ID: 1120020423

View in Genome Browser
Species Human (GRCh38)
Location 14:79524113-79524135
Sequence CTTTGTTTGCTGAAGGTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120020423_1120020428 7 Left 1120020423 14:79524113-79524135 CCTGCGACCTTCAGCAAACAAAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1120020428 14:79524143-79524165 TCTAAGGAGAAAACAGGATGTGG 0: 1
1: 0
2: 1
3: 37
4: 388
1120020423_1120020429 8 Left 1120020423 14:79524113-79524135 CCTGCGACCTTCAGCAAACAAAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1120020429 14:79524144-79524166 CTAAGGAGAAAACAGGATGTGGG 0: 1
1: 0
2: 0
3: 32
4: 349
1120020423_1120020431 28 Left 1120020423 14:79524113-79524135 CCTGCGACCTTCAGCAAACAAAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1120020431 14:79524164-79524186 GGGATGTTTCCAGTGGACCTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
1120020423_1120020430 21 Left 1120020423 14:79524113-79524135 CCTGCGACCTTCAGCAAACAAAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1120020430 14:79524157-79524179 AGGATGTGGGATGTTTCCAGTGG 0: 1
1: 0
2: 3
3: 14
4: 209
1120020423_1120020427 1 Left 1120020423 14:79524113-79524135 CCTGCGACCTTCAGCAAACAAAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1120020427 14:79524137-79524159 CAGAGATCTAAGGAGAAAACAGG 0: 1
1: 0
2: 1
3: 33
4: 338
1120020423_1120020426 -9 Left 1120020423 14:79524113-79524135 CCTGCGACCTTCAGCAAACAAAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1120020426 14:79524127-79524149 CAAACAAAGGCAGAGATCTAAGG 0: 1
1: 0
2: 1
3: 26
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120020423 Original CRISPR CTTTGTTTGCTGAAGGTCGC AGG (reversed) Intronic
900002728 1:23688-23710 CTTTTTTTGGTAAAGGTCCCAGG - Intergenic
901469571 1:9446925-9446947 TTATATTTGCTGAAGGTAGCAGG - Intergenic
906390802 1:45414130-45414152 CTTTGTTTGCTCTAGGCCACTGG + Intronic
909084413 1:71154668-71154690 CTATGTTTACTCAAGGTCACAGG + Intergenic
911123166 1:94315936-94315958 GCCTGTTTGCTGAAGGTTGCTGG + Intergenic
912059075 1:105641871-105641893 CTATGTTTTCTCAAGGTCGTGGG - Intergenic
913017330 1:114752359-114752381 GTTTGTTTGTTTAAGGTTGCTGG - Intronic
919169877 1:193939808-193939830 CTATGTTTGCTCAAGGTCCTAGG - Intergenic
921238670 1:213154264-213154286 CTATGTTTGCTGAAGGCCCTGGG + Intronic
922320402 1:224481762-224481784 CTATGTTTGCTGAAGGCCCTAGG + Intronic
923485316 1:234424105-234424127 TTTTATTTTCTGAAGGTAGCAGG - Intronic
923526049 1:234773561-234773583 CCTTGTTTGCTAAAGGGAGCAGG + Intergenic
1065404201 10:25345193-25345215 CTCTGTTTGCCGAATGTTGCCGG - Intronic
1066746979 10:38610630-38610652 CTTTGTCTCCTGAAGCTCACAGG - Intergenic
1066988284 10:42487616-42487638 CTTTCTTTTCTGGAGGACGCTGG + Intergenic
1067817042 10:49487594-49487616 CTTTGGCTTCTAAAGGTCGCAGG - Intronic
1069391818 10:67944084-67944106 CTTTGTTTGCTTAAGGCCCTAGG - Intronic
1074010396 10:109472942-109472964 CAGTGTTTTCTGAAGGTCGAGGG + Intergenic
1074692855 10:116022355-116022377 CTTTGTATCCTAAAGGTGGCAGG - Intergenic
1074889383 10:117722542-117722564 ATTTGTTGGCTGAAGGTAGAAGG + Intergenic
1079473797 11:20807556-20807578 CTATGTTTGCTGAAGGCCCTAGG + Intronic
1080128667 11:28767225-28767247 CTTTGTTTGCTCAAGGTCCTTGG - Intergenic
1083232995 11:61334902-61334924 CTTTGTTTCCTGGAGGCTGCTGG + Intronic
1084255381 11:67938635-67938657 CTATGTTTGCAAAAGCTCGCAGG - Intergenic
1084671206 11:70607592-70607614 CTCTGTTTGCTGACGGCCACAGG - Intronic
1085016442 11:73177177-73177199 CCTGGTTTGCTGAAGATCCCTGG - Intergenic
1085692523 11:78675270-78675292 CTTTCTTTGCTGAAGGGCAGGGG + Intronic
1087259976 11:96000426-96000448 CTTTGTGTGCCGTAGGTCTCTGG - Intronic
1098541653 12:71663901-71663923 CTTTGTTTCCTGCGTGTCGCAGG - Exonic
1100443052 12:94635315-94635337 CTTTGTGTTCTGCAGGTCACAGG - Intronic
1102913450 12:116736455-116736477 CTCTGTTTGCCTAAGGTGGCAGG + Intronic
1105930951 13:25051290-25051312 TTTTGTTTGTTGAAGGCAGCAGG - Intergenic
1107960507 13:45553763-45553785 CTTTGTATACTAAATGTCGCAGG - Intronic
1110916719 13:81030391-81030413 CTATGTTTGCTTAAGGTCCTAGG + Intergenic
1116930654 14:50687893-50687915 CTATGTTTGCTCAAGGTCCTGGG + Intergenic
1117653815 14:57933632-57933654 ATTTGTTTGTGAAAGGTCGCTGG + Intronic
1120020423 14:79524113-79524135 CTTTGTTTGCTGAAGGTCGCAGG - Intronic
1124693480 15:31844988-31845010 CTCTGTTTGCTGGGGGTAGCAGG - Intronic
1126250703 15:46565180-46565202 CTGTGTTTGCTCAAGGTCCCAGG + Intergenic
1126503798 15:49379899-49379921 CTATGTTTGCTCAAGGCCCCAGG + Intronic
1126601812 15:50436120-50436142 CTTTGTTTTCTAAAGGTAGCAGG - Intronic
1127012530 15:54645333-54645355 CTATGTTCGCTGAAGGCCGTGGG - Intergenic
1127585187 15:60371607-60371629 TTGTGTTTGATGAAGGTCTCGGG + Intronic
1132502471 16:290611-290633 CTTTATGTGCTCAAGGTGGCAGG - Intronic
1133255365 16:4513103-4513125 CTTTGTCTGGTGCAGGTGGCAGG - Intronic
1135814625 16:25621225-25621247 CTCTGTTTGCTAAGGGTGGCAGG + Intergenic
1136736084 16:32469015-32469037 CTTTGTCTCCTGAAGCTCACAGG + Intergenic
1137250211 16:46735884-46735906 CTTTGGGTACTGAAGGTGGCAGG - Intronic
1203016988 16_KI270728v1_random:360559-360581 CTTTGTCTCCTGAAGCTCACAGG - Intergenic
1203035323 16_KI270728v1_random:633717-633739 CTTTGTCTCCTGAAGCTCACAGG - Intergenic
1145999869 17:29124685-29124707 CTTTGCTTGCTGTCGGTAGCTGG - Intronic
1151550403 17:74819439-74819461 CTGTGTTTGCTGAAGAGAGCAGG + Intronic
1157922907 18:51732007-51732029 CTTTGTTTGCTGAAACTTGAAGG + Intergenic
1159632351 18:70763656-70763678 CTTTGCTGGCAGAAGGTCCCAGG + Intergenic
1160634479 19:65296-65318 CTTTTTTTGGTAAAGGTCCCAGG - Intergenic
1163084793 19:14971582-14971604 CTTTGTTTGGCCAAGGACGCTGG + Intronic
1166051975 19:40265860-40265882 CTTAGTTTGTTGAAGGTGGCAGG - Intronic
1166659164 19:44634609-44634631 CTTTCTTTTCTGGAGGACGCTGG - Intronic
925436985 2:3846989-3847011 CTGTGTGTGCTGCAGGTCCCAGG + Intronic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
930699704 2:54446912-54446934 GTTTGTTTTCTGAAGGGCACAGG - Intergenic
930915878 2:56687000-56687022 CTCTGTTTGCTGAAAGTACCTGG + Intergenic
934187246 2:89758127-89758149 CTTTGTCTCCTGAAGCTCACAGG + Intergenic
934309382 2:91849797-91849819 CTTTGTCTCCTGAAGCTCACAGG - Intergenic
934879540 2:97963377-97963399 TTTTGTTTCCTTAAGGTCTCAGG + Intronic
939334991 2:140814912-140814934 TTTTGTTTGCTAAAGGTCCTTGG + Intronic
941135419 2:161711548-161711570 ATATGTTTGCTGAAAGTTGCAGG + Intronic
944142716 2:196475066-196475088 CTTTGGTTGTTGATGGTCCCTGG - Intronic
946660956 2:221998824-221998846 CTGTGTTTTGTGAAGGTCTCAGG + Intergenic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
948242101 2:236446558-236446580 CTTTGTTTTCTCAGGGTCTCAGG + Intronic
948353486 2:237359688-237359710 CTCTGTTTGCTGAAGTTTGAAGG - Intronic
1168910735 20:1444674-1444696 CTTGGTTTGCTAAAAGTCACAGG - Intronic
1169127314 20:3138847-3138869 CTTTGTAGGCTGAAGGAAGCTGG - Intronic
1171351719 20:24507635-24507657 CTTTGGCTGCTGAAGGTCTGTGG + Intronic
1177090028 21:16756229-16756251 CGTTGTGTGCTGAAGGTAGCAGG + Intergenic
1177133059 21:17280241-17280263 CTTTGTTTGCTCAAGGTTCTGGG - Intergenic
1180536471 22:16396922-16396944 CTTTGTCTCCTGAAGCTCACAGG - Intergenic
1182113001 22:27736521-27736543 CATTGTCTGCTGAAGGTCTCTGG - Intergenic
1184652632 22:45926072-45926094 CTTTATTTGCGGATGGTCACGGG - Intronic
950380009 3:12604757-12604779 CTTTGTTTGCTGGTTGTAGCAGG - Intronic
950751149 3:15129112-15129134 CTATGTTTGCAAAAGCTCGCAGG + Intergenic
951435370 3:22656896-22656918 CTATGTTTGCTGAAGGGCCTGGG + Intergenic
951819270 3:26790646-26790668 CTATGTTTGCTGAAGGCCCTGGG + Intergenic
958765240 3:98360168-98360190 TTTTGTTTGCTCAAGGTCCTGGG + Intergenic
961283790 3:125783862-125783884 CTATGTTTGCAAAAGCTCGCAGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961426578 3:126852965-126852987 CTTTTTTTGTTGAATGTGGCTGG + Intronic
963365128 3:144324220-144324242 CTTTGTTTGCTCAAGGCCCTGGG - Intergenic
964318219 3:155466121-155466143 CTATGTTTGCTGAAGGCCCTGGG - Intronic
964349905 3:155791964-155791986 CTGTGTTTGCTGAAGATCCTAGG - Intronic
968702322 4:2062898-2062920 CTTTGGCTGCTGGAGGTGGCTGG + Intronic
969740070 4:9018088-9018110 CTATGTTTGCAAAAGCTCGCAGG + Intergenic
972207865 4:36799306-36799328 CTATGTTTGCTCAATGTCTCAGG - Intergenic
974301099 4:60067900-60067922 CTATGTTTGCTCAAGGCCGTAGG - Intergenic
975313051 4:72925024-72925046 CTATGTTTGCTCAAGGTCCTAGG + Intergenic
975328825 4:73090945-73090967 CTTTGTGTACTTAAGGTCGAAGG + Exonic
975335553 4:73171010-73171032 CTATGTTTGCTGAAGGCCCTAGG - Intronic
975618797 4:76275080-76275102 TTTTGATTGTTGAAGGTGGCAGG + Intronic
976254102 4:83082997-83083019 CTATGTTTGCTGAAGGCCCTGGG + Intergenic
976908322 4:90267477-90267499 CTATGTTTGCTCAAGGTCCAGGG - Intronic
979851148 4:125572907-125572929 CTATGTTTGCTCAAGGCCCCAGG + Intergenic
980660721 4:135854990-135855012 CTAGGTTTGCTGAAGGTCCTGGG + Intergenic
980965783 4:139519435-139519457 CTTTGTATGCTGAATTTCTCTGG + Intronic
981197721 4:141940725-141940747 CTTTCTTTTCTGAAGGACACTGG - Intergenic
982080156 4:151781747-151781769 CTTTGTTTGCTGAGGCTGGAGGG + Intergenic
983389002 4:167103725-167103747 CTATGTTTGCTCAAGGTCCTAGG - Intronic
984623837 4:181982917-181982939 CTTTGTTACCTGAAGGTTGGGGG + Intergenic
985695270 5:1336640-1336662 CTCTGTTTGCTGGAGTTTGCTGG - Intronic
989110139 5:37899238-37899260 ATTTGTTTGCTGCAGGTCTTGGG + Intergenic
990499957 5:56386195-56386217 CCTTGATTCCTGAAGGTTGCAGG - Intergenic
991018478 5:61956534-61956556 CTTTGTTTGCTGCAGGCCCTGGG + Intergenic
992889119 5:81187746-81187768 CTTAGTGTGCTCAAGGTCTCAGG + Intronic
993582387 5:89678225-89678247 TTATGTTTGCTGAAGGTCCTGGG - Intergenic
996291774 5:121860074-121860096 CTTTCTTTTCTGGAGGACGCTGG - Intergenic
1002925679 6:1604676-1604698 CTTTTTCTGCTGACGCTCGCGGG + Intergenic
1003803379 6:9697359-9697381 CTTTGTTTGCTACTGGTCTCTGG + Intronic
1005361873 6:25038586-25038608 CTTTAGTTGCTGAAGGCCTCAGG + Intronic
1006985053 6:38170415-38170437 CTTTGTTTGTGGTAGGTCTCTGG - Exonic
1011236101 6:85218747-85218769 CTTTGTCTGCTTAAGGTCCTAGG - Intergenic
1012483179 6:99690341-99690363 CTTTGTTTGCTCAAGGTTGTAGG - Intergenic
1014234721 6:118940924-118940946 CTATGTTTGCTCAAGGTCCTAGG - Intergenic
1014473784 6:121848053-121848075 CTTTGTTGGCTGAAGTGTGCTGG - Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1016908492 6:149174295-149174317 CTTTGGGTGCTGAAGTTTGCAGG + Intergenic
1017112089 6:150941600-150941622 ATTTGTTTGCTGATGTTTGCAGG + Intronic
1021641075 7:22736340-22736362 CTATGTTTGCTGAAGGCCCTGGG - Intergenic
1022909489 7:34886779-34886801 CTTTGTTTGATGAAAGCCTCAGG + Intergenic
1030064260 7:105647280-105647302 CTTTGTCTGCTGAAGGCCTGAGG - Intronic
1031746445 7:125505093-125505115 CTATGTTTGCTGAAGGCCCTGGG + Intergenic
1036245100 8:7109337-7109359 CTATGTTTGCAAAAGCTCGCAGG + Intergenic
1036889132 8:12583985-12584007 CTATGTTTGCAAAAGCTCGCAGG - Intergenic
1036896719 8:12642129-12642151 CTATGTTTGCAAAAGCTCGCAGG - Intergenic
1039625172 8:39042522-39042544 CTTTGAATACTGAAGGACGCTGG - Intronic
1044105127 8:88195186-88195208 GTTTGTTTTCTGAAAGTGGCTGG - Intronic
1046830943 8:118745248-118745270 CTATGTTTGTTGAAGGTTGAGGG + Intergenic
1048648731 8:136451134-136451156 CTGTGTCTGCTTAAGGTCTCAGG + Intergenic
1050592441 9:7174305-7174327 TTTTGTTTGGGGAAGGTCCCTGG + Intergenic
1054956288 9:70914584-70914606 CTATGTTTGCTCAAGGACACTGG - Intronic
1058248991 9:102668398-102668420 CTGTGTTTCCTCAAGGTCGTAGG + Intergenic
1059911491 9:119049390-119049412 CTTTCTTTGCTGAGTGTCCCAGG - Intergenic
1060658358 9:125388179-125388201 CTTTGCTCTCTGAAGGTCACAGG - Intergenic
1185505387 X:629761-629783 CTTTATTTGCAGAAGGTCCTTGG + Intronic
1188691462 X:33134167-33134189 CTCTGTTTGATGAAGGAGGCTGG - Intronic
1188728784 X:33619782-33619804 GTTTGTTTGCTGAAGGATGAGGG + Intergenic
1191669427 X:63735340-63735362 CTTTGTTTCCAGAAGGTAGGAGG + Intronic
1192822328 X:74658143-74658165 CTATGTTTGTTTAAGGTCCCGGG + Intergenic
1193000532 X:76557893-76557915 CTATGTTTGCTCAAGGTCCTGGG + Intergenic
1193280265 X:79640940-79640962 CTACGTTTGCTGAAGGTCCTAGG + Intergenic
1193830870 X:86288396-86288418 CTATGTTTGCTCAAGGTCCTGGG + Intronic
1194083497 X:89498274-89498296 CTATGTTTGCTGAAGGCCCTGGG + Intergenic
1195172179 X:102280705-102280727 CTTTGTTTGCTCAAGGCCCTGGG + Intergenic
1195186681 X:102406388-102406410 CTTTGTTTGCTCAAGGCCCTGGG - Intronic
1197876446 X:131114184-131114206 CTATGTTTGCTGAAGGCCCTAGG + Intergenic
1198996137 X:142576753-142576775 CTTTGTTTGCTCAAAGTCCTGGG + Intergenic
1200112638 X:153749751-153749773 CTTTGTCTCCTGAAGCTCACAGG - Intergenic