAATAAATGAATCAAGG - Intronic
979666479 4:123316549-123316571 CCTATTAAATATATGGCTAAGGG + Exonic
980845655 4:138321126-138321148 CCAATTAAATAGAGGGAGAGGGG + Intergenic
983277153 4:165631730-165631752 GCTACTAAATAGAAGGATCAGGG - Intergenic
986863523 5:11955839-11955861 CCAATTCAATAGATGTATAGTGG - Intergenic
991935932 5:71800284-71800306 GCAATTGAATGGATGGATCTGGG + Intergenic
993707406 5:91186664-91186686 CCAATTTCATAGATAGATGATGG + Intergenic
994327077 5:98460479-98460501 CCAATGAATTATATGGATTAAGG - Intergenic
995163460 5:109009332-109009354 CCTATTAAAAAGATGGAAGAGGG - Intronic
996227395 5:121016891-121016913 CCAATTTAAGAGTTGGTTCAAGG - Intergenic
997123409 5:131200272-131200294 CATATTAAATAGTTTGATCAAGG - Exonic
998327315 5:141292793-141292815 CAAATTAAATAGATAGATATAGG + Intergenic
1001411775 5:171517424-171517446 TCGACTCAATAGATGGATCATGG + Intergenic
1006967085 6:37998714-37998736 CCAAATAAATAAATGGATGGTGG + Intronic
1007890922 6:45290870-45290892 CCAAGAAAATGGATGGATCATGG + Intronic
1008203156 6:48617768-48617790 CCTATTCAATAGATGGTGCAGGG - Intergenic
1008496343 6:52137818-52137840 CCAAATAAATACATTGCTCAGGG - Intergenic
1008783943 6:55142942-55142964 ACAAATAAATAGATGGATAGAGG + Intronic
1010309134 6:74362534-74362556 CTAATTAAATAGATAGCTAAGGG - Intergenic
1012603669 6:101130916-101130938 AAAATTAAATAGATTGATCAAGG + Intergenic
1013618657 6:111868281-111868303 ACAATTAATTCGATGGTTCAAGG - Intronic
1014017064 6:116544447-116544469 CCAATTGAACAGATAGTTCAAGG - Intronic
1014838301 6:126185178-126185200 CCAAATAAATATATGAATCAAGG - Intergenic
1018524229 6:164689943-164689965 CCAATTAAATAGAGGGAGAAAGG - Intergenic
1019261329 7:83658-83680 CCCATTAAATAGATAGAGCCGGG + Intergenic
1019876847 7:3820474-3820496 CCAGTTAAAGAGGTGGATGAGGG - Intronic
1020332635 7:7035810-7035832 AAAATTAACTTGATGGATCAGGG - Intergenic
1021008456 7:15430670-15430692 CCATTTAAATATATGTAACAAGG - Intronic
1021429234 7:20540718-20540740 CCTATTTAATAGATGGTTCTGGG + Intergenic
1022342865 7:29485574-29485596 CCAAGTAGATAAATAGATCAAGG + Intronic
1022957722 7:35396755-35396777 AAAAATAAATATATGGATCATGG + Intergenic
1025502593 7:61323433-61323455 CCTATTAAATAAATGGTTCTGGG + Intergenic
1027861648 7:83590606-83590628 CCAATTAAAATGAGGGATAAGGG + Intronic
1028345612 7:89778589-89778611 AAAATTACATAAATGGATCAAGG - Intergenic
1031855838 7:126921581-126921603 CCAATTACAGAGAAGGATTAAGG + Intronic
1032529256 7:132606596-132606618 CCAATGCAATTGATGGATTAGGG - Intronic
1037206288 8:16323541-16323563 AGAATTAATAAGATGGATCATGG - Intronic
1038059545 8:23897323-23897345 CCAAAGAAATAATTGGATCAAGG + Intergenic
1041798930 8:61776923-61776945 CCAGTAAAATAGATGGCTTAGGG - Intergenic
1045596831 8:103666443-103666465 CCAAGTAAATACATTTATCATGG - Intronic
1048187856 8:132260774-132260796 ATAATTAAATGGATGGATAATGG - Intronic
1050980613 9:12009153-12009175 TCTATTAAATAGATTGAGCAGGG - Intergenic
1051576662 9:18623524-18623546 CAAAGCAGATAGATGGATCAAGG + Intronic
1057928927 9:99176917-99176939 CCAATTGACTGGATGGCTCAGGG - Intergenic
1058237849 9:102515369-102515391 CCAATTAAATGAATGGGTGATGG - Intergenic
1059790861 9:117640684-117640706 CCACTTAAACAGAGGCATCAAGG + Intergenic
1186946431 X:14573460-14573482 GCAAGTAAATAGATAGTTCATGG + Intronic
1187948991 X:24453518-24453540 CCAAATAAATAGAAGTATAAAGG + Intergenic
1188872542 X:35390751-35390773 CCAAGGAAATAGGTGGAACATGG - Intergenic
1192075867 X:67995771-67995793 CCTATTAAATAAATGGTTCCGGG - Intergenic
1193789840 X:85804141-85804163 CCTATTAAATAAATGGTTCTGGG - Intergenic
1194109983 X:89821856-89821878 CTTATTAAATAAATGGAGCAGGG - Intergenic
1194577198 X:95627497-95627519 GCAATTAAATCCATGAATCATGG - Intergenic
1194578939 X:95647306-95647328 GCAATTTAATAAATGGATAAAGG - Intergenic
1198985361 X:142445949-142445971 CCAATAAAATATATGGAACTGGG - Intergenic
1199663103 X:150072353-150072375 CCAATTAAATAGATGTAGGAGGG - Intergenic
1200462647 Y:3476594-3476616 CTTATTAAATAAATGGAACAGGG - Intergenic