ID: 1120015785

View in Genome Browser
Species Human (GRCh38)
Location 14:79471758-79471780
Sequence TGTCCTAGATTGAGTAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120015785 Original CRISPR TGTCCTAGATTGAGTAACTG GGG Intronic
904969829 1:34410813-34410835 TGTGCTTGATGGAGTTACTGGGG - Intergenic
905627023 1:39495840-39495862 TGTTCCAGATTGAGAAACTGAGG + Intronic
905669913 1:39784931-39784953 TGTTCCAGATTGAGAAACTGAGG - Intronic
907679388 1:56549648-56549670 TGTCCCAGCTGGGGTAACTGAGG + Intronic
910027910 1:82680526-82680548 TGTCCTGTTTTGAGGAACTGTGG - Intergenic
910044286 1:82892662-82892684 TCTTGTAGATAGAGTAACTGAGG + Intergenic
917683808 1:177395395-177395417 TGTCTAAGATTGATTGACTGGGG + Intergenic
920950479 1:210567706-210567728 TGTCCTAGATGGAGATGCTGTGG + Intronic
923763888 1:236874272-236874294 TGTCTTAGAATTAGAAACTGGGG + Intronic
1066594411 10:37034151-37034173 TGTCATGGAGTCAGTAACTGAGG - Intergenic
1068724250 10:60283247-60283269 TGTCCTAGACTCAGTATCAGTGG + Intronic
1069578900 10:69551659-69551681 TGTTCTAGATGGCGAAACTGAGG - Intergenic
1069914580 10:71779569-71779591 TGTCATAGATGGGGAAACTGAGG - Intronic
1071974194 10:90938660-90938682 TGTCCTAGTTTTGGTATCTGGGG + Intergenic
1072128369 10:92467745-92467767 TGTCCTGGTTTTAGTGACTGAGG + Intronic
1073950614 10:108804716-108804738 TTTCCTAGGTTGGGTCACTGAGG - Intergenic
1074635766 10:115315526-115315548 TGTTCTGGATTGAGAACCTGTGG + Exonic
1074951319 10:118339887-118339909 TGTCCTAGTCTGAATAACTAGGG + Intronic
1075084771 10:119407244-119407266 TTTCCTAGATAAAGAAACTGAGG + Intronic
1075623113 10:123942250-123942272 TGTTCAAGATGGAGTCACTGTGG - Intergenic
1080109113 11:28545885-28545907 TGTCCTAGAAAGAGTAATTTGGG + Intergenic
1081294175 11:41365022-41365044 CGTCCATGATTCAGTAACTGGGG - Intronic
1085081912 11:73641978-73642000 TGTGTTAGATTGAGTAACTGGGG + Intergenic
1086930831 11:92691194-92691216 TTTCCTAGATGAAGAAACTGAGG + Intronic
1091069385 11:132548986-132549008 TGTCCAAGATGGAGTCACTCTGG - Intronic
1091996114 12:4995528-4995550 TTTTCTAGATAGAATAACTGAGG + Intergenic
1095302181 12:40597833-40597855 TATCCTAGATTGAGTTTTTGAGG + Intergenic
1098223934 12:68301335-68301357 TATTCTAAATTGAGTAACTCAGG + Intronic
1098957876 12:76706159-76706181 TGTCCCAGATTGAGGCAATGGGG - Intergenic
1102077147 12:110068697-110068719 TATCCCAGTTTCAGTAACTGAGG + Intronic
1104294739 12:127501873-127501895 GGTCCTAGATTGAGAGACTCTGG + Intergenic
1107083539 13:36400806-36400828 TGTACTATATTGAATAACAGTGG + Intergenic
1109299421 13:60575477-60575499 TGTCTTAGGTTGAGAAACAGAGG + Intergenic
1109678731 13:65717346-65717368 TATCCTAAATTAAGTAACTCAGG - Intergenic
1111913176 13:94334502-94334524 TGTCCTAGATTCTGAAACAGTGG + Intronic
1113819077 13:113198895-113198917 TGTCATAGGTTTAGTAAGTGAGG + Intronic
1114431915 14:22669103-22669125 TATCCTGGTTTGATTAACTGAGG - Intergenic
1114761287 14:25317908-25317930 AGTCCTATGTTGAATAACTGTGG + Intergenic
1117196259 14:53342679-53342701 TGTCCTAGTTTGAGTACCTTGGG - Intergenic
1118106027 14:62660486-62660508 TGTCCTTCATTGTGTTACTGTGG - Intergenic
1118607813 14:67515887-67515909 TTTCCAAGATGGAGAAACTGAGG + Intronic
1119627279 14:76189728-76189750 AGTCCTAAATTGAGTAACAGTGG + Intronic
1119684543 14:76621000-76621022 TGTCCTAGATGAAGAAAGTGAGG - Intergenic
1120015785 14:79471758-79471780 TGTCCTAGATTGAGTAACTGGGG + Intronic
1124460345 15:29884493-29884515 TGTCCAAGATAGAGTAGCAGAGG + Intronic
1126967136 15:54066988-54067010 TGTCTTAGATGGAGTGAGTGTGG - Intronic
1128556481 15:68635268-68635290 TGACCTATTTTGAGGAACTGAGG - Intronic
1131680499 15:94717029-94717051 TGTAATAGATTGGGAAACTGAGG + Intergenic
1131859997 15:96642684-96642706 TAACCTAGATTGAGAAACTTTGG - Intergenic
1133377239 16:5297724-5297746 TGTCCTAAATTGAGAAACACTGG - Intergenic
1135698663 16:24612308-24612330 TTTCCAAGATGGAGAAACTGAGG + Intergenic
1137239978 16:46647930-46647952 TGTCCAAGCTGGAGTAACAGTGG - Intergenic
1137439924 16:48489689-48489711 TGTCCTAGGTTAGGAAACTGAGG + Intergenic
1138157778 16:54721920-54721942 TGTCCTAGATGAGGAAACTGAGG + Intergenic
1138526383 16:57610124-57610146 TGTCACAGATGGAGAAACTGAGG + Intergenic
1142836533 17:2592019-2592041 TGTCTTTTATTGAGAAACTGAGG + Intergenic
1144140244 17:12341108-12341130 TGGCCTAGCTAGAGTTACTGGGG - Intergenic
1144844091 17:18206965-18206987 GGTCCTAAACTGAGTACCTGTGG - Exonic
1144961476 17:19046661-19046683 TTTCCTAGATGGAGAATCTGAGG + Intronic
1144973684 17:19127863-19127885 TTTCCTAGATGGAGAATCTGAGG - Intronic
1150809312 17:68344285-68344307 ACTCCCAGATTGAGAAACTGGGG + Intronic
1151157265 17:72134078-72134100 TATCCCAGGTTGAGTAAATGGGG - Intergenic
1156025312 18:32646687-32646709 TGTGTTTGATTGAATAACTGGGG + Intergenic
1156638127 18:39055744-39055766 TGTACTCAAATGAGTAACTGAGG + Intergenic
1159475375 18:68914307-68914329 GGTCCTAGGCTGAGTGACTGCGG + Intronic
1159932127 18:74323909-74323931 TGTCCCAGGCTGAGTAAGTGTGG + Intronic
1161453144 19:4357691-4357713 TTTCATAGATGGAGAAACTGGGG - Intronic
1163499208 19:17665618-17665640 TTTCTTAGATGGAGAAACTGAGG - Intronic
1166482107 19:43183177-43183199 TGTCCTGGACTGTGGAACTGGGG - Intronic
926803153 2:16679983-16680005 TGACCTAGATTGAGAAAAAGAGG - Intergenic
928273525 2:29878414-29878436 TTTTATAGATTGAGAAACTGAGG + Intronic
931539088 2:63308991-63309013 TATCCTAGTTGTAGTAACTGAGG + Intronic
937622658 2:124006736-124006758 TGTCGTAGTTTGAGTAAGTGTGG + Intergenic
938721836 2:134074339-134074361 TGTCCTAGATTGGTTAATTGGGG - Intergenic
940773563 2:157863741-157863763 TTTCCTAAAATGAGTAACTAAGG + Intronic
945501782 2:210584640-210584662 TGTCATAGATGAAGAAACTGAGG + Intronic
948576053 2:238950320-238950342 TGTCTCAGATGGACTAACTGAGG - Intergenic
1168828357 20:829513-829535 ATTCCTAGATTGAGAAAGTGAGG - Intergenic
1169293311 20:4371269-4371291 TGTCCCATATTTAGGAACTGGGG + Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1171568296 20:26217543-26217565 GGTCCCAGTCTGAGTAACTGTGG - Intergenic
1173228846 20:41178561-41178583 TTTCCTAGATTTTGTATCTGTGG - Exonic
1173986086 20:47262657-47262679 TGTGCTTAATAGAGTAACTGGGG - Intronic
1174030674 20:47623335-47623357 TTTTCTAGATGAAGTAACTGAGG + Intronic
1174401064 20:50276253-50276275 TTTCATAGATGGAGGAACTGAGG - Intergenic
1174581483 20:51575063-51575085 TCTCCCAGAGTGAGTGACTGAGG + Intergenic
1175662454 20:60825724-60825746 TGTCCAAGATAGAGTAATTTGGG - Intergenic
1179483375 21:41692803-41692825 CGTCTTAGGTTCAGTAACTGAGG + Intergenic
1180920435 22:19518901-19518923 TGTCCTAGGGTGAGTTACAGGGG + Exonic
1181289437 22:21779882-21779904 TGTTCTAAATTGAGTAACACTGG - Intronic
1183335150 22:37242081-37242103 TTTTCTAGATGGAGAAACTGAGG - Intronic
1184096634 22:42319677-42319699 TTTCCCAGATGGAGGAACTGAGG + Intronic
950499576 3:13355084-13355106 TGTCATAGCTGGAGAAACTGAGG - Intronic
951249031 3:20372767-20372789 TGTGGTAGATTGAGTAGGTGAGG - Intergenic
951309176 3:21103020-21103042 TGTCCTAGAATGAGTTAGGGAGG + Intergenic
951734409 3:25848647-25848669 TGTCCCAGTTTGAGTGAGTGTGG + Intergenic
953882964 3:46701127-46701149 TGTCCCAGATGGAGAAACTGAGG + Intergenic
954106055 3:48410359-48410381 GGTCCCAGATGGAGCAACTGTGG - Exonic
956533161 3:70243909-70243931 TTTCCTAGAGTAAGTAACAGAGG + Intergenic
959104929 3:102054763-102054785 TGTCCTAGACTGAGTGAGTGTGG - Intergenic
963460383 3:145606139-145606161 AGTACTACATTGAGTAACAGTGG + Intergenic
965807590 3:172558237-172558259 TTTTCTAGATAGAGAAACTGAGG - Intergenic
967306835 3:188067546-188067568 TTTCCCAGATGAAGTAACTGAGG + Intergenic
967503791 3:190230369-190230391 TATCCCAGATTCAGTTACTGTGG - Intergenic
969050895 4:4372174-4372196 TTTTCCAGATTAAGTAACTGAGG - Intronic
969320646 4:6410391-6410413 TGGCCACGAGTGAGTAACTGGGG + Intronic
971743061 4:30544839-30544861 TGATCTACATTGAGTATCTGGGG + Intergenic
972963644 4:44484502-44484524 TTTCAGAGATGGAGTAACTGTGG + Intergenic
974336393 4:60551261-60551283 TGTATTTGATTGAGTAACTGAGG - Intergenic
975074654 4:70190645-70190667 TGCCCTAGATTGAGTAATCTGGG + Intergenic
976378732 4:84375367-84375389 TGCCATAGATGGAGTAACTAGGG - Intergenic
976586618 4:86804478-86804500 TGTTATAGATTGTGAAACTGAGG + Intronic
978415246 4:108468010-108468032 TGTCTTAGTTTGAGTTCCTGTGG + Intergenic
980379604 4:131994917-131994939 TGTTCTAAATTAAGTAACTCAGG - Intergenic
982977431 4:162082779-162082801 TGTCCTTGCTTAAGTATCTGTGG - Intronic
989668144 5:43881296-43881318 TCTCTTAGATTGAGTAACTTGGG - Intergenic
993682155 5:90892921-90892943 TGGCCAAGATGGAGTAACAGGGG + Intronic
994345114 5:98675407-98675429 AGTGCTATATTGAGTAACAGTGG - Intergenic
996708466 5:126520740-126520762 TCTCCTAGATTTAGTGTCTGGGG - Intergenic
997003445 5:129789628-129789650 AGTCCTATATTGAATAACAGTGG - Intergenic
997049095 5:130357747-130357769 TCTACTATATTGAGGAACTGAGG - Intergenic
998471245 5:142385628-142385650 TGTCTCAGATTGAGAAACTGAGG - Intergenic
999515275 5:152295986-152296008 TGTCTTAGATTGAATACCTCTGG + Intergenic
999871776 5:155758815-155758837 TGGCCTAGACTGACTGACTGTGG + Intergenic
1000387466 5:160688308-160688330 TGTTTAAGATTGAGTATCTGAGG + Intronic
1000583876 5:163070606-163070628 TGTACTATATTGAATAACAGTGG + Intergenic
1001498946 5:172213451-172213473 TGTACTAGATAGATTAATTGGGG - Intronic
1001884695 5:175278729-175278751 GGTCCTACCTTGAGTAACTGTGG - Intergenic
1006231721 6:32593890-32593912 TGTCCTCCATTGAGGAACTTTGG + Intergenic
1007102453 6:39258927-39258949 AGTCCTAAATTGAGTTACTCTGG + Intergenic
1010479364 6:76331728-76331750 TATCCTAGTTGGAGGAACTGAGG + Intergenic
1010794567 6:80104577-80104599 TTTCCCAAATTGAGTAAATGTGG + Intergenic
1012729687 6:102866571-102866593 TGTCCTAAGTGAAGTAACTGGGG + Intergenic
1013759632 6:113501776-113501798 TGTCCTAGATTTGGTGACAGTGG + Intergenic
1014454056 6:121616520-121616542 AGTCCTAGATTAAGTAATTTTGG + Intergenic
1015270962 6:131338661-131338683 TGCCCTGGATTTAGTAACAGGGG - Intergenic
1016032790 6:139355503-139355525 TTTCATAGATAGAGAAACTGAGG - Intergenic
1017094972 6:150796751-150796773 TTTCATAGATGAAGTAACTGAGG + Intronic
1017457924 6:154619409-154619431 TGTCCAGGTTTCAGTAACTGTGG - Intergenic
1018037307 6:159892495-159892517 TGTCCTAGGCTGGGTATCTGGGG + Intergenic
1018160382 6:161035885-161035907 TTTTATAGATTGAGAAACTGAGG + Intronic
1021138438 7:16993796-16993818 TGAGCTAGATGCAGTAACTGGGG + Intergenic
1021681171 7:23133978-23134000 AGTACTATATTGAGTAACAGTGG + Intronic
1024530685 7:50389963-50389985 TTTCCTATATTGCCTAACTGAGG - Intronic
1025820455 7:64957761-64957783 TATGCTAGATGGAATAACTGTGG + Intergenic
1027270559 7:76516318-76516340 TTTTCTAGATGGAGAAACTGAGG + Intronic
1028370253 7:90083936-90083958 TGTCATAGATGAAGTAATTGGGG - Intergenic
1032644825 7:133811857-133811879 TGTCCTAGTTTCAGGAACTATGG + Intronic
1032884314 7:136121602-136121624 TTTCCTAGATTGAGAACCTCTGG + Intergenic
1033657683 7:143383939-143383961 TGTTAAAGATTGAGAAACTGAGG - Intronic
1034160274 7:148988975-148988997 TTTTCTAGATGGAGAAACTGAGG - Intergenic
1034734663 7:153417436-153417458 GGTACTTGATTGAGTAACTGAGG + Intergenic
1035355014 7:158271134-158271156 TGTGCCAGAGGGAGTAACTGTGG + Intronic
1036074431 8:5479150-5479172 TGTCAGAAATTGAGTATCTGAGG - Intergenic
1037118090 8:15250440-15250462 ACCACTAGATTGAGTAACTGTGG - Intergenic
1038290681 8:26247331-26247353 TTTCATAGATTAAGAAACTGAGG + Intergenic
1038635248 8:29281312-29281334 TGTCTTATATTCAGTAACTGAGG + Intergenic
1039663825 8:39497522-39497544 AGTACTATGTTGAGTAACTGTGG - Intergenic
1040774657 8:51026897-51026919 TGTCATACATTTAGTAACTTAGG - Intergenic
1044230925 8:89776804-89776826 TGGCCAAGATGGAGTAACTGGGG + Intronic
1044263955 8:90161044-90161066 TGTCTTAGAGTGAACAACTGTGG - Intergenic
1044923126 8:97186578-97186600 TGTCCTAGCTTGACTCATTGTGG + Intergenic
1045434666 8:102150032-102150054 TTTCATAGATGGAGAAACTGAGG + Intergenic
1045539733 8:103072016-103072038 TCTCCTAGGTTGAATAACTGAGG - Exonic
1046333253 8:112749693-112749715 TTTCCTAGCTTCAGCAACTGAGG - Intronic
1049576060 8:143390200-143390222 TGGCCTGGAGTGAGTGACTGTGG + Intergenic
1055695473 9:78878940-78878962 TGTTAAAAATTGAGTAACTGGGG - Intergenic
1056395980 9:86181520-86181542 TCTCTTAGGTTTAGTAACTGGGG + Intergenic
1057888763 9:98852158-98852180 TGTTCAAGATGGAGTTACTGTGG + Intergenic
1058133550 9:101280884-101280906 AGTCCTATATTGAATAACAGTGG - Intronic
1059354849 9:113690666-113690688 TTTCCTAGATAGACAAACTGTGG - Intergenic
1059956696 9:119523414-119523436 TTTCCTAGATAGAATCACTGGGG - Exonic
1060544993 9:124454317-124454339 TGTTCTAGATGGGGAAACTGAGG - Intronic
1061229739 9:129308260-129308282 TGTACAAGATGGAGAAACTGAGG + Intergenic
1062057477 9:134476004-134476026 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057482 9:134476024-134476046 AGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057487 9:134476044-134476066 GGGCCTAGAGTGAGGAACTGAGG - Intergenic
1062057490 9:134476064-134476086 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057495 9:134476084-134476106 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057508 9:134476144-134476166 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057521 9:134476204-134476226 GGACCTAGAATGAGGAACTGGGG - Intergenic
1062057530 9:134476244-134476266 AGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057535 9:134476264-134476286 GGGCCTAGAGTGAGGAACTGAGG - Intergenic
1062057538 9:134476284-134476306 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057543 9:134476304-134476326 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057548 9:134476324-134476346 GGGCCTAGAGTGAGGAACTGGGG - Intergenic
1062057553 9:134476344-134476366 GGACCTAGAATGAGGAACTGGGG - Intergenic
1062057576 9:134476464-134476486 AGACCTAGAGTGAGGAACTGGGG - Intergenic
1187755830 X:22525124-22525146 TCTCCTAGATGGAGTAACGGAGG + Intergenic
1187776081 X:22759549-22759571 AGTCCGAGATTGTATAACTGGGG - Intergenic
1188607931 X:32055938-32055960 TTTCCAAGATGGAGAAACTGAGG - Intronic
1188918891 X:35947371-35947393 TGCCCTAGAATGAGCAAATGTGG - Intronic
1188918919 X:35947580-35947602 TGCCCTAGAATGAGCAAATGTGG + Intronic
1191741747 X:64443506-64443528 TGTTCTAATTTGAGTAACTCTGG + Intergenic
1191926893 X:66322544-66322566 AGTCCTATGTTGAGTAACCGTGG - Intergenic
1191953207 X:66616838-66616860 TTTCTTAGATTAAGTAACCGAGG - Intronic
1194032546 X:88834481-88834503 TGTCCTAAATGAAGTAACTCAGG + Intergenic
1199066955 X:143430680-143430702 TGTTCTAGATTTAGAAAATGTGG - Intergenic
1199538720 X:148933351-148933373 TGGCCTAGATTGAGTGAATTGGG + Intronic