ID: 1120014215

View in Genome Browser
Species Human (GRCh38)
Location 14:79451730-79451752
Sequence CTGGAGCAGCAGAATGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120014215_1120014221 8 Left 1120014215 14:79451730-79451752 CCCTTTGCATTCTGCTGCTCCAG 0: 1
1: 0
2: 0
3: 32
4: 447
Right 1120014221 14:79451761-79451783 GTCTGATTTGTTCTTACTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1120014215_1120014222 27 Left 1120014215 14:79451730-79451752 CCCTTTGCATTCTGCTGCTCCAG 0: 1
1: 0
2: 0
3: 32
4: 447
Right 1120014222 14:79451780-79451802 CTGGTTTAAGAGAGATTAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120014215 Original CRISPR CTGGAGCAGCAGAATGCAAA GGG (reversed) Intronic
900481247 1:2900500-2900522 CTGGAGCAGGAGCTTGCACAGGG - Intergenic
901252302 1:7789578-7789600 CTTTATCAGCAGCATGCAAACGG + Intronic
903996471 1:27308017-27308039 CTGGAACACAAGAAAGCAAAGGG - Exonic
904554299 1:31348159-31348181 TTGGTGCAGCAGAAAGCACAGGG + Intronic
905658009 1:39698501-39698523 CTGGAGGAGCAAAATGCAGATGG + Intronic
905658018 1:39698578-39698600 CTGGAGGAGCAAAATGCAGATGG + Intronic
906021151 1:42630775-42630797 CTGGAGCTGAAAAATGCAATAGG - Intronic
906352593 1:45076913-45076935 CTGGAGCTGAAAAATGCAATTGG - Intronic
908062599 1:60368106-60368128 CTGGTGAAGCACTATGCAAAAGG + Intergenic
908186136 1:61654787-61654809 CTGCAGGAGCTGAAGGCAAAGGG + Intergenic
909026930 1:70493019-70493041 CTTGAGCAGACGAAGGCAAATGG - Intergenic
910230032 1:84975861-84975883 CTGGAGCTGAAAAATGCAATTGG + Intronic
910733282 1:90422089-90422111 CTGGAGCTGAAAAATGCAACTGG + Intergenic
911887698 1:103325607-103325629 CTGGAGCTGAAAAATGCAATTGG - Intergenic
912598709 1:110904964-110904986 CTGGAGCTGAAAAATGCAATTGG + Intergenic
912607084 1:111002315-111002337 CTGGAGCTAAAAAATGCAAATGG - Intergenic
915004416 1:152623246-152623268 CTGGGGAAGGGGAATGCAAACGG + Intergenic
915493602 1:156265857-156265879 CTGGAGGAGCAGGTTGCTAAAGG + Exonic
915668847 1:157470258-157470280 CTGGAGCAGCAGAACAGAACAGG - Intergenic
915723385 1:158000486-158000508 CTGGAGCTACAGAATGGAGAGGG - Intronic
916719946 1:167477245-167477267 CTGGGCCAGGAGAAAGCAAAAGG + Intronic
917355114 1:174119395-174119417 CTTGAGCAGCAGAGTGCAGGTGG - Intergenic
917372947 1:174316046-174316068 CTGGAGCTGAAAAATGCAATTGG - Intronic
917892265 1:179451880-179451902 CTTTATCAGCAGAATGAAAATGG + Intronic
918429552 1:184444571-184444593 CTTTATCAGCAGAATGAAAATGG + Intronic
918618956 1:186580553-186580575 CTGGAGCAGCATGATGGAAATGG - Intergenic
918756317 1:188343083-188343105 CTGGAGCTGAAAAATGCAATAGG - Intergenic
918986222 1:191630605-191630627 CTGGAGCTGAAAAATGCAATTGG + Intergenic
919895342 1:202006326-202006348 CTGGTGCAGGAAAATGAAAAAGG + Intergenic
920549766 1:206848451-206848473 CTGGAGCTGAAAAATGCAATTGG + Intergenic
920712680 1:208310116-208310138 TGGAAGCAGCAGAATGCAGATGG - Intergenic
921599348 1:217090141-217090163 CAGGAGCAGCAGGATTTAAAGGG - Intronic
922045757 1:221944922-221944944 CTGGAGCTGAAAAATGCAATTGG - Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
924856477 1:247879648-247879670 CAGCTGGAGCAGAATGCAAAGGG - Intergenic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1065795269 10:29301354-29301376 CTTTATCAGCAGAATGAAAATGG + Intronic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1066754110 10:38692426-38692448 CTTTATCAGCAGAATGAAAACGG + Intergenic
1067756454 10:49009320-49009342 CTGAAGCAAGAGAAAGCAAATGG + Intergenic
1068563785 10:58548240-58548262 CTGGAGTTGAACAATGCAAATGG - Intronic
1068641719 10:59415262-59415284 CTGGAGTTGCAAAATGCAACCGG + Intergenic
1069127989 10:64661865-64661887 CTTTAGCAGCAGCATGAAAATGG - Intergenic
1069147969 10:64918818-64918840 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1069933350 10:71898587-71898609 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1070042964 10:72800247-72800269 CTGAACCATCAGAAAGCAAAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070424682 10:76273779-76273801 CTGGATCAGGTGAATGAAAAGGG + Intronic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1072639568 10:97201793-97201815 CTTGGGCAACAGCATGCAAACGG - Intronic
1072660090 10:97358609-97358631 CTGGGCAAGCAGAAAGCAAAAGG - Exonic
1072862841 10:99024177-99024199 CTGGAGCTGAAAAATGCAATTGG + Intronic
1072979157 10:100085361-100085383 ACGGAGCAGCAGGATGCAAGGGG - Intergenic
1073590969 10:104757285-104757307 CCGGACCAGCAGAAGCCAAAAGG - Intronic
1073627189 10:105111307-105111329 CTGGGGAAACATAATGCAAATGG - Intronic
1076094786 10:127722206-127722228 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1076286880 10:129308025-129308047 CTTGAGCAGCAGAAGTCACATGG - Intergenic
1076531312 10:131147131-131147153 CGGCAGCAGCAGAATTAAAAGGG + Intronic
1076889262 10:133275948-133275970 ATGGAGGAGGAGAATGGAAACGG - Intronic
1077214065 11:1387983-1388005 CTGGAGTAGCCGGATGCAAACGG + Intergenic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079183659 11:18216339-18216361 CTGGAGCTGAAAAATGCAATTGG + Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1079665569 11:23100822-23100844 CTGGAGCAGCACAGTTCAAAAGG + Intergenic
1079710976 11:23681028-23681050 CTGCAGCAGCAGACAGCAAGAGG + Intergenic
1079721662 11:23822509-23822531 CTGAAGGAACAGAAGGCAAAAGG - Intergenic
1080084059 11:28257698-28257720 CTGGAGCTGAAAAATGCAATTGG - Intronic
1081083953 11:38775924-38775946 CTTGATCAGCAGCATGAAAATGG - Intergenic
1081411790 11:42767516-42767538 CTTGAGCAGCAGAATAAATATGG - Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1083024546 11:59539250-59539272 CTGCAACAGCAGAATGAAATTGG + Intergenic
1083780505 11:64915070-64915092 CTGGATGAGCAGAGTTCAAAGGG + Intronic
1084120698 11:67067283-67067305 CTGGAGCAGAGGAATTCAAGGGG - Intronic
1085847348 11:80081523-80081545 CTGAAGCAGCTGAAAGGAAAGGG + Intergenic
1085890361 11:80572464-80572486 CTTGATCAGCAGCATGAAAATGG - Intergenic
1086610304 11:88748028-88748050 CTGGAGTAGCAGAGAGCCAAAGG + Intronic
1086750613 11:90489405-90489427 CTTTAGCAGCAGCATGAAAATGG + Intergenic
1086850192 11:91799430-91799452 CTTTATCAGCAGAATGAAAATGG - Intergenic
1088011812 11:105012227-105012249 CAAGAGCAGAAGAATGAAAACGG + Intronic
1088361859 11:109000019-109000041 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1088653006 11:111974961-111974983 CTGGAGCAGCTGGATTCAGACGG - Exonic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1090318139 11:125816027-125816049 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1090943966 11:131413352-131413374 CTGGCGCTCCAGAAAGCAAAAGG - Intronic
1091390189 12:121550-121572 CTGGAGCAGCAAACAGCGAAAGG - Intronic
1092756249 12:11766147-11766169 CAGCAGCAGCAGAAAGCCAAGGG + Intronic
1093376151 12:18430198-18430220 CTGGAGCATCAGTATGCTATGGG + Intronic
1095529409 12:43168295-43168317 TTGGAGCAGAAGATTGCAGATGG - Intergenic
1095986201 12:48001440-48001462 CTGGAGCAGTGGAATGCAGGCGG + Intronic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1097146848 12:56947423-56947445 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1097150736 12:56977934-56977956 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1097563503 12:61238635-61238657 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1098142728 12:67467878-67467900 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1098705751 12:73686309-73686331 CTGGAGCTGAAAAATGCAACTGG + Intergenic
1100236676 12:92668568-92668590 CTGGAGCTTCAGAATTCAGAAGG + Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100342830 12:93697318-93697340 CTCCCGCAGCAGAATGCCAAAGG - Intronic
1100914569 12:99404479-99404501 CTGGAGCTGAAAAATGCAACTGG + Intronic
1101302460 12:103495826-103495848 GGGGAGCAGCAGAGAGCAAACGG + Exonic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1105406238 13:20134848-20134870 CAGGTGCAGAAGAAGGCAAATGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1107057460 13:36122251-36122273 CTGGAGCTGCAGTTTGCATAAGG - Intronic
1107083787 13:36404428-36404450 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1107265849 13:38553478-38553500 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1107635473 13:42388125-42388147 CTGTGTCAGCAGAAAGCAAAGGG + Intergenic
1108081741 13:46744367-46744389 CTGGAGAAAGAGAATACAAATGG - Intronic
1108922697 13:55694809-55694831 CTGGAGCTGAAAAATGCAACTGG + Intergenic
1109906136 13:68844934-68844956 GTGGAGCAGGAGAGAGCAAAGGG - Intergenic
1110483770 13:76014473-76014495 TTGGAGCAGAAGAAAGGAAAGGG - Intergenic
1111500980 13:89119652-89119674 CTTGATCAGCAGCATGAAAACGG - Intergenic
1112618711 13:101033478-101033500 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1115948806 14:38695873-38695895 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1116276854 14:42845774-42845796 CTGGAGCTGGAAAATGCAATTGG - Intergenic
1116354984 14:43916034-43916056 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1117159218 14:52972465-52972487 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1117161270 14:52993055-52993077 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1117657244 14:57968522-57968544 GTGTAGCAGCACAATGGAAAGGG - Intronic
1118142580 14:63100720-63100742 CTGGAGCAGAATAAACCAAATGG - Intronic
1118623265 14:67633591-67633613 CTGGAGAAGCAGAGTGCCACAGG - Intronic
1118763586 14:68895421-68895443 CTGGAGCCCCAGAAAGCAAGTGG + Intronic
1119775469 14:77245495-77245517 CTTTATCAGCAGAGTGCAAATGG - Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120095022 14:80378779-80378801 CATGAGAAGCAGAATGCAAGAGG + Intronic
1120104777 14:80481133-80481155 CTTTAGCAGCAGCATGAAAATGG - Intronic
1121152849 14:91653445-91653467 CTTGATCAGCAGCATGAAAAGGG - Intronic
1122316534 14:100828627-100828649 CCGGAACAGCAGAGAGCAAAAGG - Intergenic
1122532700 14:102439949-102439971 CTGGATGAGCTGAATGGAAAAGG - Intronic
1124037308 15:26066642-26066664 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1124225597 15:27891045-27891067 TTGGAGCATCAGGAAGCAAAAGG + Intronic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1126294843 15:47128574-47128596 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127019523 15:54730634-54730656 CAGTAGCAGAAGAATGCAGAAGG + Intergenic
1127022307 15:54761533-54761555 CTGGAGCTGAAAAATGCAACTGG + Intergenic
1127113748 15:55702894-55702916 CTGGATCAGCAGCCTGTAAAAGG - Intronic
1127171051 15:56301193-56301215 CTGGAGCTGAAAAATGCAATGGG + Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127983838 15:64053052-64053074 CTGGAGCAGCAGGAACCAAAGGG - Intronic
1129160729 15:73746294-73746316 CCGGAGGAGGAGAAGGCAAAGGG + Intronic
1129735897 15:77962953-77962975 CTTTAGCAGCAGAATACAACTGG - Intergenic
1131516423 15:93080633-93080655 CTGGGGCAGCAGAGGTCAAAGGG - Intronic
1131868726 15:96739259-96739281 CTGTACCAAGAGAATGCAAAAGG + Intergenic
1132141557 15:99401176-99401198 CTTGATCAGCAGCATGAAAATGG - Intergenic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137810633 16:51349527-51349549 CTGAAGAAGCAGAACACAAAAGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1140457283 16:75112755-75112777 CTGGGGCAGCAGGAGGCAAGAGG - Intronic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1143389624 17:6552580-6552602 CTGGAGCGGAAGAATGCAGAGGG - Intronic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1149709128 17:58722908-58722930 ATGGATCATCAGAATGCAACAGG + Intronic
1150601365 17:66653681-66653703 GGGGAGATGCAGAATGCAAACGG - Intronic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1152518892 17:80843850-80843872 CAGGGGCAGCAGACTGAAAATGG - Intronic
1152986040 18:322054-322076 CTGGTTCATCAGAATGCAGAGGG + Intronic
1153761915 18:8339761-8339783 CAGGAGCTGCTGAATCCAAATGG + Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156408411 18:36804944-36804966 CTGGTGCAGCACAATGCCAGAGG + Intronic
1157194517 18:45609919-45609941 CTGGAGATGCAGGATGCAAATGG + Intronic
1157781068 18:50439656-50439678 CTGGTGCAGCATAATGCCACAGG - Intergenic
1160119849 18:76120569-76120591 CTGGAACAGTAGAATGACAAAGG + Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1162666602 19:12219044-12219066 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1162803392 19:13123390-13123412 CTGGAGCTGCTGCCTGCAAAGGG + Intronic
1165038204 19:33049848-33049870 CTGGAGCAGCAGGAAGGACAGGG - Intronic
1166410208 19:42551638-42551660 CTTTAGCAGCAGCATGAAAATGG + Intronic
1168225188 19:54989595-54989617 CTGGAGCAGCAGTTGTCAAAGGG - Intronic
925925945 2:8670732-8670754 ATGGGGCAAGAGAATGCAAAAGG + Intergenic
926129261 2:10290697-10290719 CTGGGGCAGAAGAATGCCAGTGG - Intergenic
926429371 2:12770097-12770119 CAGGAGCAGAAGGATGCAAGTGG + Intergenic
926512337 2:13797994-13798016 CTGGAGCTGAAAAATGCAATTGG - Intergenic
926767191 2:16331902-16331924 CTGGGGTAGCAGAGTGGAAATGG - Intergenic
927805080 2:26139882-26139904 CTCGCGCAGAAGAAAGCAAAGGG + Intergenic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
928688474 2:33775007-33775029 GAGGAGAAACAGAATGCAAAAGG - Intergenic
929388492 2:41441170-41441192 CTGGAGCCGAAAAATGCAATTGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930028121 2:47042014-47042036 CTGGAGCTACAGAAAGGAAAAGG + Intronic
930132851 2:47870174-47870196 CTGGAGAAGCAGAACTCAATAGG - Intronic
930492337 2:52092023-52092045 CTGGAGCTGAAAAATGCAACTGG - Intergenic
931219483 2:60276439-60276461 CTGGAGGAGCAAAATGGAGATGG - Intergenic
931637431 2:64353128-64353150 CTGGAGCTGAAAAATGCAATTGG + Intergenic
932563449 2:72891415-72891437 CTGCAGGAGCTGAAGGCAAAGGG + Exonic
932884138 2:75532663-75532685 CTGGAGCTCCAGAATGAAAGAGG + Intronic
934317410 2:91936763-91936785 CTTTATCAGCAGAATGAAAACGG + Intergenic
934929172 2:98406090-98406112 CTGGAGATGAAAAATGCAAATGG + Intergenic
936462098 2:112721690-112721712 CTGCAGCTGCAGAAAGCACAGGG - Intronic
938084947 2:128393426-128393448 CTTTAGCAGCAGCATGAAAATGG + Intergenic
938337100 2:130510155-130510177 CTGGAGGAGCTGGCTGCAAATGG + Intergenic
938352737 2:130610576-130610598 CTGGAGGAGCTGGCTGCAAATGG - Intergenic
939026118 2:137015462-137015484 CTGGAGCAGCAGAAAGCTGCTGG - Intronic
942352491 2:175066768-175066790 CTGGAGCTGAAAAATGCAATTGG + Intergenic
942769260 2:179496165-179496187 CTGGAGCTGAAAAATGCAACTGG + Intronic
943170228 2:184387881-184387903 CTGGAGCTGAAAAATGCAATTGG + Intergenic
943208039 2:184926817-184926839 CTGGAGCTGAAAAATGCAATTGG - Intronic
943915718 2:193629206-193629228 CTGGAGCTGAAAAATGCAACTGG + Intergenic
944202376 2:197121394-197121416 AGGCAGCAGCAAAATGCAAAGGG + Exonic
944502921 2:200380211-200380233 TCACAGCAGCAGAATGCAAATGG - Intronic
945141669 2:206693199-206693221 CTGGACCAGGTGAATCCAAAGGG - Exonic
946487650 2:220116297-220116319 CTGCTGCAGCAGGATGCAAAGGG + Intergenic
946543518 2:220711672-220711694 CTTCAGCAGCAGCATGAAAATGG + Intergenic
946832299 2:223739234-223739256 CTTTATCAGCAGCATGCAAATGG - Intergenic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947892910 2:233642322-233642344 CTGGAGCTGAAAAATGCAATCGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948903146 2:240966141-240966163 CTGGGGCAGCAGAGAGGAAAGGG + Intronic
1169034311 20:2436964-2436986 CTGGAGCAGCTGACAGCTAAGGG + Intergenic
1170765876 20:19289761-19289783 CTGGAGCAGCAGTGTGCCCAGGG + Intronic
1171266534 20:23776137-23776159 CAGGAGCAGCAGAGTGCACAGGG + Intergenic
1171272320 20:23826628-23826650 CAGGAGCAGCAGGGTGCACAGGG + Exonic
1171343416 20:24447667-24447689 CTGGAGCAGTGGATTGCAAGGGG + Intergenic
1171779560 20:29406950-29406972 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1174969828 20:55262544-55262566 ATGGAGCACCAGATTCCAAATGG - Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175756912 20:61535863-61535885 CTAGAGGAGCACAGTGCAAAGGG - Intronic
1176695260 21:9969646-9969668 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1177133123 21:17280924-17280946 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1177731379 21:25031071-25031093 GTGGAGCAGCAGAAACAAAAGGG + Intergenic
1178110485 21:29365216-29365238 CTTCAGCAGCAGAATCCTAAAGG + Intronic
1178216765 21:30607135-30607157 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1179240862 21:39590654-39590676 CTACAGCAGCAGAATACATATGG + Intronic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1180305585 22:11120555-11120577 CTTTAACAGCAGAATGAAAACGG + Intergenic
1180544104 22:16482734-16482756 CTTTAACAGCAGAATGAAAACGG + Intergenic
1181907758 22:26212829-26212851 CTGGAGAATAAGACTGCAAATGG + Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182558466 22:31141503-31141525 CTGGAGAAGCAGCAGGCTAATGG - Intergenic
1184032676 22:41904198-41904220 AGGGAGCAGCAGAATGGAAATGG - Intronic
1184432369 22:44449047-44449069 CTGGAGCAACAGAAAGCACGGGG - Intergenic
1184855416 22:47143921-47143943 CTGGAGCAGAAGAAGGCAGCGGG - Intronic
949428685 3:3948343-3948365 CTGGAGTTGAAGAATGCAATTGG - Intronic
950980865 3:17303099-17303121 GGGGAGCAGCAGAAAGAAAAGGG - Intronic
951740911 3:25922114-25922136 CTTGAGAAGGAGCATGCAAAAGG + Intergenic
952222133 3:31333435-31333457 CTGGAGCTGAAAAATGCAATTGG + Intergenic
953875978 3:46667144-46667166 CTGGAGCTGCAGTAGGCAAGGGG + Intergenic
954393389 3:50279284-50279306 CTGGAGCTGGAGCATGAAAATGG - Intronic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
956056396 3:65303166-65303188 CTGGTGAAGCAGAATGGACAGGG + Intergenic
957026323 3:75186413-75186435 TTGGAGGAGAAGAATACAAAAGG - Intergenic
957085575 3:75673656-75673678 CTGGAGCTGAAAAATGCAATTGG - Intergenic
958065833 3:88544140-88544162 CTTTATCAGCAGCATGCAAATGG + Intergenic
958617684 3:96515912-96515934 CTGGAGCTGAAAAATGCAATTGG - Intergenic
958757624 3:98270112-98270134 CTGGAGCTGAAAAATGCAATTGG - Intergenic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
959328592 3:104972464-104972486 CTGGAGCTGAAGAATGCAATTGG - Intergenic
959414174 3:106063100-106063122 CTGGAGCTGAAAAATGCAATTGG + Intergenic
960541021 3:118863177-118863199 CTGGAGCTGAAAAATGCAATTGG - Intergenic
960784847 3:121361598-121361620 CTGGAGCTGAAAAATGCAACTGG - Intronic
960852037 3:122065803-122065825 CTTGGAGAGCAGAATGCAAACGG - Intronic
961180007 3:124869074-124869096 CTGGAGCAGGAGAATCCCCATGG + Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962425449 3:135265424-135265446 CAAGAGCAGCAGAAGGGAAAGGG + Intergenic
963434336 3:145249150-145249172 CTGGAGCTGAAAAATGCAACTGG - Intergenic
963448210 3:145441327-145441349 CTGGAGTAGAAAAATGCAACTGG + Intergenic
964169041 3:153745203-153745225 CTGAAGCAGCAGTTTGCAGAGGG - Intergenic
964495547 3:157286044-157286066 CTTGAGCAGCAGAAAGGAAGTGG + Intronic
966468275 3:180256989-180257011 CTGGAGCTGAAAAATGCAATTGG + Intergenic
967633047 3:191769312-191769334 CTGGAGCTGAAAAATGCAATTGG - Intergenic
968585031 4:1412339-1412361 CTGTAGAGGCAGGATGCAAAAGG + Intergenic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969887397 4:10227696-10227718 CTGGAGCAAAAACATGCAAATGG + Intergenic
970071050 4:12160884-12160906 CTGGAGCTGAAAAATGCAATTGG - Intergenic
970302289 4:14693923-14693945 CTGAATAAGCAAAATGCAAATGG + Intergenic
970560769 4:17280194-17280216 CTGGAGCAGGAAAATGTTAAGGG - Intergenic
970815214 4:20147872-20147894 GTGGGGCAGCAGAGTGCACAGGG - Intergenic
973067960 4:45821409-45821431 CTGGAGGGGGAGAATGCAAATGG + Intergenic
973573706 4:52265234-52265256 CTGGAACAGCAGGATGTGAAGGG + Intergenic
973824422 4:54691103-54691125 GTGGAGCAGCAGAATTGACATGG + Intronic
974474423 4:62361473-62361495 CTGGAGTAGCTGAAGACAAAGGG - Intergenic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
974593116 4:63982148-63982170 CTGGAGCTGAAAAATGCAACTGG - Intergenic
975502108 4:75098848-75098870 CTGGAGCTGAAAAATGCAATTGG - Intergenic
975909472 4:79250019-79250041 CAGGAGCAGCACAGAGCAAAGGG + Intronic
976340125 4:83937798-83937820 CTGGAAAAGAAGAATGGAAAAGG + Intergenic
977185048 4:93926213-93926235 CTGGAGCTGAAAAATGCAACTGG + Intergenic
977299575 4:95252861-95252883 CTGAACCATCAGAAAGCAAAGGG - Intronic
977341657 4:95765425-95765447 CTGGAGCTGAAAAATGCAATAGG + Intergenic
977949650 4:102955383-102955405 CTTTATCAGCAGAATGAAAACGG + Intronic
978729577 4:112009781-112009803 CTGAACCATCAGAAAGCAAAGGG + Intergenic
978853492 4:113366581-113366603 CTGAAACAGGAGAATGCAGAGGG - Intronic
979406023 4:120311314-120311336 CTTTATCAGCAGAATGAAAACGG - Intergenic
980367887 4:131829876-131829898 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
980405174 4:132345457-132345479 CAGGAGCTGCATAAGGCAAAGGG - Intergenic
980443122 4:132872526-132872548 CTGGAGCTGAAAAATGCAACTGG + Intergenic
980509991 4:133772663-133772685 CTTTAGCAGCAGCATGAAAATGG - Intergenic
981297944 4:143155081-143155103 CTGGAGCTGAAAAATGCAACTGG - Intergenic
982578298 4:157145915-157145937 CTGGAGCAGAACAAGTCAAAGGG + Intronic
983749204 4:171243575-171243597 CTGGAACAACAGAAAACAAAAGG + Intergenic
983780674 4:171666456-171666478 CAGGAGCAGGAGAAAGAAAAAGG - Intergenic
985100425 4:186452859-186452881 CTTTATCAGCAGCATGCAAATGG - Intronic
985444431 4:190013835-190013857 CTGGAGCTGAAAAATGCAATTGG + Intergenic
985981990 5:3477735-3477757 TTGGTGCAAGAGAATGCAAAAGG + Intergenic
986660978 5:10059858-10059880 CAGCAGCAGCACAATTCAAATGG + Intergenic
987238816 5:15971771-15971793 CTGGAGCAGGAGTTTGAAAAGGG - Intergenic
987726873 5:21714766-21714788 CTGGAGCAATATAATGCCAAGGG - Intergenic
987823251 5:22992616-22992638 CTGGAGCTGAAAAATGCAATTGG + Intergenic
987857472 5:23439459-23439481 GTGGAGCTGAAGAAAGCAAAAGG - Intergenic
989629135 5:43462618-43462640 CTGGAGCTGAAAAATGCAATTGG + Intronic
990252425 5:53929801-53929823 ATGGTGTGGCAGAATGCAAATGG + Intronic
990370697 5:55115112-55115134 CTGAAGCAGCTTAATGAAAAAGG + Intronic
990593105 5:57285193-57285215 CTGGAGCTGAAAAATGCAATTGG + Intergenic
991010068 5:61873049-61873071 CTTTATCAGCAGCATGCAAATGG - Intergenic
991514239 5:67416181-67416203 CTGGGCCAACAGAATGCAAAAGG - Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
993582458 5:89678914-89678936 CTGGAGCTGAAAAATGCAAATGG + Intergenic
994026483 5:95090429-95090451 CTGGAGCAGCAGCATTTAAGCGG - Intronic
994029748 5:95128095-95128117 CTTGAGGAGCAAAATGCTAAAGG + Intronic
994627958 5:102244216-102244238 CTGGAGCTGAAAAATGCAATTGG + Intronic
994764829 5:103902902-103902924 CTTTAGCAGCAGCATGAAAATGG - Intergenic
995096523 5:108241335-108241357 CTGGAGCTGAAAAATGCAATTGG + Intronic
995372016 5:111428565-111428587 CTGGAGCAGAAAAATGCAATTGG + Intronic
995579085 5:113574985-113575007 CAGGAGCAGCACAGAGCAAAAGG - Intronic
996138647 5:119876856-119876878 TTGGAGCAGCTGAATCTAAATGG + Intergenic
996927698 5:128847309-128847331 CTGGAGCTGAAAAATGCAATTGG + Intronic
997831833 5:137157074-137157096 CCGGGGCAGCAGAGTGTAAAGGG - Intronic
1000545459 5:162594909-162594931 GTGAATCAGCAGAATGTAAATGG + Intergenic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1002790315 6:432705-432727 CTGGAAAAGCACAATGGAAATGG - Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1004413704 6:15405199-15405221 CTGGAACAGCAGCATCAAAATGG - Intronic
1005449713 6:25960964-25960986 CTGGATCAGCAGTGTGAAAATGG + Intergenic
1005880497 6:30055245-30055267 ATGGATCATCAGAATGCAACAGG - Intergenic
1006173829 6:32110032-32110054 CTGAGGTAGGAGAATGCAAAGGG - Intronic
1006578786 6:35064683-35064705 CTGGGGCAGAAGAAGGCAAAAGG - Intronic
1007570072 6:42883445-42883467 CTGTAGCAGAAGAAAGGAAAAGG + Exonic
1008031798 6:46704847-46704869 CTTTAGCAGCTGAATGCAAACGG + Intronic
1008707448 6:54180645-54180667 CTGGAGCTGCAAAATGCAATTGG - Intronic
1009390861 6:63141550-63141572 CTGGAGCTGAAAAATGCAAGGGG + Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1010549012 6:77197898-77197920 ATGGGGGAGAAGAATGCAAATGG + Intergenic
1011102761 6:83742955-83742977 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1011508967 6:88079106-88079128 CTGTAGCATCTTAATGCAAATGG + Intergenic
1011528275 6:88290708-88290730 CAGGAGCAGAAGAATGCCCATGG + Intergenic
1012091608 6:94904114-94904136 CTGGAGCTGAAAACTGCAAATGG + Intergenic
1012194277 6:96319102-96319124 CTTTATCAGCAGAATGAAAATGG - Intergenic
1012483258 6:99691046-99691068 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1012620409 6:101338241-101338263 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1013627344 6:111951104-111951126 CTATGGCAGCAGAGTGCAAAGGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1016194616 6:141318396-141318418 CTGGAGCTGAAGAATTCAATTGG + Intergenic
1016251715 6:142050382-142050404 CTGGAGCTGAAAAATGCAATAGG + Intergenic
1016806049 6:148213012-148213034 CAGGGGCAGGAGAATGTAAAAGG - Intergenic
1016976905 6:149817806-149817828 CTTGAACAGCAAAATGGAAAGGG + Intergenic
1017315907 6:153031110-153031132 CTGGAGCAGGAGAATAAAACAGG + Intronic
1017318765 6:153063415-153063437 CTGGAGCTGAAAAATGCAATTGG + Intronic
1019099876 6:169620879-169620901 CTGGAGGAGCAGAGTGCAGGAGG - Intronic
1020764112 7:12299676-12299698 CTTTAACAGCAGCATGCAAATGG + Intergenic
1021886929 7:25148338-25148360 CTGAAGCAGGAGGATGCAGAAGG + Intronic
1022061274 7:26797861-26797883 CTGGAGCTGAAAAATGCAACTGG + Intronic
1022061308 7:26798385-26798407 CTGGAGCTGAAAAATGCAATTGG + Intronic
1022080381 7:27013913-27013935 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1023243136 7:38170738-38170760 CTGGAGCAGAAGAGACCAAAAGG - Intergenic
1024028701 7:45436967-45436989 GTGGGGCAGCAGAAAACAAACGG + Intergenic
1024661099 7:51496273-51496295 CTGGAGCTGAAGAAGGCAATTGG - Intergenic
1027900104 7:84102485-84102507 CTGGAGCAGCAGAGAGCCATTGG + Intronic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028817765 7:95167022-95167044 CTTCAGCAGCAGCATGAAAATGG - Intronic
1029797128 7:102908222-102908244 CTGGAGCTGAAAAATGCAATTGG - Intronic
1030119663 7:106096292-106096314 CTGGATCATAAGAATGGAAATGG - Intronic
1030541223 7:110832769-110832791 CTGGAGTATGAGAATGCAGAGGG + Intronic
1031379130 7:121063003-121063025 CTTCAGCAGCAGCATGAAAAAGG + Intronic
1031638963 7:124139083-124139105 CTGGAGCTGAATAATGCAATTGG - Intergenic
1034350446 7:150411669-150411691 CTGGAATAGCAGAATGCTCAGGG + Intronic
1034453813 7:151153291-151153313 TTGGGGCAGCAGAGAGCAAATGG - Intronic
1036071538 8:5445740-5445762 CAGCAGCTGAAGAATGCAAACGG - Intergenic
1037056400 8:14446718-14446740 CTGAATCAGCACAATGCAAATGG - Intronic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1038090231 8:24244811-24244833 CTTGATCAGCAGCATGAAAATGG + Intergenic
1038306221 8:26405496-26405518 CAAGAGCAGCAGAACGCACAGGG + Intronic
1038433526 8:27518847-27518869 CAGAAGCAGCAGAGTGCAAGAGG - Intronic
1038964568 8:32557447-32557469 CTGAAACAACAGAATGGAAAAGG - Intronic
1039190158 8:34964469-34964491 ATGGAACAGAAGAAGGCAAAGGG + Intergenic
1040511336 8:48099021-48099043 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1040767548 8:50931941-50931963 CTGGAGCAGGAGCAAGAAAATGG - Intergenic
1041140976 8:54819270-54819292 CTGGAGCTGAAAAATGCAAGTGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041842459 8:62288097-62288119 CTGTAGAAGCACAAGGCAAATGG - Intronic
1042928699 8:73992738-73992760 CTGGAAGAGGGGAATGCAAAAGG - Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1046068223 8:109221124-109221146 CTCTTGCAACAGAATGCAAAAGG + Intergenic
1047199079 8:122748726-122748748 CTTCATCAGCAGAATGAAAATGG - Intergenic
1047621686 8:126613942-126613964 CTTTATCAGCAGAATGAAAATGG + Intergenic
1048229922 8:132628487-132628509 CTGGAGCAGCCTAAAGCAGAGGG - Intronic
1048504279 8:135006648-135006670 CTGGTGCAGCAGAAACAAAATGG + Intergenic
1048859659 8:138714670-138714692 CAGGAGCAGCACAATCAAAATGG - Intronic
1049013408 8:139903247-139903269 CTGGAGAAGCCCAAGGCAAATGG - Intronic
1049321163 8:141997159-141997181 TTTGAGCAGCAGAATACAACAGG + Intergenic
1049518990 8:143078780-143078802 CTGGAGCATCAGAGGACAAAGGG + Intergenic
1050661842 9:7891469-7891491 CTTTATCAGCAGAATGAAAATGG - Intergenic
1051672738 9:19528495-19528517 CTGGAGCAAAAGAAAGAAAAAGG - Intronic
1051875676 9:21790821-21790843 CTGGAGCAGAGGTGTGCAAAGGG - Intergenic
1052224328 9:26066605-26066627 TTGTATGAGCAGAATGCAAATGG - Intergenic
1052365603 9:27608871-27608893 CTGGACCAGCAGAACTCAGAAGG - Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053632238 9:39955590-39955612 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1053773523 9:41507940-41507962 CTGAAGCAGCAAAGGGCAAAGGG - Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054211650 9:62295108-62295130 CTGAAGCAGCAAAGGGCAAAGGG - Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054313332 9:63553727-63553749 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055661404 9:78507402-78507424 CTCTAGCAGGAGAATGAAAAAGG + Intergenic
1056211085 9:84366202-84366224 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058951617 9:109909249-109909271 CTGAAGCAGGAGGATGCAGAAGG - Intronic
1058997638 9:110315453-110315475 CTGCTGCTGCAAAATGCAAAGGG + Intronic
1059279975 9:113124599-113124621 CTGGAGCAGAGGAAAGCAATTGG - Intergenic
1059528668 9:115016151-115016173 CAGGAGAGGCAGAAGGCAAAAGG - Intergenic
1060008383 9:120020699-120020721 CTTTATCAGCAGCATGCAAATGG + Intergenic
1060179406 9:121522670-121522692 CTTTAGCAGCAGCATGAAAATGG + Intergenic
1061586136 9:131570031-131570053 GTGGACCAGCAGAAAGGAAAAGG - Intergenic
1203372410 Un_KI270442v1:321048-321070 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1187639854 X:21275972-21275994 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1188078346 X:25806599-25806621 CTGGAGGAGAAAAATGCAATTGG - Intergenic
1188721367 X:33527423-33527445 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1189019748 X:37321671-37321693 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1189690352 X:43611617-43611639 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1189855610 X:45222170-45222192 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1189971923 X:46426451-46426473 CAGGAACACCAGAATGCAAATGG - Intergenic
1190015295 X:46821153-46821175 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1190517430 X:51238298-51238320 CTGGAGCATTTGAATGCAAATGG + Intergenic
1190787685 X:53668078-53668100 TTGGAGCTGAATAATGCAAAAGG - Intronic
1191052585 X:56210847-56210869 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1191650418 X:63530789-63530811 CTGGAGCTGAAAAATGCAACTGG + Intergenic
1191800113 X:65069448-65069470 CTGGAGCTGTAAAATGCAATTGG - Intergenic
1191926130 X:66312033-66312055 CTGGAGCAGAAGAATCCAAGTGG - Intergenic
1192062312 X:67840040-67840062 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1192304256 X:69943006-69943028 CTGGAGCTGAAAAATGCAATTGG - Intronic
1192305228 X:69952225-69952247 CTTTATCAGCAGAATGAAAATGG - Intronic
1192714621 X:73626603-73626625 CTGGAGCAGAAAAAAGCAATTGG - Intronic
1192977889 X:76305538-76305560 CTGGAGCTGAAGAATGCAATTGG - Intergenic
1193463347 X:81816940-81816962 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1193489557 X:82132801-82132823 CTGGAGCTGGAAAATGCAATTGG + Intergenic
1193561600 X:83023865-83023887 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1193697122 X:84722860-84722882 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1193887210 X:86997264-86997286 CTGGAGCTGAAGAATGCAATTGG - Intergenic
1193979395 X:88162711-88162733 CTAAAGGAGCAGCATGCAAATGG - Intergenic
1194586240 X:95737415-95737437 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1194653145 X:96539312-96539334 CTGAAGCAACAAAATGCAAAAGG + Intergenic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1195089975 X:101449517-101449539 CTGGAGCTGAAAAATGCAATTGG - Intronic
1195132270 X:101864763-101864785 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1195172093 X:102279972-102279994 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1195186767 X:102407121-102407143 CTGGAGCTGAAAAATGCAACTGG + Intronic
1195834733 X:109101744-109101766 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1195848990 X:109263120-109263142 CTGGAGCTGAAAAATGCAACTGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196232315 X:113238677-113238699 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1196243335 X:113369282-113369304 CTGTAGCAGCTGAACACAAAAGG + Intergenic
1196537212 X:116861573-116861595 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1196613924 X:117745070-117745092 CTGGAGCTGAAAAATGCAACTGG + Intergenic
1196625508 X:117872660-117872682 CTGGAGCTGAAAAATGCAATTGG + Intergenic
1196984388 X:121252626-121252648 CTGGAGGTGAAAAATGCAAATGG - Intergenic
1197527128 X:127577193-127577215 CTTTATCAGCAGCATGCAAATGG - Intergenic
1197633949 X:128892913-128892935 CAAAACCAGCAGAATGCAAAGGG - Intergenic
1197876386 X:131113484-131113506 CTGGAGCTGAAAAATGCAATTGG - Intergenic
1198516986 X:137419356-137419378 CTGGAGCACCAAAATTCAATGGG - Intergenic
1198889091 X:141372584-141372606 CTGCAGCAGCATAATGCTAGAGG + Intergenic
1200279790 X:154767163-154767185 CTGCAGCAGCCGACTGAAAAGGG - Intronic
1200290080 X:154863503-154863525 CTGGAGTAGCAGAGCCCAAATGG - Intronic
1201261335 Y:12161691-12161713 CTTTAGCAGCAGAATGAAAACGG - Intergenic