ID: 1120017198

View in Genome Browser
Species Human (GRCh38)
Location 14:79487508-79487530
Sequence ACTCAAAACCCTATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120017196_1120017198 -2 Left 1120017196 14:79487487-79487509 CCTTTCAAGATGAAAATTGTTAC 0: 1
1: 0
2: 1
3: 26
4: 271
Right 1120017198 14:79487508-79487530 ACTCAAAACCCTATGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 148
1120017194_1120017198 30 Left 1120017194 14:79487455-79487477 CCCAATTCAGTGTCTCGTATCAA 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1120017198 14:79487508-79487530 ACTCAAAACCCTATGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 148
1120017195_1120017198 29 Left 1120017195 14:79487456-79487478 CCAATTCAGTGTCTCGTATCAAA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1120017198 14:79487508-79487530 ACTCAAAACCCTATGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120017198 Original CRISPR ACTCAAAACCCTATGCAGCT GGG Intronic
904568916 1:31445959-31445981 ACTCAGAACCCCCTGCAGCATGG - Intergenic
905651384 1:39659330-39659352 TCTCAAGACCCTGCGCAGCTGGG - Exonic
905952713 1:41965116-41965138 ACTCTAGACCCTATTCACCTTGG - Intronic
907064918 1:51471409-51471431 ACTTATAACCCTATGTAACTAGG + Intronic
907498043 1:54858170-54858192 AGTCAGCACCCTGTGCAGCTGGG - Intronic
911443621 1:97962827-97962849 TCTCAAAAACCTCTCCAGCTAGG + Intergenic
917269728 1:173259205-173259227 ACTCCAGACCCTATTCACCTGGG - Intergenic
920409938 1:205751013-205751035 ACTAATAAGCCTATGCAGTTAGG - Intergenic
922162163 1:223086107-223086129 ACTCCAAATCCTATGCATATGGG + Intergenic
922349533 1:224723834-224723856 ACTCAAAACCCTTTGCTGTTAGG - Intronic
923502376 1:234576298-234576320 CCTCAAATCCCTCTGCAGCCTGG + Intergenic
924517494 1:244779048-244779070 AATCAAATCCCTCTTCAGCTTGG + Intergenic
1064370377 10:14747582-14747604 ACTCCAGATCCTATGCATCTGGG + Intronic
1064988290 10:21232750-21232772 GCTCAAAACCCTGTGAAGCAGGG - Intergenic
1066270105 10:33813929-33813951 ACACAAAACCAAATGCAGCCAGG + Intergenic
1068051009 10:51949293-51949315 ATTCAAAGCCCAATGCAACTAGG - Intronic
1070825917 10:79390664-79390686 ACGGAAAACACTCTGCAGCTGGG + Intronic
1073243009 10:102070483-102070505 ACTCAAAACCTTCAGCAGCTGGG - Intergenic
1075282007 10:121147325-121147347 ACTCCAGACCCTATGCCCCTGGG + Intergenic
1076667634 10:132102213-132102235 GGACAAAACCCTAGGCAGCTTGG - Intergenic
1078441638 11:11373065-11373087 ACCCAAAACCCTTTGCAACCTGG - Intronic
1080486970 11:32718707-32718729 AGTGGAAACCCTCTGCAGCTGGG + Intronic
1081800196 11:45853556-45853578 AATCAAAGTCCTATGCAGCCTGG + Intronic
1082834657 11:57642756-57642778 CCTCAAAACCCTATTCCTCTTGG - Intergenic
1083188743 11:61034560-61034582 GCTCAGACCCCTAAGCAGCTGGG - Intergenic
1084568376 11:69944402-69944424 TTCCAAAACCCTGTGCAGCTTGG - Intergenic
1085127515 11:74011672-74011694 CCTCACAACCCCATGAAGCTGGG + Intergenic
1088037511 11:105334832-105334854 ACTCCAGACCCTATTCACCTGGG - Intergenic
1088721439 11:112595549-112595571 ACTCAAGACCCCTTGCTGCTTGG - Intergenic
1088822823 11:113470966-113470988 AATCAATACCCTTGGCAGCTGGG - Intronic
1097392608 12:59033798-59033820 ACTCACAATCCAATCCAGCTGGG - Intergenic
1098072677 12:66692975-66692997 TCTCAACACCCTATGAAGTTAGG - Intronic
1098521753 12:71440749-71440771 ACTAAAAACCCTTTGGAGCTGGG - Intronic
1101521495 12:105486287-105486309 ACTCAGACCCCTAAGTAGCTGGG - Intergenic
1101986204 12:109449429-109449451 ATTTAAAACACTATGCAGCCAGG + Exonic
1105846493 13:24298538-24298560 GCTCAAAACCCTAAAGAGCTTGG - Intronic
1107848998 13:44551287-44551309 ACCCAAAACCCCAATCAGCTGGG + Intronic
1108357648 13:49642041-49642063 ACCAAGAACCCTGTGCAGCTGGG + Intergenic
1109825872 13:67721469-67721491 ACTCCAAACTCCATGCTGCTAGG - Intergenic
1110361638 13:74631897-74631919 GCTAAAACCCCTATGCAGCTGGG - Intergenic
1116739997 14:48742243-48742265 TCCCAAAAAGCTATGCAGCTGGG + Intergenic
1117328901 14:54693565-54693587 CCTCAACATCCTAAGCAGCTCGG - Intronic
1117751143 14:58924615-58924637 ACTCCAGACCCTATTCACCTGGG - Intergenic
1118926909 14:70199569-70199591 ACTCCAGACCCTGTTCAGCTGGG + Intergenic
1120017198 14:79487508-79487530 ACTCAAAACCCTATGCAGCTGGG + Intronic
1120804867 14:88736626-88736648 AGACAAATCCCTATGCAGATAGG + Intronic
1122316431 14:100828255-100828277 ACTCAAAACCCAAGGTAGCGGGG - Intergenic
1126219523 15:46196936-46196958 ACTCCAGACCCTATTCATCTTGG + Intergenic
1129079363 15:73025513-73025535 GCTCAAAACCTTATGGAGCCAGG + Intergenic
1129291592 15:74572346-74572368 ATTCAAAACCCTAAGCCGCATGG - Intronic
1137950914 16:52782451-52782473 ACTAAAAACCCCATGAAGGTAGG + Intergenic
1140256211 16:73338455-73338477 AGTCAAAATCCTCTGCAGCTTGG + Intergenic
1140669992 16:77269014-77269036 ACTCCAGACCCTATTCACCTGGG + Intronic
1140959352 16:79897219-79897241 TCCCAGAACCCTTTGCAGCTAGG - Intergenic
1140966547 16:79971898-79971920 ACTCAAAACCTTATGGAATTTGG + Intergenic
1142728129 17:1831176-1831198 ACTTAAAACCCTCTGAAGCATGG - Intronic
1144012643 17:11164071-11164093 ACTCCAGACCCTATTCACCTGGG - Intergenic
1146783569 17:35698261-35698283 ACACAAAATCCAGTGCAGCTGGG - Intronic
1152679182 17:81656874-81656896 CCCCAAAACCCTCTGCAGCCTGG + Intronic
1155825686 18:30439574-30439596 ACTGAAAAGCCTATGAAGGTAGG + Intergenic
1156384071 18:36590300-36590322 AGTCAAAACCCTTGGAAGCTTGG - Intronic
1157494243 18:48143840-48143862 ACTCACCACCCTCTGCACCTTGG + Intronic
1157789748 18:50521025-50521047 ACTCAAAGACATTTGCAGCTGGG + Intergenic
1158387727 18:57013962-57013984 TCTCATAACCCTATGCAGCCTGG - Intronic
1159200133 18:65173191-65173213 ACTAAAAAACTTTTGCAGCTGGG + Intergenic
1159375106 18:67583081-67583103 ACTCATAACCCTGCCCAGCTGGG + Intergenic
1162403217 19:10458386-10458408 ACACCAATCCCTCTGCAGCTGGG - Intronic
925474266 2:4195184-4195206 TCTCAAAACACTATGTAGTTTGG - Intergenic
928045329 2:27925468-27925490 ACTGAAAACCCAATGCAGGTAGG - Intronic
929069228 2:38011997-38012019 GCTCAAAACCCTTTGCTGCTGGG + Intronic
932302011 2:70674110-70674132 TCTCAAACCCCTCTCCAGCTAGG - Intronic
934734534 2:96683119-96683141 ACTCCAAACCCTAAGCCGTTGGG - Intergenic
936977228 2:118232331-118232353 AATCAAAAGCCTATTCAGGTTGG + Intergenic
939022859 2:136980052-136980074 ACTCCATACCCTATTCACCTGGG + Intronic
940124951 2:150312163-150312185 ACTCCAAACCCTGTTCACCTGGG - Intergenic
940712871 2:157183585-157183607 TCTAAAAATCCTATGCATCTCGG + Intergenic
942023827 2:171893917-171893939 ACTCACAATCCCATGCACCTAGG + Intronic
944522110 2:200582320-200582342 ATTCACAACCCTATGGGGCTAGG + Intronic
944958350 2:204838508-204838530 ACTCAAAACCTGATGCAGCCAGG - Intronic
946211284 2:218149317-218149339 ACTCAAAACCCTTTGTGGTTTGG - Intergenic
1168759421 20:339255-339277 GCTAAAAAGCCTATGAAGCTGGG - Intergenic
1168836958 20:883925-883947 CCTCAAACCCCTACTCAGCTGGG + Intronic
1174718333 20:52784352-52784374 ACTCAAAATTCTATGTGGCTGGG + Intergenic
1178329738 21:31677491-31677513 TCTCACAACCCTATGTAACTGGG + Intronic
1180704539 22:17801074-17801096 ACTCATAACCCTTTGAAGGTGGG - Intronic
1181813408 22:25419663-25419685 ACTGAAAACCCCAGGCAGCGGGG + Intergenic
1182571526 22:31242886-31242908 GCTCATAACCCTGTGAAGCTGGG + Intronic
1183836838 22:40461355-40461377 ACTTAAAACCAAATCCAGCTGGG + Intronic
949183596 3:1164662-1164684 ACTCAGAAGCCTATGCAACTTGG + Intronic
949385877 3:3501851-3501873 ACAGAAAAGCCTATGCAGATGGG - Intergenic
951041892 3:17997449-17997471 TCTGAAAACCCTCTGCTGCTTGG + Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
954529152 3:51303698-51303720 ACTCCAGACCCTATTCACCTGGG + Intronic
955508321 3:59654170-59654192 TCTCAAATCCCTATGCAGTCTGG - Intergenic
958052515 3:88366367-88366389 ACTGAAAACCAGATGAAGCTGGG + Intergenic
958592432 3:96175175-96175197 AGTCAAAGCCCTAGGCAGATAGG + Intergenic
960594188 3:119392913-119392935 ACTAAAGACCATATGCACCTAGG - Intronic
961547683 3:127646679-127646701 ACTCAAAATTCTATGGAGCCAGG - Intronic
963719442 3:148843881-148843903 ACTCCCATCACTATGCAGCTTGG + Intronic
964295070 3:155224954-155224976 ACTCCAGACCCTATTCACCTGGG + Intergenic
965288715 3:166849260-166849282 ACTCCAGACCCTATTCATCTGGG + Intergenic
966992060 3:185242795-185242817 ACTAAAGCCCTTATGCAGCTGGG - Intronic
969323338 4:6426231-6426253 ACTCATCACCCTAGCCAGCTGGG + Intronic
970412154 4:15818719-15818741 ACTCCAGACCCTATTCACCTGGG - Intronic
973970784 4:56211947-56211969 ACTCAAATACCTAGGCAGATTGG - Intronic
974539697 4:63218616-63218638 ACTCCAAACCCTAATCACCTGGG + Intergenic
975489939 4:74976808-74976830 ACTCCAGACCCTATTCACCTGGG - Intronic
977362067 4:96017903-96017925 ACTCTAAACCCTATGTAGATAGG + Intergenic
977518663 4:98054244-98054266 ACGCATAACCCCATGCAGCAGGG + Intronic
977882746 4:102224599-102224621 ACTCTAAATACTATGCAGCCTGG - Intergenic
982372390 4:154647737-154647759 ACTCCAGACCCTATTCACCTTGG - Intronic
982399363 4:154949511-154949533 AGTCAAATGCCTATGCAGATGGG + Intergenic
983743210 4:171161677-171161699 CCTCAAACTCCCATGCAGCTGGG + Intergenic
983893159 4:173052369-173052391 ACTAAAAAGTATATGCAGCTAGG + Intergenic
984114434 4:175662297-175662319 ACTTAAAACCATATTTAGCTAGG + Intronic
989158891 5:38371177-38371199 ACTCAGAACCCTGTGTAGCAGGG + Intronic
993642683 5:90424681-90424703 ACTCAAAACAATATGCAGGAGGG - Intergenic
995052317 5:107720083-107720105 ACTCCAGACCCTATTCATCTGGG - Intergenic
996695327 5:126388255-126388277 CCTCAACTCCCTAAGCAGCTGGG - Intronic
997636085 5:135408110-135408132 CCTCAAACTCCTATGTAGCTGGG + Intergenic
998761029 5:145432725-145432747 ACACAAAGCCCTATGCAGCTTGG - Intergenic
1000801666 5:165735263-165735285 CCTCAAAACTCTGAGCAGCTAGG + Intergenic
1002474873 5:179459100-179459122 TCTCATATCCCCATGCAGCTGGG - Intergenic
1002663923 5:180809470-180809492 ACTCAGCACCCTAAGAAGCTTGG - Intronic
1002837533 6:877709-877731 CCTCAAAACCACCTGCAGCTGGG - Intergenic
1004880404 6:20001899-20001921 CCTGAAAACCCTCTACAGCTGGG - Intergenic
1006013981 6:31066182-31066204 GCTCAAAACCCAATACAGATTGG - Intergenic
1008112989 6:47513425-47513447 ATGCAAAAACCTATGCAGTTTGG - Intronic
1010967047 6:82222766-82222788 ACTTAAAACTTTATGAAGCTGGG + Intronic
1013388554 6:109658358-109658380 AATGAAAACTCTATGCAGCAGGG - Intronic
1016598803 6:145832572-145832594 ACTGTAAACACTATGCAGGTAGG - Intergenic
1017463132 6:154670275-154670297 CCTCAGAATCCTATGTAGCTGGG + Intergenic
1020433211 7:8134218-8134240 AATAAAAACCCTATGCCCCTGGG + Intronic
1022582235 7:31566863-31566885 AGTCAATACCCAATTCAGCTAGG - Intronic
1026316214 7:69229944-69229966 CCCCAAAACTCTATCCAGCTGGG + Intergenic
1030113330 7:106044695-106044717 ACTCAGACTCCTCTGCAGCTAGG + Intergenic
1032375490 7:131411969-131411991 CCTCAGTACCCTAAGCAGCTGGG - Intronic
1033171786 7:139091117-139091139 ACCCAGAACCCTCAGCAGCTGGG + Intronic
1035870179 8:3129472-3129494 ACACAAAAAACTATGGAGCTGGG + Intronic
1037421738 8:18709703-18709725 ACTCCACACCCTATTCACCTGGG - Intronic
1037734163 8:21553873-21553895 ACTTACATCCCTATGCTGCTGGG + Intergenic
1041766186 8:61420672-61420694 ACTCAAAAACATATGCGGCCAGG + Intronic
1044235689 8:89827313-89827335 ACTCAAAAACTAATGGAGCTGGG - Intergenic
1046757950 8:117990920-117990942 ACACAAGAGCCTATGCAGCCAGG + Intronic
1050514781 9:6431486-6431508 ACTCAAACTCCTGAGCAGCTAGG - Intronic
1051703914 9:19856574-19856596 ACTCCAGACCCTATTCATCTGGG + Intergenic
1052742439 9:32406157-32406179 ACCCTAAACACTATGCAGCATGG - Intronic
1055627937 9:78193877-78193899 ACTCACAGCTCTATGCGGCTGGG + Intergenic
1059264022 9:113009159-113009181 ATTCAAAACCCTATGAAAATTGG + Intergenic
1059957229 9:119530327-119530349 ACTCAGAACTCTATTCAGTTTGG + Intergenic
1060038459 9:120279458-120279480 ACTCAAGTCCATATGCAGCTGGG - Intergenic
1060697088 9:125718605-125718627 TCTCAAAACCCTCTTCACCTGGG + Intergenic
1186913300 X:14193097-14193119 ACTCCAAACCCTATTTAGCTGGG + Intergenic
1188307620 X:28577595-28577617 ACTCAAAACACTATGTTGCCGGG - Intergenic
1188744749 X:33829072-33829094 ACTCCAGACCCTATTCACCTGGG + Intergenic
1190971893 X:55357340-55357362 ACTCCAGACCCTATTCACCTGGG - Intergenic
1191865679 X:65701917-65701939 CCTCAAATCCCTCTGCACCTTGG - Intronic
1193164234 X:78263636-78263658 ACTCCAGACCCTATTCACCTGGG + Intergenic
1194330612 X:92580023-92580045 ACTCCAGACCCTATTCACCTGGG + Intronic
1194405796 X:93494317-93494339 ACTCCAGACCCTATTCATCTGGG - Intergenic
1195676126 X:107508275-107508297 ATTCAAAACTCTTTGCACCTGGG - Intergenic
1196131653 X:112163741-112163763 CCTCAAAACTCTATGCAGGTAGG - Intergenic
1196146368 X:112321691-112321713 TCTCATAACCCTATGAAGCGAGG + Intergenic
1200639318 Y:5699093-5699115 ACTCCAGACCCTATTCACCTGGG + Intronic