ID: 1120018353

View in Genome Browser
Species Human (GRCh38)
Location 14:79499754-79499776
Sequence GTCCCCTAGATTAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120018353_1120018358 14 Left 1120018353 14:79499754-79499776 CCAGCCACCCTAATCTAGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1120018358 14:79499791-79499813 AAAATTTGCTTCTACGAACAAGG 0: 1
1: 0
2: 0
3: 7
4: 185
1120018353_1120018359 30 Left 1120018353 14:79499754-79499776 CCAGCCACCCTAATCTAGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1120018359 14:79499807-79499829 AACAAGGTAATGTCATGATATGG 0: 1
1: 0
2: 0
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120018353 Original CRISPR GTCCCCTAGATTAGGGTGGC TGG (reversed) Intronic
900761335 1:4473253-4473275 CTCCCCTAGAATATGGGGGCTGG - Intergenic
902538534 1:17136057-17136079 GTGGCCTATTTTAGGGTGGCTGG + Intergenic
903846773 1:26283602-26283624 GAACCCTAGACTAGGGTGGTGGG + Intronic
913194927 1:116448315-116448337 TACCCCTTGATGAGGGTGGCAGG + Intergenic
915082494 1:153361584-153361606 CTCCCGTTGATTAGGGTGGCAGG - Intergenic
1062857093 10:784798-784820 GTCCCCTAGACCCGGGAGGCTGG - Intergenic
1067720707 10:48725695-48725717 GCCCCCTAGGAAAGGGTGGCAGG - Intronic
1074889286 10:117721644-117721666 GCCGCCCAGTTTAGGGTGGCTGG + Intergenic
1080232897 11:30037639-30037661 GTCCTTTAGATTAGGTAGGCAGG - Intergenic
1083138656 11:60703600-60703622 ATCCCCCACATTTGGGTGGCTGG - Intronic
1083656763 11:64233811-64233833 GGCCCCTAGAGTGGGGTGGAAGG + Intronic
1083715319 11:64572004-64572026 GTCCCCTCGATGAGGGTTGTTGG + Exonic
1084609488 11:70193219-70193241 GGTCCCTAGAGTAGTGTGGCTGG + Intergenic
1092816293 12:12315062-12315084 GTACCCTAGTTCAGGGTGGGGGG - Intergenic
1100793697 12:98157789-98157811 GTCCCCTAGATTACTGAGTCAGG + Intergenic
1108696496 13:52906804-52906826 GGCCCCTAGATTGTGGGGGCTGG - Intergenic
1110293583 13:73836110-73836132 TTCCCCTACATAAAGGTGGCTGG + Intronic
1120018353 14:79499754-79499776 GTCCCCTAGATTAGGGTGGCTGG - Intronic
1125455587 15:39855614-39855636 GGCCACTAGAATAGTGTGGCTGG + Intronic
1128671606 15:69578107-69578129 GTTCCCTAGATGGGGGTGGAGGG + Intergenic
1130464006 15:84181399-84181421 GTCTCCAAGATCAGGTTGGCAGG + Intronic
1130500261 15:84492142-84492164 GTCTCCAAGATCAGGTTGGCAGG - Intergenic
1134469478 16:14510755-14510777 GTCACATAGATGGGGGTGGCAGG - Intronic
1135762981 16:25152384-25152406 GTCCCCTTGGTTCAGGTGGCTGG + Intronic
1136053918 16:27673701-27673723 GTCCCCTGGAGTTGGGTGGGGGG + Intronic
1136126060 16:28181628-28181650 GTCCCATTGCTTTGGGTGGCTGG - Intronic
1147996662 17:44363469-44363491 GTTCCCTGGATTCGGGTGGGGGG - Intronic
1151966475 17:77434205-77434227 GTGCCCTAGGATACGGTGGCAGG + Intronic
1160458957 18:79022912-79022934 GTCCCCCACATTGGCGTGGCTGG + Intergenic
1163915219 19:20235496-20235518 GTCCCCTAGATTTTCTTGGCGGG - Intergenic
1166051902 19:40265535-40265557 TTCCCCCAGATTGGGGTCGCTGG - Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925005566 2:440748-440770 GTCCCTTAGGCTAGGGTGCCCGG - Intergenic
929226075 2:39512927-39512949 GTCCCCAAGATGAGACTGGCTGG + Intergenic
935918697 2:107986483-107986505 GTCCCCTTTATAAGGGCGGCAGG - Intergenic
939464620 2:142541455-142541477 ATGCCCTAGATAAGTGTGGCAGG - Intergenic
945397529 2:209338302-209338324 GTGACCTAGATTAGGGAGGTAGG - Intergenic
1170632755 20:18079548-18079570 CGGCCCTAGACTAGGGTGGCTGG - Intergenic
1175368568 20:58471550-58471572 GACCCCTAGATGAGCTTGGCTGG + Intronic
1176267577 20:64218630-64218652 GTCCCCTAGAGGAGGGTGGGTGG + Intronic
1177906693 21:26980108-26980130 GATCCCTAGATTATGGTAGCAGG + Intergenic
1178069902 21:28952824-28952846 CTCCCCTAGATTAGGAAGGCAGG - Intronic
1178936690 21:36868844-36868866 GTCTCCCAGACTAGGGTGGATGG - Intronic
1183034242 22:35129131-35129153 GTCACCTACATCAGGGTCGCAGG - Intergenic
1183669826 22:39265924-39265946 CTCCCCTAGGGAAGGGTGGCTGG + Intergenic
1184296586 22:43529014-43529036 GTGCCCTAGGTTAAGGAGGCAGG + Intronic
953034525 3:39200655-39200677 GAACCCTTGATCAGGGTGGCAGG + Intergenic
960068544 3:113402573-113402595 GTCCCATAGATTAGCCTGGTTGG + Intronic
963335012 3:143964877-143964899 GTCACCTAGAGTACGGTGGTAGG + Intergenic
964501627 3:157354454-157354476 GCACCCTAGATTAGGGTGGTTGG - Intronic
968919460 4:3515169-3515191 GCCCCCTAGATTCGGGGGGCGGG - Intronic
971209591 4:24602914-24602936 GTCCTTTAAATTAGGGTGACTGG - Intergenic
974297311 4:60018256-60018278 GTCCCCTACAGTAGGGTTGAAGG - Intergenic
976818488 4:89177513-89177535 GTCCCCTAGATTGCCATGGCTGG + Intergenic
985841097 5:2306544-2306566 GGCCCCTGGACTGGGGTGGCTGG - Intergenic
987114029 5:14712726-14712748 GTCTCGTGGCTTAGGGTGGCTGG - Intronic
1017443930 6:154490244-154490266 TTCCCCTACAGTAGGGTGACTGG + Intronic
1019273409 7:163423-163445 GTCTCTGAGCTTAGGGTGGCCGG + Intergenic
1026933408 7:74237873-74237895 GACCCCTTGTTTAGGGTGTCAGG - Intronic
1035115339 7:156518882-156518904 GTCCTCTAGGGTGGGGTGGCTGG - Intergenic
1038409888 8:27349956-27349978 GTCCCCTTGACCAAGGTGGCTGG + Intronic
1042546160 8:69953486-69953508 GTCCCCAATAATACGGTGGCTGG - Intergenic
1047970303 8:130078669-130078691 GTCCCCCAAATTAGGGTTGAAGG + Intronic
1049181503 8:141225550-141225572 CTCCTCTAGATTAGGTGGGCTGG - Intronic
1053625908 9:39870327-39870349 CTCCCCTAGATTACTGTGGGGGG - Intergenic
1054217980 9:62380374-62380396 CTCCCCTAGATTACTGTGGGGGG + Intergenic
1060416171 9:123432350-123432372 GTCTCCCTGATGAGGGTGGCTGG - Intronic
1061361454 9:130144881-130144903 GTCATCTAGATGAGGGTGGCTGG - Intergenic
1192149945 X:68705999-68706021 GGCCCCTAGGACAGGGTGGCAGG - Intronic
1200119246 X:153782699-153782721 CTCCCCTAGCTGAGGGTGGGTGG + Intronic
1200257983 X:154595224-154595246 CTCTCCTAGCTTCGGGTGGCTGG - Intergenic