ID: 1120016408

View in Genome Browser
Species Human (GRCh38)
Location 14:79478951-79478973
Sequence CACCTTTTGGAGCTTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120016404_1120016408 11 Left 1120016404 14:79478917-79478939 CCTTATCTTGTTCATCTCTCAGC 0: 1
1: 0
2: 2
3: 18
4: 259
Right 1120016408 14:79478951-79478973 CACCTTTTGGAGCTTCAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120016408 Original CRISPR CACCTTTTGGAGCTTCAGTT TGG Intronic
902200111 1:14826999-14827021 CACCTATTGGAGCTGCCGTGAGG + Intronic
905446347 1:38030559-38030581 CCCCTCTGGGGGCTTCAGTTAGG - Intergenic
908363447 1:63392784-63392806 TACCTATGGGAGCTTCACTTGGG - Intronic
910747353 1:90588366-90588388 CATCTTTTGGAGCTTTCATTTGG - Intergenic
914725019 1:150320243-150320265 GACATTTTGGAACTTTAGTTTGG + Intergenic
915107592 1:153544020-153544042 CTCCTTTGGGAGGTCCAGTTTGG + Intronic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
921360576 1:214327911-214327933 CACACTTTGGGGCTTCTGTTTGG + Intronic
921796998 1:219357615-219357637 CACCATTTTGAGCAGCAGTTTGG + Intergenic
922244424 1:223781257-223781279 CAGCATTTGGAGCTTCTATTAGG + Intronic
922597996 1:226828366-226828388 TTCCTTTTGGAGCCTCAGTCAGG - Intergenic
923483244 1:234404394-234404416 CAACTTTGGTAGCTTGAGTTTGG + Intronic
1063649142 10:7915730-7915752 CACCTTTGGGAGGTTGAGGTGGG + Intronic
1064860483 10:19820058-19820080 CAAGTTTTGGAGCTTGAGGTTGG + Intronic
1065313662 10:24440929-24440951 CACCTTTTGGCTCTGCAGGTTGG + Intronic
1065324966 10:24542751-24542773 CACCTTTTGGAATTCCATTTGGG - Exonic
1065851791 10:29796364-29796386 GACCTCCTGCAGCTTCAGTTGGG - Intergenic
1066043288 10:31574491-31574513 CACCTTGTTCAGCTTCAGCTGGG - Intergenic
1067722816 10:48742561-48742583 CATCTCGTGGAGCTTCAGTCTGG + Intronic
1071495001 10:86162181-86162203 CACCTTTTGGGGCTTTGGGTGGG + Intronic
1081426396 11:42930747-42930769 CACCTTTTTGAGGTTATGTTTGG - Intergenic
1083191643 11:61056587-61056609 CACCTTTGGGGGCTTCAGGATGG - Intergenic
1084507794 11:69580145-69580167 CTCCTTTTGAAGCTTCTTTTTGG + Intergenic
1084556582 11:69879521-69879543 CACCTTTTGGAGCTGCTAGTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088117033 11:106324001-106324023 CAACTTTAGGAGGTTAAGTTGGG + Intergenic
1089449180 11:118579868-118579890 CACTTTTTGAATCATCAGTTTGG + Intronic
1090218722 11:124996074-124996096 CACCTTTGGGAGGCTCAGGTGGG - Intronic
1090410189 11:126502743-126502765 CACCTTTTGGAGATGCAAATCGG - Intronic
1092020282 12:5196514-5196536 AACCCTTTAGAGCCTCAGTTAGG + Intergenic
1098647539 12:72922472-72922494 CACTTTTTAGAGCTTGATTTTGG + Intergenic
1100612383 12:96202239-96202261 CACATCTTGCAGCTTGAGTTAGG - Intronic
1100860422 12:98799796-98799818 AACCTTTTGAAGCTTTAGTAGGG + Intronic
1101682826 12:106986253-106986275 CACCTCTCTGAGCCTCAGTTTGG + Exonic
1101809754 12:108097378-108097400 CATCTTTTGTGGCTTCATTTGGG + Intergenic
1102188970 12:110971486-110971508 CACATGTTGGAGCCTCAGTTGGG - Intergenic
1103021279 12:117536383-117536405 AACCTTTTGGAAGTACAGTTGGG - Intronic
1105827709 13:24137221-24137243 CACCCCTTTGGGCTTCAGTTGGG + Intronic
1106245683 13:27947895-27947917 CAGCGTCTGGAGCCTCAGTTAGG - Intergenic
1106359519 13:29017738-29017760 CACCTTTTTGAGCTGAGGTTAGG + Intronic
1107332723 13:39319303-39319325 CACCTCATGGAGCTGGAGTTGGG - Intergenic
1109807274 13:67460068-67460090 CATGTTGTGTAGCTTCAGTTAGG - Intergenic
1113433132 13:110267347-110267369 CATCTTTGTGAGCTTGAGTTGGG - Intronic
1115797330 14:36952819-36952841 CACCTTCTGTAGCTTGGGTTTGG + Intronic
1118652713 14:67914835-67914857 CACCTTATTCAGCTTCAGATGGG - Intronic
1119428865 14:74552776-74552798 CAACTTGTGGAGCCACAGTTTGG + Intronic
1120016408 14:79478951-79478973 CACCTTTTGGAGCTTCAGTTTGG + Intronic
1124515084 15:30361066-30361088 CAGCTTTTGGGGCTGCAGCTGGG + Intergenic
1124727838 15:32169661-32169683 CAGCTTTTGGGGCTGCAGCTGGG - Intronic
1133316846 16:4890181-4890203 CACCTTCTGGTTCTTCAGCTTGG + Exonic
1133367835 16:5225089-5225111 CACCTCTTGGGGCTGCAGTGAGG - Intergenic
1133503363 16:6386515-6386537 CACCTTTTCGAGCTTATATTTGG + Intronic
1133638143 16:7689983-7690005 CTACTTTTGCAGCTTCTGTTTGG - Intronic
1134415249 16:14037854-14037876 CACTTTTTGGAACTCCAATTAGG + Intergenic
1135948134 16:26883891-26883913 CACCTTTGTGTGCTTCAGCTTGG - Intergenic
1136743846 16:32565490-32565512 CACTTTTTGGAGAATCAGTGTGG + Intergenic
1140029996 16:71328075-71328097 CACATTTTGGAGCTGGGGTTAGG + Intergenic
1203025751 16_KI270728v1_random:509743-509765 CACTTTTTGGAGAATCAGTGTGG - Intergenic
1203045970 16_KI270728v1_random:824688-824710 CACTTTTTGGAGAATCAGTGTGG + Intergenic
1143222924 17:5277436-5277458 CACCTTTTGGGTTGTCAGTTGGG + Intergenic
1145796531 17:27658759-27658781 CAGCTTTTGGAGCAGCAGCTGGG + Intergenic
1145810966 17:27764035-27764057 CAGCTTTTGGAGCAGCAGCTGGG + Exonic
1151221874 17:72618934-72618956 CATCTTCTAGATCTTCAGTTGGG - Intergenic
1155540482 18:26863815-26863837 CACCTTGTGGAGCTTCTCTGGGG + Intronic
1157969355 18:52248487-52248509 CACCTTGGACAGCTTCAGTTAGG - Intergenic
1158325804 18:56313018-56313040 TAACCTTTTGAGCTTCAGTTTGG + Intergenic
1158911106 18:62063621-62063643 CACCTTTTGTAATTTCAATTAGG - Intronic
1159786061 18:72715801-72715823 CACCTTTTGTAGTTTCATTTAGG + Intergenic
1162901335 19:13796742-13796764 CCCCTTTTTCAGCTTCAGTGTGG + Intronic
1168602420 19:57728379-57728401 AACTTTTGTGAGCTTCAGTTTGG + Intronic
925970271 2:9101677-9101699 CACCGTTAGGAGCTGCAGGTAGG - Intergenic
928466289 2:31525973-31525995 GGCTTTTTGAAGCTTCAGTTGGG + Exonic
930446066 2:51473973-51473995 CACTTTTTGAAGCTTCTCTTTGG + Intergenic
932376397 2:71239766-71239788 CAGTTTGTGGAGCTTCAGGTTGG + Intergenic
936171028 2:110174708-110174730 CACCATGTTCAGCTTCAGTTGGG - Intronic
936174774 2:110210195-110210217 CAACTCTTGGAGCCTCAATTAGG + Intergenic
937729806 2:125214903-125214925 CACATTTTGGAGATTGAGTTTGG + Intergenic
940373290 2:152925104-152925126 CTTCTTTTAGTGCTTCAGTTTGG + Intergenic
940585016 2:155636731-155636753 CACCTCTTGTACCTCCAGTTTGG + Intergenic
1172184985 20:33025936-33025958 CACCCTTTGGTCATTCAGTTAGG + Intergenic
1172468992 20:35176895-35176917 AACCTTCTGGTGTTTCAGTTGGG - Exonic
1176065869 20:63194388-63194410 CAGCATTTGGAGCTGCAGGTGGG + Intergenic
1176909576 21:14548019-14548041 CATCTTTTAGACTTTCAGTTTGG + Intronic
1177852690 21:26367268-26367290 CACCTGTTGGATCTCCACTTTGG - Intergenic
1178290801 21:31366409-31366431 CACCCTTTGGCTCCTCAGTTTGG + Intronic
1178311777 21:31535860-31535882 CACCTGATGGGCCTTCAGTTTGG - Intronic
1181104296 22:20564450-20564472 CACCTGCTGGAGCTGCAGCTGGG - Exonic
956428676 3:69163004-69163026 AACCTTCTTGAGCTTCTGTTTGG + Intergenic
958047694 3:88304842-88304864 CACCTTTTAGAGTTTCAGAAAGG + Intergenic
961226972 3:125258689-125258711 AATCTTTTAGTGCTTCAGTTTGG + Intronic
968197288 3:196717935-196717957 CACCTTGCGAAGCTTCAGTTTGG - Intronic
969319287 4:6402065-6402087 TACCTTCTGGGGCTTCAGTGAGG + Intronic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
978946180 4:114500478-114500500 CTTCTTTTGGAACTCCAGTTAGG + Intergenic
988664709 5:33312949-33312971 GGCCTTTTGGAGCTTGAGGTAGG + Intergenic
989280610 5:39638551-39638573 CTTCTTTTGGAGCTTGAGTTAGG + Intergenic
989320038 5:40123272-40123294 CATCTTATGGAGCTGCAGCTGGG - Intergenic
993909887 5:93668349-93668371 CACTTTTTGGAGGCTGAGTTGGG - Intronic
995987112 5:118190431-118190453 AATTTTTTGGAGCTTCAGTAGGG + Intergenic
998391245 5:141788345-141788367 TCCCTAGTGGAGCTTCAGTTGGG - Intergenic
1003283269 6:4712386-4712408 CACCCTTTCTACCTTCAGTTGGG - Intronic
1003755720 6:9117522-9117544 CACCTTTTTGACTTTTAGTTTGG + Intergenic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1008881144 6:56381637-56381659 CAACTTTTGTAGCTTATGTTCGG - Intronic
1009773002 6:68167801-68167823 CACATATTTGAGTTTCAGTTTGG + Intergenic
1011556190 6:88573393-88573415 GACCTGGTGGAGCTCCAGTTTGG + Intergenic
1015647819 6:135414364-135414386 CACCTTTGTGAGCTTGGGTTAGG + Intronic
1016083965 6:139889620-139889642 CCCCTTTTGGAGCTTTGTTTTGG + Intergenic
1024124828 7:46282870-46282892 AAACTTTTGGAGCTTGAGGTTGG + Intergenic
1025024445 7:55504843-55504865 CACTTATTGGAGCTTCAGGCAGG + Intronic
1025535265 7:61939850-61939872 CACTTTTTGGAGGATCAGTGAGG + Intergenic
1032990108 7:137384654-137384676 GACATGTTTGAGCTTCAGTTGGG - Intronic
1033732055 7:144189669-144189691 GACCTTATGGATCTTCACTTTGG + Intronic
1033742904 7:144288252-144288274 GACCTTATGGATCTTCATTTTGG + Intergenic
1033750998 7:144361362-144361384 GACCTTATGGATCTTCATTTTGG - Intronic
1033826432 7:145195992-145196014 AACCTTTTTGACCTTGAGTTAGG - Intergenic
1038711643 8:29952357-29952379 CACCTTCTGGATCTTCAGAATGG + Intergenic
1041214012 8:55581897-55581919 CTCCTTTGGGAGCTGCAGTGAGG - Intergenic
1043397915 8:79856631-79856653 CTCCTTATGGGGCTTCGGTTAGG - Intergenic
1045031086 8:98136918-98136940 CAGCTTTTATTGCTTCAGTTAGG - Exonic
1045697845 8:104830728-104830750 CCCCTTTTGGAGATTCACTAGGG - Intronic
1046159019 8:110334558-110334580 CACTTTTTGGTGCTTCCTTTTGG - Intergenic
1046323718 8:112613016-112613038 CACCTTTTGGAGGTTAAGGTGGG - Intronic
1047333787 8:123917250-123917272 CACATTTAGGAGATTCAATTTGG + Intronic
1048145172 8:131834681-131834703 CACCCTTTGGAGCTTTAATGAGG - Intergenic
1049787786 8:144459323-144459345 CACCTTCTGGAGTCTCAGGTGGG - Intronic
1051844513 9:21436292-21436314 TAAGTTTTGGAGCTACAGTTTGG - Intronic
1052785300 9:32822642-32822664 CACTCTTTGGAGCATCACTTAGG + Intergenic
1053472406 9:38356379-38356401 CACCTCATGGAGCTGCAGTGAGG - Intergenic
1055944698 9:81682305-81682327 CATCTATTGAAGCTTGAGTTGGG - Intronic
1056380706 9:86054644-86054666 CACTTGTTGGAGCTGGAGTTTGG - Intronic
1060403507 9:123361589-123361611 CACCTTTGGGAGCTCCGGATGGG + Intronic
1061159367 9:128884322-128884344 GACCTCTTGGAGATTCAGGTGGG + Intronic
1188207048 X:27373128-27373150 CCCCTTTTGGTGTATCAGTTTGG - Intergenic
1188876480 X:35436626-35436648 CACGATATGGAGCTGCAGTTGGG - Intergenic
1189065617 X:37805149-37805171 TACCTTTTTGAGCTTCAGATTGG - Exonic
1194391485 X:93322641-93322663 CACCTCCTGCAGCTGCAGTTTGG - Intergenic
1196515236 X:116603325-116603347 CAACTTTTGAAGCATCGGTTGGG + Intergenic
1196736988 X:118988948-118988970 GTCCTTTTGGAGCTGGAGTTTGG + Intronic
1200211250 X:154347552-154347574 CAGCTTTGGGTGCTGCAGTTGGG + Intergenic
1202256940 Y:22931551-22931573 CACCTTCTGGAGCTGCAGGGTGG + Intergenic
1202409931 Y:24565299-24565321 CACCTTCTGGAGCTGCAGGGTGG + Intergenic
1202460851 Y:25104773-25104795 CACCTTCTGGAGCTGCAGGGTGG - Intergenic