ID: 1120023876

View in Genome Browser
Species Human (GRCh38)
Location 14:79560421-79560443
Sequence GGGGGTGGGAGGAGCATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 947}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120023863_1120023876 16 Left 1120023863 14:79560382-79560404 CCTGGGTGACCAGAGAGGACCCC 0: 1
1: 0
2: 1
3: 27
4: 467
Right 1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG 0: 1
1: 0
2: 3
3: 63
4: 947
1120023867_1120023876 -3 Left 1120023867 14:79560401-79560423 CCCCTAGGTAAGACAGCACTGGG 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG 0: 1
1: 0
2: 3
3: 63
4: 947
1120023869_1120023876 -4 Left 1120023869 14:79560402-79560424 CCCTAGGTAAGACAGCACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG 0: 1
1: 0
2: 3
3: 63
4: 947
1120023871_1120023876 -5 Left 1120023871 14:79560403-79560425 CCTAGGTAAGACAGCACTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG 0: 1
1: 0
2: 3
3: 63
4: 947
1120023865_1120023876 7 Left 1120023865 14:79560391-79560413 CCAGAGAGGACCCCTAGGTAAGA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG 0: 1
1: 0
2: 3
3: 63
4: 947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120023876 Original CRISPR GGGGGTGGGAGGAGCATTTC TGG Intronic
900102119 1:966401-966423 GGGCGAGGGTGGAGCCTTTCTGG - Intergenic
900196391 1:1378114-1378136 GGAGGTTGGAGGAGCATTAAAGG - Intergenic
900321199 1:2085048-2085070 TGGGGTGGGAGCAGCCTGTCTGG - Intronic
901188337 1:7389161-7389183 GGGGGTGGGAGGATCTCTCCAGG - Intronic
901395792 1:8980432-8980454 AGGGTTGGGAGGATCATTTAAGG + Intergenic
901505996 1:9686432-9686454 CGAGGTGGGAGGATCATTTAAGG - Intronic
901516797 1:9753095-9753117 GGGGGTGGGAGGATGGTTTTGGG + Intronic
901810968 1:11766611-11766633 GGGGGTGGGCGGAGAATGGCTGG - Intronic
901827583 1:11872426-11872448 TGGGGTGGGAGGATCATTTGAGG - Intergenic
902167071 1:14581224-14581246 GGCGGTGGGAGGAGCAGGTTTGG - Intergenic
903064489 1:20691377-20691399 TGGGGTGGGAGGATCACTTGAGG - Intronic
903363414 1:22791546-22791568 TGAGGTGGGAGGATCATTTGTGG - Intronic
903449870 1:23445738-23445760 TGAGGTGGGAGGATCATTTGAGG + Intronic
903869056 1:26419130-26419152 GGGGGTGGTACAAGAATTTCAGG + Intronic
904042081 1:27590996-27591018 GGGGGTTGGAGGGGAATTTAAGG - Intronic
904113651 1:28146049-28146071 GGGGATGGGAGGAGTATATTAGG - Intergenic
904896954 1:33824685-33824707 GAGGGTGGGAGGAGCAAGTCAGG + Intronic
904978900 1:34480023-34480045 GGGGATGGGAGGGGCAATGCAGG + Intergenic
905063894 1:35163429-35163451 TGAGGTGGGAGGATCATTTGAGG + Intergenic
905491927 1:38351111-38351133 GGCGGGGAGAAGAGCATTTCAGG - Intergenic
905492699 1:38356894-38356916 GGGAGAGGGAGGAGCATATGAGG - Intergenic
905574997 1:39036943-39036965 TGAGGTGGGAAGATCATTTCAGG - Intergenic
906231946 1:44171750-44171772 TGGGGTGGGAGAGGCAGTTCAGG + Intergenic
906279247 1:44542434-44542456 GGGGGAGGGAGGAGGATATAGGG + Intronic
906396333 1:45468757-45468779 GGGTGTGGGATGAGCACTACTGG + Intronic
906644947 1:47468166-47468188 TGAGGTGGGAGGATCAATTCAGG - Intergenic
906748660 1:48239566-48239588 GGGGGAAGGGAGAGCATTTCTGG - Intronic
906798882 1:48719152-48719174 GGGGGAAGGGGGCGCATTTCAGG - Intronic
906866432 1:49425759-49425781 GGGGGTGAGAGGAGAAACTCTGG + Intronic
906987783 1:50705118-50705140 GAGGGTGGGGGGAACATTTAAGG - Intronic
907034905 1:51207472-51207494 CGAGGTGGGAGGATCATTTGAGG + Intergenic
907209867 1:52811536-52811558 TGAGGTGGGAGGATCACTTCAGG - Intronic
907311980 1:53544002-53544024 GGTGGCGGGAGGAGCCGTTCTGG + Intronic
907328178 1:53654358-53654380 GGCGGTGAGAGGAGCAGGTCGGG + Intronic
907474525 1:54696902-54696924 TGAGGTGGGAGGATCATTTGAGG - Intronic
907683836 1:56590661-56590683 GGGGGTTGCATCAGCATTTCTGG - Intronic
908191147 1:61704830-61704852 TGAGGTGGGAGGATCACTTCAGG + Intronic
908479722 1:64526579-64526601 GGGGGTGAGGAGAGCATGTCAGG + Intronic
908722525 1:67141523-67141545 TGAGGTGGGAGGATCATTTGAGG + Intronic
909130452 1:71729181-71729203 GGTGGTGTGAGGAGCATGTCAGG - Intronic
910161774 1:84279848-84279870 GAGGGGAGGAAGAGCATTTCTGG + Intergenic
910464427 1:87481707-87481729 GGAGGTGGGAGGATCACTTGAGG + Intergenic
910806723 1:91195615-91195637 AGGGGTGGGAGGATCACTTAAGG - Intergenic
911029157 1:93467675-93467697 TGAGGTGGGAGGACCATTTGAGG + Intronic
911052984 1:93687537-93687559 TGGGGTGGGTGGATCATTTGAGG - Intronic
911134083 1:94420242-94420264 GGGGGCATGAGGAGAATTTCTGG - Intronic
912686812 1:111774468-111774490 GGAGCTGGGGGCAGCATTTCTGG - Intronic
912763348 1:112387613-112387635 GGAGGTGGAAGAAGCACTTCAGG + Intergenic
912766110 1:112412849-112412871 GGAGGTGGGAGGATCACTTGAGG - Intronic
914359205 1:146916537-146916559 GGAGGTGGGAGGATCACTTGAGG + Intergenic
914461356 1:147888732-147888754 TGGGGTGGGAGGATCACTTGAGG + Intergenic
914494543 1:148183339-148183361 GGAGGTGGGAGGATCACTTGAGG - Intergenic
914761978 1:150606321-150606343 TGAGGTGGGAGGATCACTTCAGG - Intronic
915181517 1:154065185-154065207 TGAGGTGGGAGGATCACTTCAGG + Intronic
915249416 1:154577741-154577763 GGAGCTGGGAGGAACATTACAGG + Exonic
915369250 1:155334202-155334224 GGAGGTGGGCGGATCATTTGTGG + Intergenic
915407218 1:155669793-155669815 AGGAGTGGGAGGATCATTTGAGG + Intronic
915546918 1:156605031-156605053 CGAGGTGGGAGGATCATTTGAGG + Intergenic
916465168 1:165066820-165066842 GTGGGAGGAATGAGCATTTCAGG - Intergenic
916658600 1:166900220-166900242 GGGGGTGGGGGGAGCATGAAAGG - Intergenic
916960192 1:169881789-169881811 AGGGGTGGGGGGATTATTTCGGG + Intronic
917179461 1:172279627-172279649 GGAGATTGGAGGAGCATGTCTGG - Intronic
917908329 1:179612700-179612722 GGAGGTGGGTGGATCATTTGAGG + Intronic
918105191 1:181410629-181410651 GGGGCTGGGAGAGGCATTTATGG + Intergenic
919054294 1:192550493-192550515 TGAGGTGGGAGGATCATTTGAGG - Intergenic
919364885 1:196646718-196646740 AGGGGTGGTAGGAGTATTCCTGG + Intergenic
919479628 1:198072156-198072178 TGAGGTGGGAGGATCACTTCAGG - Intergenic
919484211 1:198127170-198127192 CGAGGTGGGAGGATCATTTGAGG + Intergenic
919698746 1:200609414-200609436 CGAGGTGGGAGGATCATTTGAGG + Intronic
919838954 1:201595472-201595494 GGGGGAGGGAGGAGGCTTCCAGG - Intergenic
920120443 1:203652376-203652398 CGAGGTGGGAGGATCATTTGAGG - Intronic
920181731 1:204136161-204136183 TGAGGTGGGAGGATCATTTGAGG + Intronic
920402342 1:205683929-205683951 GGAGGTGGGTGGATCATTTGAGG + Intergenic
920826227 1:209426397-209426419 GAGGGTGGGGGAAGCATATCTGG - Intergenic
920853149 1:209642709-209642731 TGGGGTGGGTGGATCATTTGAGG - Intronic
921076196 1:211702049-211702071 GGAGGAGGGAGGAGCAGGTCTGG + Intergenic
921130831 1:212218232-212218254 GGAGAGGGGAGGAGCATTCCAGG - Intergenic
921340553 1:214129634-214129656 GGGGGTGGGAGTAGAACCTCTGG - Intergenic
921557083 1:216611869-216611891 GAGGGTGAGAAGAGCATTCCAGG + Intronic
921857942 1:220008906-220008928 GGAGGTGGGAAGATCATTTGAGG - Intronic
922225861 1:223645554-223645576 GGGGGTGGGGGGACCACTCCAGG + Intronic
922440092 1:225648010-225648032 GGGGGTTGGGGGAGCATGTTAGG + Intronic
922509818 1:226155183-226155205 GGAGGTGGGTGGATCATTTGAGG + Intronic
922533192 1:226360232-226360254 CGAGGTGGGAGGATCATTTGAGG - Intergenic
922905582 1:229171302-229171324 GAGAGTGAGAGGAGCAGTTCAGG - Intergenic
923444695 1:234058575-234058597 TGAGGTGGGAGGATCATTTCAGG - Intronic
923618382 1:235556681-235556703 GGGGGTGGGGGGATGGTTTCAGG + Intronic
923672254 1:236050843-236050865 GGAGGTGGGTGGATCATTTGAGG + Intronic
923822139 1:237456842-237456864 TGAGGTGGGAGGATCATTTGAGG + Intronic
924270376 1:242326107-242326129 GGAGGGGGGAGGATCATTTGAGG - Intronic
924404405 1:243727511-243727533 TGAGGTGGGAGGATCATTTGAGG - Intronic
924512523 1:244739458-244739480 TGAGGTGGGAGGATCATTTGAGG - Intergenic
924531576 1:244898381-244898403 TGAGGTGGGAGGATCATTTAGGG + Intergenic
924548880 1:245055552-245055574 GTGGGTGGGAGGATCACTTGAGG - Intronic
924705568 1:246499025-246499047 CGAGGTGGGAGGATCATTTGAGG - Intronic
1062780824 10:205590-205612 TGAGGTGGGAGGAGCACTTGAGG + Intronic
1062874295 10:932183-932205 GGGGGTGGGATGAGGGGTTCGGG - Intergenic
1062930342 10:1348591-1348613 GGGGGTGGGAGGAGGAGAGCAGG - Intronic
1063588882 10:7377396-7377418 GGGGATGGGAGGATGGTTTCAGG + Intronic
1063935151 10:11070195-11070217 GGAGGAGGGAAGAGAATTTCAGG + Intronic
1064312468 10:14223641-14223663 TGAGGTGAGAGGATCATTTCTGG + Intronic
1064465314 10:15574052-15574074 TGAGGTGGGAGAAGCACTTCAGG - Intronic
1065073211 10:22049176-22049198 GGGGCTGGGAGGATGGTTTCAGG - Intergenic
1065081995 10:22138310-22138332 TGAGGTGGGTGGAGCATTTGAGG - Intergenic
1065356213 10:24844550-24844572 CAGGGTGGGAGGATCACTTCAGG + Intergenic
1065859440 10:29859242-29859264 CGAGGTGGGAGGATTATTTCAGG - Intergenic
1065938102 10:30539352-30539374 CGAGGTGGGAGGATCACTTCAGG - Intergenic
1065938805 10:30545414-30545436 GGTGGTGGGAGGATCACTTGAGG + Intergenic
1066079987 10:31921042-31921064 GGAGGTGGGAGGATCACTTGAGG + Intronic
1066714555 10:38272695-38272717 GGAGGGGGGAGGATCATTTGAGG + Intergenic
1066783517 10:38978015-38978037 GGAGGGGGGAGGATCATTTGAGG - Intergenic
1068036214 10:51763327-51763349 TGAGGTGGGAGGATCACTTCAGG - Intronic
1068163314 10:53296486-53296508 CGGGGTGGGAGGATGGTTTCAGG + Intergenic
1068851026 10:61740912-61740934 TGAGGTGGGAGGATCATTTGAGG + Intronic
1069407569 10:68118597-68118619 GGAGGTGGGAGGATCACTTGAGG + Intronic
1069710917 10:70488216-70488238 TGAGGTGGGAGGATCATTTGAGG - Intronic
1069818913 10:71215645-71215667 TGGGGTGGGAGGAGATTTCCAGG - Intronic
1069889862 10:71646010-71646032 TGGGGTGGGGGGTGGATTTCAGG + Intronic
1069909010 10:71748682-71748704 GGGGGCGGGAGGAGCACTAGGGG - Exonic
1069998271 10:72356643-72356665 AGGGGTGGGAGGATCACTTGAGG + Intergenic
1070223917 10:74480509-74480531 TGAGGTGGGAGGATCATTTGAGG - Intronic
1071229673 10:83571040-83571062 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1071596903 10:86934527-86934549 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1071996084 10:91150973-91150995 GGGGGTGTGGGGTGCATTGCAGG - Intergenic
1072072658 10:91934467-91934489 GGAGGTGGGAGGATCACTTGAGG - Intronic
1072164892 10:92803724-92803746 GTGGGTGGGAGGATCACTTGAGG - Intergenic
1072174048 10:92898184-92898206 TGAGGTGGGAGGATCATTTGAGG + Intronic
1072267990 10:93748836-93748858 GGGGGTGCTAAGAGCATTTGGGG + Intergenic
1073207585 10:101776791-101776813 GGGGGAGGGGGAGGCATTTCTGG - Intronic
1073604530 10:104880556-104880578 GCAGGTGGGAGAAGCATTTTGGG + Intronic
1074496041 10:113980909-113980931 GGTGGGTGGAGGGGCATTTCAGG - Intergenic
1076240596 10:128902671-128902693 GGGGTTGGGAGGAGGGTTCCTGG - Intergenic
1076781775 10:132728516-132728538 GGGGCTGGAAGCGGCATTTCCGG + Intronic
1076828556 10:132982887-132982909 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828615 10:132983077-132983099 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828640 10:132983153-132983175 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828653 10:132983191-132983213 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828666 10:132983229-132983251 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828679 10:132983267-132983289 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828692 10:132983305-132983327 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076828705 10:132983343-132983365 GAGGGTGGGAGGAGGGTTACAGG - Intergenic
1076948490 10:133666746-133666768 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076949479 10:133670056-133670078 GGGGGAGGGGGGCGCGTTTCGGG - Intronic
1076950463 10:133673355-133673377 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076951448 10:133676654-133676676 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076952438 10:133679964-133679986 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076953426 10:133683274-133683296 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076955394 10:133742925-133742947 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076956384 10:133746235-133746257 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076957372 10:133749544-133749566 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076958361 10:133752854-133752876 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076959345 10:133756153-133756175 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1076960334 10:133759463-133759485 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
1078184972 11:9044462-9044484 CGAGGTGGGAGGATCACTTCAGG - Intronic
1078500955 11:11875833-11875855 CGAGGTGGGAGGATCACTTCAGG - Intronic
1079189430 11:18265442-18265464 AGGGGTGGAAGGAGCCTTCCAGG + Intergenic
1079665756 11:23103538-23103560 GGGTTTGGCAGAAGCATTTCAGG - Intergenic
1080277476 11:30519046-30519068 CGGGGCGGGAGGATCATTTGAGG + Intronic
1081456091 11:43224286-43224308 GGGTGTGGGAAGAGGATTTCTGG + Intergenic
1081579951 11:44345353-44345375 GGGGAGGGGTTGAGCATTTCAGG + Intergenic
1081901527 11:46632928-46632950 GGAGGTGGGAGGATCACTTGAGG + Intronic
1082838004 11:57665899-57665921 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1083109455 11:60390654-60390676 GGGGGTGGGAGAGGCATATTGGG + Intronic
1083274968 11:61591651-61591673 GGGGGCGTGGGGAGCATTTCAGG + Intergenic
1083326797 11:61877026-61877048 GTGGGTGGGAGGAGGACCTCAGG + Intronic
1083561894 11:63679749-63679771 GGGGGTGGGAGGATGACTCCTGG - Intergenic
1083631103 11:64095961-64095983 GGGGGTGGGGGGACCACTGCTGG - Intronic
1083960529 11:66012657-66012679 GGGGGTGGGGGGGGGAGTTCTGG - Intronic
1084043380 11:66555457-66555479 GGGGGTGGTCGGAGCATCCCAGG - Intronic
1084191225 11:67499855-67499877 TGGGGTGGGAGGAGCTGCTCGGG + Intronic
1084274902 11:68046272-68046294 TGTGGTGGGAGGAGGATCTCTGG + Intronic
1084436052 11:69140743-69140765 TGGGGTGGGTGGAGCTTTTATGG + Intergenic
1084521495 11:69665920-69665942 GGACGTGGGTGGATCATTTCAGG + Exonic
1084626570 11:70312421-70312443 TCGGGTGGGAGGATCATTTGAGG - Intronic
1084678737 11:70652575-70652597 TGAGGTGGGAGGATCATTTGAGG + Intronic
1084769750 11:71334924-71334946 GGGGTTGGTGGGAGCATTGCAGG + Intergenic
1085020563 11:73204317-73204339 TGGGGTGGGAGGATCACTTGAGG + Intergenic
1085274946 11:75292370-75292392 GGAGGTGGGAGGATCACTTGAGG - Intronic
1085563621 11:77493194-77493216 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1085714749 11:78862638-78862660 TGGGGTGAGAGGAGCTCTTCTGG - Intronic
1085821747 11:79801253-79801275 AGTGGTGGGAAGAGCATTTAAGG - Intergenic
1087776533 11:102261673-102261695 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1087821723 11:102719989-102720011 GGGCATGGGAAGAGTATTTCAGG + Intronic
1088479425 11:110280930-110280952 CGGGGCGGGAGGATCATTTGAGG + Intronic
1088549086 11:110992151-110992173 GGGGGTGGGAAGTGCATTCCAGG - Intergenic
1088706682 11:112470335-112470357 GGTGGTAGGAGAAGCATTCCTGG + Intergenic
1088901867 11:114124368-114124390 GAGGGTGGGAGAAGCATTTGGGG - Intronic
1089130043 11:116204966-116204988 GGGGGTGGGGAGAGGATTTGGGG + Intergenic
1089511626 11:119001989-119002011 CGAGGTGGGAGGATCATTTGAGG + Intronic
1089869182 11:121657101-121657123 GGTGGTTGGAGCAGGATTTCTGG - Intergenic
1089961302 11:122619081-122619103 GGTGGTGAGAGAAGCATGTCCGG + Intergenic
1090534942 11:127630818-127630840 TGGGGTGGGAGGGGCATCTTGGG - Intergenic
1090596774 11:128329049-128329071 GGGGGTGTGAGCACCCTTTCTGG + Intergenic
1090654951 11:128836070-128836092 GGGGGTGGGAGGAGGGGTTATGG - Intergenic
1090781686 11:130012412-130012434 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1091025078 11:132135039-132135061 GGGGAGGGGAGGAGGATTTGGGG - Intronic
1091723646 12:2830940-2830962 GGGGGTGGGGGGAGCATCCTGGG - Intronic
1092231380 12:6777565-6777587 GGGGGTGGCAGGGGCTGTTCTGG - Intronic
1092349162 12:7741653-7741675 CGAGGTGGGAGGACCATTTGAGG + Intronic
1092681910 12:10992643-10992665 TGAGGTGGGAGGAGCACTTGAGG - Intronic
1092734286 12:11565511-11565533 GGGGTTGGGTGGAGGGTTTCAGG - Intergenic
1092940967 12:13406669-13406691 AAGGGTGGGAGGAGGATTTAGGG - Intergenic
1094586697 12:31783541-31783563 TGAGGTGGGAGGATCACTTCGGG - Intergenic
1095201965 12:39395342-39395364 GGGGTGGGGATGGGCATTTCAGG - Intronic
1095565093 12:43613633-43613655 GGAGGTGGGTGGATCATTTGAGG - Intergenic
1096133866 12:49183317-49183339 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1096304395 12:50461722-50461744 CGTGGTGGGAGGATCATCTCAGG + Intronic
1096366104 12:51029614-51029636 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1096460251 12:51818359-51818381 GGGGGTGGGTGGAGGGTGTCAGG - Intergenic
1096515556 12:52153279-52153301 GGGAGTGGGAGGCACATTCCTGG + Intergenic
1096743351 12:53710324-53710346 GGGGTGGACAGGAGCATTTCAGG + Intronic
1097078963 12:56415518-56415540 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1097215462 12:57408161-57408183 CGAGGTGGGAGGATCATTTGAGG - Intronic
1097751574 12:63360196-63360218 GAGGGTGGGAGGAAAATTTGGGG + Intergenic
1097847993 12:64385927-64385949 CGAGGTGGGAGGATCATTTGAGG + Intronic
1098017808 12:66124958-66124980 TGGGGTGGGAGGATCATTTGAGG + Intronic
1099337791 12:81386389-81386411 TGGGGTGGGAGGATCACTTGAGG + Intronic
1100367759 12:93937109-93937131 GGGGAAGGGAAGGGCATTTCAGG + Intergenic
1100637310 12:96447195-96447217 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1101089625 12:101271632-101271654 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1101140380 12:101789714-101789736 GGAGGTGGGAGGATCACTTGAGG - Intronic
1102079088 12:110083675-110083697 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1102170501 12:110838842-110838864 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1102176195 12:110876799-110876821 TGAGGTGGGAGGATCATTTGAGG + Intronic
1102325121 12:111974408-111974430 CGGGGTGGGCGGATCATTTGAGG + Intronic
1102364800 12:112323143-112323165 GGAGGTGGGAGGATCACTTGAGG + Intronic
1102646890 12:114409440-114409462 GGGTTTGGGAGAAGGATTTCGGG - Intergenic
1102973573 12:117190223-117190245 AGGTGTGGAAGGAGCAGTTCCGG - Exonic
1103551242 12:121738952-121738974 CGAGGTGGGAGGATCATTTGAGG + Intronic
1103775070 12:123361314-123361336 GGAGGTGGGTGGATCATCTCAGG + Intronic
1103992041 12:124805800-124805822 CGAGGTGGGAGGATCACTTCAGG - Intronic
1104198779 12:126567299-126567321 GGGGGTGGGTGGGGCATGGCAGG - Intergenic
1104726992 12:131084364-131084386 GGGGTTGGGAGGAGAGATTCTGG - Intronic
1104788501 12:131467077-131467099 GAGGATGGGAGGGGCATGTCAGG + Intergenic
1104973505 12:132541886-132541908 GGTGGTGGGGGGAGCAGCTCTGG - Intronic
1105205323 13:18218425-18218447 GGAGGTGGGCGGATCATTTGAGG - Intergenic
1105452347 13:20511322-20511344 TGAGGTGGGAGGATCATTTGAGG - Intronic
1106143742 13:27034015-27034037 GGAGGTGGGAGCATCATTTGAGG - Intergenic
1106215146 13:27690558-27690580 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1106836945 13:33644775-33644797 GGGAGGGAGTGGAGCATTTCAGG - Intergenic
1107543102 13:41411655-41411677 TGGGGTGGGGGCAGCATTGCTGG + Intergenic
1107677513 13:42812176-42812198 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1108210361 13:48133169-48133191 GTGGGTGGTAGGAGTATTTCTGG - Intergenic
1108287844 13:48926379-48926401 GGTTCTGGGAGGATCATTTCAGG + Intergenic
1108700378 13:52938743-52938765 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1108809385 13:54202594-54202616 TGAGGTGGGAGGACCACTTCAGG - Intergenic
1112507739 13:99985212-99985234 GGCGGCGGGGGGAACATTTCTGG + Intronic
1112514962 13:100045337-100045359 AGGGGTGGGGGGATGATTTCAGG + Intergenic
1113030060 13:105983115-105983137 CGGGGTGGGAAAATCATTTCAGG + Intergenic
1113571661 13:111362312-111362334 GGGGGTGAGGGGTGCATGTCAGG + Intergenic
1113841390 13:113363652-113363674 GGGAGGGGGAGGAACCTTTCCGG - Intronic
1114631087 14:24160067-24160089 GTGGGAGGGAGGAGGCTTTCTGG + Intronic
1115104837 14:29747974-29747996 GGAGGTGGGAGGATCACTTGAGG - Intronic
1115393762 14:32883259-32883281 TGAGGTGGGTGGATCATTTCAGG - Intergenic
1115520126 14:34225152-34225174 TGGGGTGGGAGGATCACTTGAGG + Intronic
1115593752 14:34889230-34889252 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1117720330 14:58623082-58623104 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1117851530 14:59976284-59976306 GGGGATGGGAGGATGGTTTCAGG - Intronic
1117917968 14:60698560-60698582 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1119075800 14:71637495-71637517 TGAGGTGGGAGGATCATTTGAGG + Intronic
1119099486 14:71866934-71866956 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1119282515 14:73421904-73421926 CGAGGTGGGTGGATCATTTCAGG + Intronic
1119430271 14:74563055-74563077 GGTGGTGGGAGGAGCTTCTCAGG - Intronic
1119729168 14:76940208-76940230 GGGCTTGGGAGGAGCATTCCAGG + Intergenic
1119752368 14:77088738-77088760 AGGGGTGGGAGGAACAATGCAGG + Intergenic
1119835147 14:77742794-77742816 TGAGGTGGGAGGATCATTTGAGG - Intronic
1119973462 14:78998834-78998856 AGAGGTGGGAGGATCACTTCAGG - Intronic
1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG + Intronic
1120189260 14:81425338-81425360 GGAGGAGGGAGGATCATTTGAGG + Intronic
1120443911 14:84569418-84569440 CGGGGTGGGAGGATCACTTGAGG - Intergenic
1121044580 14:90778463-90778485 GGGGGTGGGAGGTGGCTTTGGGG - Intronic
1121114021 14:91331110-91331132 GGGGGTGGGGGGAGCGGTGCAGG + Intronic
1121248635 14:92483258-92483280 AGTGGGGGGAGGAGCATTCCTGG - Intronic
1121368106 14:93332921-93332943 GGCGGTGGGAGGAGGATGGCCGG - Exonic
1122044214 14:99011918-99011940 GGGGGTGAGAGGGGCATGTGAGG - Intergenic
1122089903 14:99331115-99331137 AAGGGTGGGAAGAGCATTTCTGG - Intergenic
1122209632 14:100166142-100166164 GGGAGTGGGGGGAGCCTGTCTGG + Intergenic
1122209642 14:100166165-100166187 GGGAGTGGGGGGAGCCTGTCTGG + Intergenic
1122209678 14:100166257-100166279 GGGAGTGGGGGGAGCCTGTCTGG + Intergenic
1122364321 14:101185478-101185500 CGGGGTGGGAAGAGCTTCTCTGG + Intergenic
1122561392 14:102617479-102617501 TGGGGTGGGAGGATCACTTGAGG + Intronic
1122721932 14:103727176-103727198 CGAGGTGGGAGGATCATTTGAGG - Intronic
1122754095 14:103964007-103964029 GGAGGTGGGAGGATCACTTGAGG + Intronic
1122880677 14:104689356-104689378 GGGGGTGGGACGCGCAGATCGGG - Intergenic
1124155021 15:27218105-27218127 GGAGGTGGGAGGATCACTTGAGG - Intronic
1124839968 15:33232579-33232601 TGAGGTGGGAGGATCATTTAAGG + Intergenic
1125135062 15:36332014-36332036 AGGGGTGGGAGGGGCAATTTTGG - Intergenic
1125162414 15:36661040-36661062 GGAGGTGGGTGGAGCATGTGAGG + Intronic
1125605162 15:40936151-40936173 GGGGGTGGGAGCCCCATTCCAGG - Intronic
1125641653 15:41236174-41236196 TGGGGTGGAAGGATCATTTGAGG - Intronic
1125750790 15:42026738-42026760 CGAGGTGGGAGGATCATTTGAGG + Intronic
1125799292 15:42430875-42430897 TGAGGTGGGAGGATCATTTGAGG - Intronic
1125997704 15:44179939-44179961 TGGAGTGGGAGGATCATTTGAGG + Intronic
1126377531 15:48011185-48011207 GGGAATGGGAGGAGCATTCGAGG - Intergenic
1126582191 15:50252139-50252161 TGTGGTAGGAAGAGCATTTCTGG + Intronic
1126804197 15:52329520-52329542 GAGAGTGGAAGAAGCATTTCAGG - Intronic
1127220838 15:56879163-56879185 CGGGGTGGGAGGATCACTTGAGG - Intronic
1127427783 15:58873291-58873313 TGGGGTGGGAGGATCACTTGAGG - Intronic
1128310232 15:66626455-66626477 TGAGGTGGGAGGATCACTTCAGG + Intronic
1128483000 15:68055167-68055189 GAGGGTGAGAGGAGCCTTTGGGG + Intronic
1128486960 15:68101966-68101988 TGGGGTGGGAGGATCACTTGAGG - Intronic
1128933187 15:71724104-71724126 AGTTGAGGGAGGAGCATTTCTGG + Intronic
1129006031 15:72374567-72374589 GGGGGTGGGAGCCACATTTACGG - Intronic
1129031662 15:72622935-72622957 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1129168438 15:73793080-73793102 GGGGGTGGGCGGATCACTTGAGG - Intergenic
1129210834 15:74066916-74066938 GGGGGTGGTAGGAGCATGGTAGG + Intergenic
1129403177 15:75298413-75298435 GGGGGTGGTAGGAGCATGGTAGG - Intergenic
1129449295 15:75641177-75641199 TGAGGTGGGAGGATCATTTGAGG + Intronic
1129671971 15:77612562-77612584 GGGACTGGGAGAAGCAGTTCTGG - Intergenic
1129718843 15:77866778-77866800 AGGGGTGGGAGGAGCTGTCCTGG + Intergenic
1129757055 15:78105011-78105033 GGGGGGGTGGGGAGCATTTCTGG + Exonic
1129893876 15:79089859-79089881 GGGGTTGGGAGCACCATTTTTGG + Intronic
1130460086 15:84154082-84154104 AGGGGTGGGAGGAGCTGTCCTGG - Intergenic
1130531725 15:84751992-84752014 GGAGGTGGGAGGATCACTTGAGG - Intronic
1130549216 15:84879191-84879213 TGAGGTGGGAGGATCACTTCAGG - Intergenic
1130907033 15:88247982-88248004 TGGGGTGCCAGGAGCATTTCTGG - Intronic
1132355475 15:101168310-101168332 GGGGGTGGGAGGAGCATCCTAGG + Intergenic
1132422508 15:101684455-101684477 AGGGGAGGGAACAGCATTTCTGG - Intronic
1132642902 16:985733-985755 GGGGGTGGCAGGGGCCTTGCAGG + Exonic
1132878190 16:2149405-2149427 GGGGCTGGGAGGACCATTTTGGG + Intronic
1132911277 16:2313670-2313692 GGAGGTGGGAGGATCACTTGAGG + Intronic
1133183130 16:4074460-4074482 AGAGGTGGGAGGAGCACTTGAGG + Intronic
1133239379 16:4405329-4405351 GGGGGTGTGAGGAGCAGCTAGGG + Intronic
1133323709 16:4930756-4930778 AGGGGTGGGAGGGGCATTCTGGG + Intronic
1133690719 16:8211847-8211869 TGGGGTGGGAGGATCACTTGAGG + Intergenic
1133691632 16:8221227-8221249 GGAGGTGGGTGGATCATTTGAGG + Intergenic
1133838221 16:9385419-9385441 GGGGGTGGGTGGATCACTTGAGG - Intergenic
1134022554 16:10931090-10931112 TGGGGTGGGAGGATCACTTGAGG + Exonic
1134197178 16:12168269-12168291 GGTGGAGGGAGGAGCCTTTGGGG + Intronic
1134197462 16:12170097-12170119 GGGGAAGGGAGGAGCACTCCTGG - Intronic
1134215160 16:12311546-12311568 GGCCTTGGGAAGAGCATTTCAGG - Intronic
1134294125 16:12930125-12930147 GGGAGTGGGAGGAAGATTCCTGG - Intronic
1134427923 16:14170222-14170244 TGAGGTGGGAGGATCATTTAAGG + Intronic
1134559632 16:15197148-15197170 GTGGGAGGGAAGAGAATTTCTGG + Intergenic
1134858838 16:17542881-17542903 TGAGGTGGGAGGATCATTTAAGG - Intergenic
1134871412 16:17655466-17655488 AGGGATGGGAGGAGCATTTCTGG - Intergenic
1134920172 16:18108759-18108781 GTGGGAGGGAAGAGAATTTCTGG + Intergenic
1135141504 16:19926158-19926180 TGAGGTGGGAGGAACTTTTCTGG - Intergenic
1135263672 16:21002867-21002889 GGCGGTGGGGGGAACATTTATGG - Intronic
1135630218 16:24030644-24030666 TGAGGTGGGAGGATCATTTGAGG + Intronic
1135880110 16:26247291-26247313 AGGGGTGAAAGGAGCATTTTTGG - Intergenic
1135887139 16:26320472-26320494 TGAGGTGGGAGGAGCACTTGAGG + Intergenic
1135912090 16:26570684-26570706 GCAGGTGGGAGGATCATTTGAGG + Intergenic
1135999786 16:27283415-27283437 TGGGGTGGGAGGCGCACTTGAGG + Intronic
1136018714 16:27425786-27425808 CGAGGTGGGAGGATCATTTGAGG - Intronic
1136292851 16:29286213-29286235 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1136406521 16:30051161-30051183 CGAGGTGGGAGGATCATTTGAGG + Intronic
1136469027 16:30466125-30466147 CGAGGTGGGAGGAGCACCTCAGG - Intergenic
1136556738 16:31011399-31011421 GGGGGTGGGAGGAGCTGGTGTGG - Intergenic
1136562193 16:31046417-31046439 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1136748084 16:32609779-32609801 GGGTGTGGGAGGAGGATAGCAGG - Intergenic
1138020923 16:53480624-53480646 AGGTGTGGGAGGAGCACTGCTGG - Exonic
1138115336 16:54356551-54356573 GTGGGTGGATGGAACATTTCAGG + Intergenic
1138125348 16:54433872-54433894 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1138620667 16:58208542-58208564 GGGGGTGGGGGGATGATTTTGGG - Intergenic
1139841983 16:69889079-69889101 TGGGGTGGGAGGATCACTTGAGG + Intronic
1140105651 16:71957563-71957585 GAAGGTGGGAGGATCATTTGAGG + Intronic
1140301666 16:73763920-73763942 GGGGGTGGGAGGACCATACTTGG + Intergenic
1140564664 16:76027302-76027324 GAGGCTGGGAGGAGTACTTCCGG - Intergenic
1140776661 16:78254957-78254979 AGGGCTGGGAGGAGGATTGCAGG + Intronic
1140884283 16:79229236-79229258 GGGGTTGGGAGAGGCTTTTCTGG - Intergenic
1140959283 16:79896800-79896822 GAGGGTGGGAGGATCACTTGAGG + Intergenic
1141015314 16:80443735-80443757 CGGGGTGGGAGGATCACTTGAGG - Intergenic
1141190812 16:81823381-81823403 GGGGTGGGGAGCAGCATTTCAGG - Intronic
1141229239 16:82149232-82149254 TGGGGTAAGAGGAGCATTCCTGG + Intronic
1141981547 16:87553292-87553314 GGGAGTGGAAGCAGCAGTTCTGG + Intergenic
1142098740 16:88260219-88260241 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1142392774 16:89813308-89813330 TGGGGTGGGAGGATCACTTGAGG + Intronic
1203050221 16_KI270728v1_random:868986-869008 GGGTGTGGGAGGAGGATAGCAGG - Intergenic
1142781757 17:2186680-2186702 GGATGTGGGAGGAGGATTCCAGG + Exonic
1142941420 17:3382705-3382727 GGGAGTGGAAAGGGCATTTCAGG - Intergenic
1143303938 17:5931315-5931337 TGAGGTGGGAGGATCATTTGAGG - Intronic
1143550778 17:7629138-7629160 TGAGGTGGGCGGATCATTTCAGG + Intronic
1143604218 17:7972125-7972147 GGGGGTGGCAGTGCCATTTCTGG - Intergenic
1143897861 17:10150819-10150841 CGAGGTGGGTGGAGCATTTTAGG - Intronic
1144481093 17:15629673-15629695 GGGAGTGGGAGGAGAATATGAGG - Intronic
1144569178 17:16384998-16385020 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1144724834 17:17496560-17496582 GGGGCTGGGGGGAGCAGTCCAGG + Intergenic
1144917216 17:18734064-18734086 GGGAGTGGGAGGAGAATATGAGG + Intronic
1144937286 17:18910185-18910207 CGAGGTGGGTGGATCATTTCAGG + Intronic
1145861834 17:28217640-28217662 GGGGGAGGAAGGAGCGTATCAGG - Intergenic
1145903150 17:28500970-28500992 GGAGGTGGGAGAAGCAATGCTGG - Intronic
1145939129 17:28732782-28732804 CGAGGTGGGTGGAGCATTTGAGG - Intronic
1145945092 17:28767894-28767916 GGGGGTGGGAGAGGTAGTTCAGG - Intronic
1146277219 17:31523485-31523507 AGGGGTGGGAGGAGGGTGTCTGG - Intronic
1147001399 17:37365189-37365211 AGAGGTGGGAGGATCATTTGAGG - Intronic
1147155711 17:38543670-38543692 GGGGGTGGGTGGGGCAGTCCTGG + Intronic
1147432095 17:40378014-40378036 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1148378173 17:47169221-47169243 GGAGGTGGGAGGATCACTTGAGG - Intronic
1148502274 17:48101002-48101024 GGGGGTGGGCCGAGCACTTGGGG - Exonic
1148680688 17:49471919-49471941 GGGGGTGGGGGAAGCATTCTGGG - Intronic
1148932624 17:51139478-51139500 CAAGGTGGGAGGATCATTTCAGG + Intergenic
1148980234 17:51567307-51567329 AGTGGTGGGAGGATCACTTCAGG + Intergenic
1149171915 17:53822475-53822497 GCGGGTTTGAGGAGCCTTTCTGG + Intergenic
1149281524 17:55110460-55110482 GGAAGTGGGAGGAGGAATTCAGG + Intronic
1149737371 17:59008808-59008830 GGGGGTGGGAATAGCATATGTGG - Intronic
1150250554 17:63702078-63702100 GGGGCGGCGGGGAGCATTTCCGG - Intergenic
1150318218 17:64187751-64187773 GGGTGTGGGAGGAGCACTCCAGG - Intronic
1150732040 17:67704185-67704207 TGGGGTGGGAGGATCACTTGAGG - Intergenic
1150828090 17:68494305-68494327 TGAGGTGGGTGGATCATTTCAGG + Intergenic
1151357801 17:73570828-73570850 AGGCCTGGGAGGAGCATTTCGGG - Intronic
1151572393 17:74933349-74933371 TGTGGAGAGAGGAGCATTTCAGG - Intronic
1151762731 17:76115568-76115590 CGAGGTGGGAGGATCATTTGAGG + Intronic
1152079350 17:78176839-78176861 GGGGGTGGGAGGTGTGTTCCTGG - Intronic
1152194431 17:78908849-78908871 GGAGCTGGGATGAGCATTGCTGG - Intronic
1152376293 17:79920456-79920478 GTGGGTGGCAGGGTCATTTCAGG + Intergenic
1152585126 17:81185911-81185933 GGGGGTGGGGGGAGGGCTTCGGG - Intergenic
1153680350 18:7494623-7494645 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1153888509 18:9490541-9490563 CGGGGTGGGAGGATCACTTGAGG - Intronic
1155067668 18:22281773-22281795 GGGGGTGAGAGGAACAGCTCCGG + Intergenic
1155134460 18:22974690-22974712 GGAGGTGGGTGGATCATTTGAGG - Intronic
1155171091 18:23267297-23267319 GGGGGTTGCAGGTGAATTTCAGG + Intronic
1155176048 18:23302212-23302234 GGGGATGGGAGGAGCAGCTGAGG + Intronic
1155247469 18:23924085-23924107 GGGGGTGGGAGGATCACTTGAGG - Intronic
1156300292 18:35830548-35830570 TGAGGTGGGAGGATCACTTCAGG + Intergenic
1156774670 18:40772387-40772409 GGGGATGGGGGGATGATTTCAGG + Intergenic
1157200174 18:45653251-45653273 GGGGGTGGGAGGAGCCCAGCAGG - Intronic
1157285358 18:46373849-46373871 GGGGGTGGGAGGGGGATCTGAGG - Intronic
1157326799 18:46674915-46674937 GGAGGTGGCAGGAGGATCTCTGG + Intronic
1157340177 18:46771362-46771384 AGGGGTGGGAAGAGCGATTCAGG - Intergenic
1157560075 18:48639538-48639560 GGGGGAGGCAGGAGCATCTGTGG + Intronic
1157755193 18:50211369-50211391 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1157784604 18:50470360-50470382 GGAGGTGGGAGGATCATTTGAGG + Intergenic
1158049483 18:53199321-53199343 CGAGGTGGGAGGATCATTTGAGG - Intronic
1158427591 18:57353293-57353315 GGGGGTTGGGGGAGGCTTTCAGG + Intronic
1159324580 18:66897844-66897866 GGGGTTGGGAGGATGGTTTCAGG - Intergenic
1159917079 18:74197695-74197717 TGGGAGGGGAGGAGCATTTCCGG - Intergenic
1160447968 18:78941873-78941895 GGGGTTGGGGGAAGCATTTTAGG + Intergenic
1160591706 18:79948571-79948593 CGGGGTGGGAGGATCACTTGAGG - Intronic
1160719738 19:591901-591923 TGGGGTGGGAGGAGGATTCCAGG - Intronic
1160885733 19:1346699-1346721 AGAGGTGGGAGGAGCTTTTGAGG - Intergenic
1160947128 19:1648823-1648845 GGGGGGGGGAGCAGAATTTAAGG + Intronic
1160964047 19:1737985-1738007 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1161193776 19:2974756-2974778 GGAGGTGGGAGGATCACTTGGGG + Intergenic
1161262503 19:3345615-3345637 GGGGGGGGGAAGAGCGTTTCAGG - Intergenic
1161568735 19:5018258-5018280 TGAGGTGGGAGGATCATTTGAGG - Intronic
1161620001 19:5292854-5292876 GGGGGTGGGGGGAGGAGGTCGGG + Intronic
1162138813 19:8572926-8572948 GGAGGTGGGAGGATCACTTGAGG - Intronic
1162275235 19:9648533-9648555 GGGGGTGGGCAGATCATTTGAGG - Intronic
1162567075 19:11450538-11450560 TGAGGTGGGAGGATCATTTGAGG - Intronic
1162938294 19:13993040-13993062 CGAGGTGGGAGGATCATTTGAGG + Intronic
1162971854 19:14185524-14185546 TGAGGTGGGAGGATCATTTGAGG - Intronic
1163139644 19:15338391-15338413 GGAGGTGGGCGGATCATTTAGGG - Intergenic
1163160225 19:15459888-15459910 GGGGGTGGAAAAAGCATTCCAGG - Intronic
1163179218 19:15587036-15587058 TGGGGTGGGCGGATCACTTCAGG - Intergenic
1163498257 19:17659666-17659688 GGGTATGGCAGGAGCATTGCTGG + Intronic
1163498880 19:17663653-17663675 TGGGGTGGGGGGAGCAGTTGGGG - Intronic
1163544303 19:17932000-17932022 GGAGGTGGGAGGAGTCTTGCGGG + Intergenic
1163609120 19:18292056-18292078 TGGGGCGGGAGGCGCATTCCAGG + Intergenic
1163796708 19:19342170-19342192 GGGGGTGGGAGGTGGCTTCCTGG - Intronic
1163877795 19:19889576-19889598 TGGGGTGGGTGGATCATTTGAGG - Intronic
1164654784 19:29912354-29912376 TGAGGTGGGAGGATCACTTCAGG - Intergenic
1164784773 19:30921270-30921292 TGGGGTGGGAGGATCGTTTGAGG - Intergenic
1164788868 19:30959252-30959274 GGAGGTGGGAGGCCCATTCCTGG + Intergenic
1164795567 19:31024659-31024681 TGAGGTGGGAGGATCATTTGGGG + Intergenic
1164799738 19:31066853-31066875 GGGGTTGGGGAGAGCATTTATGG - Intergenic
1164870433 19:31638960-31638982 GGTGGTGGGAGGATCACTTGAGG + Intergenic
1164973563 19:32552958-32552980 GAAGGTGGGAGGATCATTTGAGG + Intergenic
1165006970 19:32815191-32815213 GGGGGTGGCAAGAGCAAATCTGG - Intronic
1165020483 19:32920310-32920332 CGAGGTGGGAGGAGCACTTGAGG - Intronic
1165024541 19:32950085-32950107 GGAGGTGGGAGGATCATTTGAGG - Intronic
1165193674 19:34084613-34084635 TGAGGTGGGAGGAGGATTGCTGG - Intergenic
1165811412 19:38614180-38614202 GGAGATGGGAGTGGCATTTCAGG - Intronic
1165842289 19:38795978-38796000 CGGGGTGGGAGGATCACTTGAGG - Intergenic
1165881647 19:39048200-39048222 TGAGGTGGGAGGATCCTTTCAGG + Intergenic
1166213492 19:41321699-41321721 GGAAGTGGGAGGAGCATTCCTGG + Intronic
1166329813 19:42071271-42071293 GGGGGTGGGTGGTGCATGGCTGG + Intronic
1166356151 19:42228851-42228873 GGGCCTGGGAGGAGCCTATCAGG - Intergenic
1166534296 19:43562509-43562531 TGGGGTGGGAGGATCACTTGAGG + Intronic
1166731570 19:45061990-45062012 GGGGGTGGGTGGAGGAATTAAGG + Intronic
1166822581 19:45589597-45589619 TGTTGTGGGAAGAGCATTTCAGG - Intronic
1167076547 19:47253400-47253422 AGAGGTGGGAGGATCATTTAAGG - Intergenic
1167126763 19:47554859-47554881 GGAGGTGGGAGGATCACTTGAGG + Intronic
1167142687 19:47662800-47662822 GGACGAGGGAGGAGAATTTCTGG + Intronic
1167242515 19:48352847-48352869 TGAGGTGGGAGGATCATTTGAGG - Intronic
1167305873 19:48709055-48709077 TGAGGTGGGAGGAGCACTTGGGG + Intergenic
1167398594 19:49248922-49248944 GGAGGTGGGTGGATCACTTCAGG - Intergenic
1167822137 19:51937961-51937983 CGAGGTGGGAGGATCATTTGAGG - Intronic
1168022723 19:53621363-53621385 ACGGGTGGGAGGATCATTTGAGG - Intergenic
1168323246 19:55522907-55522929 GGAGGTGGGTGGATCATTTGAGG - Intergenic
925570695 2:5309564-5309586 GTCTGTGGGAGGATCATTTCTGG - Intergenic
925886869 2:8401118-8401140 GGGGGAAGGAGAAGCATTGCTGG + Intergenic
925936866 2:8772241-8772263 AGAGGTGGGAGGACCATTTGAGG + Intronic
926882179 2:17557979-17558001 GGGTGCTGCAGGAGCATTTCTGG + Intronic
926929108 2:18018352-18018374 GAGGGTGGGAGGCGGATTTGTGG - Intronic
927430028 2:23019640-23019662 TGGGAGGGCAGGAGCATTTCTGG - Intergenic
928413651 2:31073486-31073508 GGGGGGGGGAACAGCATTTGGGG + Intronic
928549893 2:32359799-32359821 TGAGGTGGGAGGATCATTTGAGG - Intronic
929625703 2:43404423-43404445 CAGAGTGGGAGGAGCACTTCAGG - Intronic
929948594 2:46389141-46389163 GGGGGTGACAGGATCATTTTTGG - Intergenic
930794121 2:55369687-55369709 GGTGGTGGGTGGATCATTTGAGG - Intronic
931018839 2:58018847-58018869 TGGGGCAGGAGAAGCATTTCAGG - Intronic
931078149 2:58739708-58739730 GGAGGTGGGAGGATCACTTGAGG + Intergenic
931389691 2:61830738-61830760 GAGGGGGGGAGGATCATTTGAGG - Intronic
931390042 2:61833795-61833817 GGAGGTGGGAGGATCACTTGAGG + Intronic
932077792 2:68681387-68681409 GGGGGTGGGACGGGTCTTTCAGG - Intronic
932219733 2:69990414-69990436 TGAGGTGGGAGGATCATTTGAGG - Intergenic
932539727 2:72639346-72639368 GGTGCTGGCAGGTGCATTTCTGG - Intronic
932552077 2:72781904-72781926 CGAGGTGGGAGGATCATTTGAGG + Intronic
933085329 2:78047910-78047932 CGAGGTGGGAGGATCATTTGAGG + Intergenic
933214616 2:79615776-79615798 GTGGGTGTGAGGAGAATTCCTGG + Intronic
933325528 2:80831730-80831752 GGGGGTGGGTGCTGAATTTCAGG + Intergenic
933590007 2:84222120-84222142 TGGGGTGGGAGGATCACTTGAGG - Intergenic
933763277 2:85689483-85689505 GGAGGTGGGAGGAGGATGTGAGG - Intronic
934100782 2:88651159-88651181 CGAGGTGGGAGGATCATTTGAGG + Intergenic
934136142 2:88998022-88998044 GGAGGTGGGAAGGGGATTTCAGG + Intergenic
934757424 2:96833741-96833763 TAGGGAGGGAGGAGGATTTCTGG + Exonic
934999444 2:98999126-98999148 TGAGGTGGGAGGATCATTTGAGG - Intronic
935639105 2:105273954-105273976 GGGTGTGTGAGGAGGACTTCAGG - Intronic
936286137 2:111182774-111182796 GCAGGTGGGAGGAGCATGTCTGG - Intergenic
936616237 2:114050476-114050498 CAGGGTGGGAGGAGCACTTGGGG + Intergenic
937117185 2:119416141-119416163 TGAGGTGGGAGGATCATTTGAGG + Intergenic
937118430 2:119425976-119425998 GGGTCTGGGAGGAGCAATACGGG - Intergenic
937342073 2:121097432-121097454 TGGGGTGGGTGGATCATTTGAGG + Intergenic
939187990 2:138882872-138882894 GGGAGTAGGAGGAGGATATCTGG + Intergenic
939579498 2:143931196-143931218 CGGGGTGGGAGGATCACTTGAGG - Intergenic
939871235 2:147528083-147528105 GGGGGTGGGAGGCACATTGCTGG + Intergenic
939940276 2:148341152-148341174 TGGGGTGGGAGGAGGATGACAGG - Intronic
940657547 2:156507242-156507264 AGGGGTGGGAGGATCACTTGAGG - Intronic
941398081 2:164995773-164995795 TAAGGTGGGAGGATCATTTCTGG + Intergenic
941963369 2:171275830-171275852 TGAGGTGGGAGGATCATTTGAGG - Intergenic
943081618 2:183264245-183264267 GGGGGGGGGGGCAGCATTTAGGG - Intergenic
943253279 2:185558824-185558846 GGAGGTGGGTGGATCATTTGAGG + Intergenic
943438326 2:187895516-187895538 TGAGGTGGGAGGATCATTTGAGG + Intergenic
943754820 2:191546875-191546897 GGTGGTGGGGGGAGCTATTCCGG - Intergenic
944140679 2:196452698-196452720 GGTGGTGGAGGGATCATTTCTGG + Intronic
944596663 2:201267300-201267322 GCAGGTGGGAGGGGGATTTCAGG - Intronic
944747589 2:202674005-202674027 GGTGCAGGGAGGAACATTTCAGG - Intronic
944886149 2:204064623-204064645 GGGGGTGGGAAGATGGTTTCTGG - Intergenic
944954840 2:204796940-204796962 GGAAGTGGGTGGATCATTTCAGG + Intronic
945296360 2:208175049-208175071 GGGGGTGGGTGGATCAGTTGAGG + Intronic
946305536 2:218855090-218855112 CAGGGAGGGAAGAGCATTTCAGG - Intergenic
946321413 2:218956669-218956691 GTGAGTGAGAGGAGCATCTCTGG + Intergenic
946347585 2:219123747-219123769 GGGGGTCGGATCAGCTTTTCAGG - Intronic
946738477 2:222777857-222777879 GGAGGTGGGCGGATCATTTGAGG + Intergenic
946767680 2:223055088-223055110 CGAGGTGGGAGGATCATTTAAGG - Exonic
947699228 2:232218513-232218535 CGAGGTGGGAGGATCATTTGAGG + Intronic
947752721 2:232541189-232541211 GGGGGTGGCAGGAGGATTGCTGG + Intronic
948386754 2:237585496-237585518 GGGGGTGGGAAGATCATTTTGGG - Intronic
948902322 2:240962965-240962987 GGCAGTGGGAGGAGGATCTCTGG - Intronic
1168747331 20:254704-254726 GGGGGTGGGAGGATGGTTTTGGG + Intergenic
1168809750 20:697379-697401 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1168847807 20:957410-957432 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1169046172 20:2536233-2536255 GGAGGTGTGAGGAGCATCCCAGG - Intergenic
1169143351 20:3238199-3238221 GGGGGTGGGAGGAGTATCTGAGG + Intronic
1169267069 20:4173202-4173224 GGGGGCAGGAGGGGCCTTTCTGG - Intronic
1170555419 20:17511042-17511064 TGAGGTGGGAGGATCATTTGAGG - Intronic
1172016266 20:31875552-31875574 GAGGATGGGAAGAGCATTCCAGG - Intronic
1172119970 20:32592487-32592509 TGAGGTGGGTGGATCATTTCAGG + Intronic
1172737445 20:37138156-37138178 TGAGGTGGGAGGATCATTTGAGG - Intronic
1172743905 20:37191847-37191869 TGGGGTGGGAGGATCACTTGAGG + Intronic
1172965258 20:38829805-38829827 GGGGGTGGGAGGAGGTGTGCGGG + Intronic
1174026851 20:47584060-47584082 GGAGGTGGGAGGATCACTTGAGG + Intronic
1174128906 20:48328172-48328194 GGCTGTGGGAAGAGCATTCCAGG + Intergenic
1174230850 20:49044648-49044670 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1174264319 20:49320200-49320222 GGCTGTGGGAGGATCATTTGAGG + Intergenic
1174289801 20:49499992-49500014 GGGGGTGGCAGGAGCCACTCTGG - Intergenic
1174410903 20:50334637-50334659 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1174800233 20:53557245-53557267 TGAGGTGGGAGGAGCAGCTCCGG + Intergenic
1175167989 20:57059640-57059662 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1175224916 20:57439307-57439329 GGGGGTGGGAGGGGCAGTGCAGG - Intergenic
1175502831 20:59462359-59462381 GGGTCTGGGAGGAGCCTCTCAGG + Intergenic
1176424759 21:6541314-6541336 GGTGGTGGGAGGGGTGTTTCTGG + Intergenic
1176637561 21:9262450-9262472 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1177785483 21:25666761-25666783 GGAGGTGGGAGGATCACTTGAGG - Intronic
1178677960 21:34647001-34647023 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1178946562 21:36953192-36953214 TGGGGTGGGAGGATCACTTTAGG - Intronic
1179058219 21:37955334-37955356 GGGGGAGGGAGGATGGTTTCAGG + Intronic
1179668835 21:42931336-42931358 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1179700248 21:43149623-43149645 GGTGGTGGGAGGGGTGTTTCTGG + Intergenic
1179807336 21:43847988-43848010 GGGGGTGGGAAGAACATGGCTGG + Intergenic
1180609644 22:17086770-17086792 GGGGGTAGCAGGAGCATTCCAGG + Intronic
1180643226 22:17316579-17316601 CGGGGTGGGTGGATCATTTGAGG + Intergenic
1180709031 22:17827243-17827265 GGGGGCGGGAGGGGCATGTTTGG - Intronic
1180760652 22:18200296-18200318 GGAGGTGGGTGGATCATTTGAGG + Intergenic
1180770966 22:18384593-18384615 GGAGGTGGGTGGATCATTTGAGG + Intergenic
1180775016 22:18424400-18424422 GGAGGTGGGTGGATCATTTGAGG - Intergenic
1180808091 22:18735455-18735477 GGAGGTGGGTGGATCATTTGAGG - Intergenic
1180895458 22:19328725-19328747 TGAGGTGGGAGGACCATTTGAGG - Intergenic
1181071015 22:20340420-20340442 GGAGGTGGGTGGATCATTTGAGG - Intergenic
1181194087 22:21169369-21169391 GGAGGTGGGTGGATCATTTGAGG - Intergenic
1181215355 22:21323409-21323431 GGAGGTGGGTGGATCATTTGAGG + Intergenic
1181280144 22:21714026-21714048 GGCGGTGGGGGGTGCATCTCAGG - Intronic
1181686656 22:24533858-24533880 GGGAGGGGGAGCAGCAATTCTGG - Intergenic
1182130283 22:27845424-27845446 GGGGGTGGGGGCTGTATTTCAGG - Intergenic
1182307681 22:29382277-29382299 TGAGGTGGGAGGATCATTTGAGG - Intronic
1182360677 22:29744660-29744682 TGGGGTGGGAGAAGAATTCCAGG + Intronic
1182473427 22:30562406-30562428 GGAGGTGGGAGGATCACTTGAGG - Intronic
1182501076 22:30748107-30748129 AGGGGTGGGTGGATCATTTGAGG - Intronic
1183134545 22:35873911-35873933 GGAGGTGGGTGGAGCACTTGAGG - Intronic
1183141447 22:35944841-35944863 TGAGGTGGGAGGATCATTTGAGG + Intronic
1183201527 22:36388151-36388173 GGGGGTGGGCGGAGCCTCTGCGG + Intergenic
1183355781 22:37358635-37358657 GGGAGTGGGACTACCATTTCTGG + Intergenic
1183399891 22:37596579-37596601 GGGGGTTCCAGGAGTATTTCTGG - Intergenic
1183741596 22:39671483-39671505 AAGGGTGGAAGGACCATTTCAGG + Intronic
1183882698 22:40848512-40848534 TGGGGTGGGTGGATCATTTGAGG + Intronic
1183917764 22:41136561-41136583 TGAGGTGGGAGGAGCACTTGAGG + Intronic
1184170709 22:42757987-42758009 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1184539202 22:45108714-45108736 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1184631981 22:45788879-45788901 TGAGGTGGGAGGATCATTTGAGG - Intronic
1184927099 22:47650603-47650625 GGGGGTAGGAGGCCCATGTCTGG + Intergenic
1185414239 22:50701066-50701088 GGGGGTGGGGGGAGCAGATCTGG - Intergenic
1203232800 22_KI270731v1_random:125765-125787 GGAGGTGGGTGGATCATTTGAGG + Intergenic
949115032 3:310195-310217 CGAGGTGGGAGGATCATTTAAGG + Intronic
949379658 3:3430731-3430753 GGGGATGGGAGGTGCATTAATGG - Intergenic
949868231 3:8564502-8564524 GGAGGTAGGAGGATCATTTGAGG - Intronic
950372219 3:12540639-12540661 GAGGGTGGGAGGATCACTTGAGG + Intronic
950435935 3:12980146-12980168 AGGGGTGGTGGGAGCATTACAGG - Intronic
950657208 3:14443998-14444020 GGGGTTGGCAGGAGCATGGCAGG - Intronic
951238263 3:20260478-20260500 GGGTGTGGGAGAACCTTTTCGGG - Intergenic
951481203 3:23164309-23164331 TGAGGTGGGAGGATCATTTGAGG + Intergenic
951726430 3:25765961-25765983 TGAGGTGGGAGGATCATTTGAGG - Intronic
952180749 3:30914070-30914092 TGAGGTGGGAGGATCATTTGAGG - Intergenic
952377466 3:32779768-32779790 GGAGGTGGGAGGATCACTTGAGG - Intergenic
952544782 3:34407189-34407211 GGGGGTGAGGGGAGGCTTTCAGG - Intergenic
952831082 3:37565560-37565582 GGTGGTGGGTACAGCATTTCAGG + Intronic
952924337 3:38310143-38310165 TGGGGTGGGAGGAGCGCTTGAGG + Intronic
952961780 3:38596664-38596686 GGGGGTGGTAGGGGGACTTCTGG - Intronic
953016313 3:39080190-39080212 GGGGGAGGGAGGGGTATTACTGG - Intronic
953030701 3:39177978-39178000 GGTGGTGGGCGGAGCTTTTGAGG + Intergenic
953135263 3:40176515-40176537 TGAGGTGGGAGGATCATTTGAGG + Intronic
953484482 3:43282535-43282557 AGAGGTGGGAGGATCACTTCAGG - Intergenic
953599263 3:44347465-44347487 GGGGCTGGGAGGAGGAGTGCAGG + Intronic
953622132 3:44542481-44542503 GGAAGAGGGAAGAGCATTTCTGG - Intergenic
953632388 3:44629982-44630004 TGAGGTGGGAGGATCATTTGAGG + Intronic
953696990 3:45167361-45167383 GGGGGTGGTATGTGCATATCTGG + Intergenic
953952963 3:47206553-47206575 CGAGGTGGGAGGATCATTTGAGG + Intergenic
954354177 3:50071147-50071169 GGGGAAGGGAAGGGCATTTCAGG + Intronic
954373083 3:50179556-50179578 GGAGGTGGGAGGAACACTTTAGG - Intronic
954377980 3:50204978-50205000 GGGTGTGGGCAAAGCATTTCAGG + Intergenic
954579370 3:51694905-51694927 GGGGGTGAGAGGAAAGTTTCCGG + Intronic
954792633 3:53144510-53144532 TGAGGTGGGCGGATCATTTCAGG - Intergenic
954797645 3:53169608-53169630 TGGGGTGGGAGGAGGATCCCAGG + Intronic
954883164 3:53849441-53849463 TGAGGTGGGAGGATCATTTGAGG + Intronic
954906253 3:54065546-54065568 GGGGGTGGGAGAAGCCTTCATGG + Intergenic
956419601 3:69073268-69073290 GTGGGTTGGGGGAGCATTTTTGG - Intronic
956502120 3:69898244-69898266 GGATGTGGGATGAGTATTTCAGG + Intronic
956665345 3:71637175-71637197 TGAGGTGGGAGGATCATTTGAGG - Intergenic
956791494 3:72683513-72683535 GGGGGTGGGGGGAGCAGGACAGG + Intergenic
956825942 3:72996962-72996984 GGGGGTGGGGGGAGGCGTTCCGG + Exonic
956979173 3:74615740-74615762 TGAGGTGGGAGGAGCACTTGAGG + Intergenic
956982491 3:74654855-74654877 GGTAGTGGGGGGAGCATTTTTGG - Intergenic
958056505 3:88419213-88419235 GGGGGTGGGAGAATAGTTTCAGG - Intergenic
958148697 3:89660721-89660743 GGCGGAGGCAGGAGCATTGCTGG + Intergenic
958680141 3:97319433-97319455 TGAGGTGGGCGGAGCATTTGAGG + Intronic
959076537 3:101754990-101755012 TGGGGTGGGAGGATCACTTGAGG - Intronic
959087835 3:101869854-101869876 GTGGGTGGGTGGATGATTTCAGG + Intergenic
960324780 3:116282745-116282767 GGGGGTGGGGGGAGTATCACTGG - Intronic
960858426 3:122126714-122126736 AGGAGTTGTAGGAGCATTTCTGG - Intergenic
960904514 3:122586440-122586462 TGAGGTGGGAGGATCACTTCAGG - Intronic
961131723 3:124474741-124474763 GGCAGTGGGAGAAGGATTTCAGG - Intronic
961394669 3:126578609-126578631 GGGGGTGGGCAGAGCATTATGGG - Intronic
961727266 3:128939732-128939754 GGGGTTGGGAGGATGATTTCAGG + Intronic
961823269 3:129586108-129586130 GGGGGTGGGAGGAGCTGACCTGG - Intronic
961830701 3:129621642-129621664 GGGGGTGGGAGGTGCAGATGCGG - Intergenic
962069100 3:132014318-132014340 GGGGGTGGGAGGAGCATTCGGGG - Intronic
962370348 3:134816324-134816346 CGAGGTGGGCGGAGCATTTGAGG - Intronic
962439063 3:135395156-135395178 GGGGGTGGGAGAGGCTTTTCTGG - Intergenic
962548520 3:136463643-136463665 TGAGGTGGGAGGATCACTTCAGG + Intronic
963677197 3:148327281-148327303 GGGGGCGGGGGGAACATTCCAGG - Intergenic
963842459 3:150121553-150121575 GGTGGTGTGAGGAGGGTTTCTGG + Intergenic
964110780 3:153085193-153085215 GGAGGTGGGAGGATCACTTGAGG - Intergenic
964634596 3:158845256-158845278 AGAGGTGGGAGGATCATTTCAGG + Intergenic
964798048 3:160521364-160521386 TGGGGTGGAAGGATCATTTGAGG + Intronic
964846430 3:161049178-161049200 TGGGGTGGGAGGATCACTTGAGG + Intronic
965231529 3:166060399-166060421 GGGAGTGGGAGGACAATTGCTGG - Intergenic
965387729 3:168064667-168064689 CGAGGTGGGAGGATCATTTCAGG - Intronic
965722675 3:171678915-171678937 GAGGGAGAAAGGAGCATTTCAGG - Intronic
966163407 3:176991094-176991116 GGGGGTGGGGGGATGGTTTCAGG + Intergenic
966163779 3:176994274-176994296 GGGGGTTGGAAGAGAATTTGGGG - Intergenic
966916078 3:184584681-184584703 GGGGGCGGGAGGCGCCTTCCAGG - Intronic
967126838 3:186431713-186431735 TGTGGTGGGAGGATCATTTGAGG - Intergenic
967208666 3:187147584-187147606 GGGGGCGGGGGGAGGGTTTCAGG + Intronic
967281479 3:187827929-187827951 TGAGCTGGGAGGAGCAATTCTGG + Intergenic
967423268 3:189297472-189297494 GGGAGTGGGAGGAGCAGTATGGG - Intronic
967826256 3:193879929-193879951 GGGAGTGGGAGGACCCTTTCAGG + Intergenic
967857596 3:194129943-194129965 GGGGGTGGGGGGAGTATTACAGG + Intergenic
968050500 3:195651692-195651714 GGGGGTGGGGGGAGGCGTTCCGG - Intergenic
968096822 3:195937167-195937189 GGGGGTGGGGGGAGGCGTTCCGG + Intergenic
968105325 3:195996662-195996684 GGGGGTGGGGGGAGGCGTTCCGG + Intergenic
968117545 3:196101090-196101112 TGGGGTGGGAGGATCACTTGAGG + Intergenic
968222919 3:196951728-196951750 TGGGGAGGGAGTAGCATGTCTGG - Intronic
968303614 3:197634239-197634261 GGGGGTGGGGGGAGGCGTTCCGG + Intergenic
968337111 3:197923375-197923397 GGAGGTGGAAGGATCATTTGAGG - Intronic
1202749334 3_GL000221v1_random:142571-142593 CGAGGTGGGAGGATCATTTGAGG + Intergenic
968534471 4:1114118-1114140 GGGGGTGGGGGGGGCAGTTGGGG + Intergenic
968747537 4:2368143-2368165 TGAGGTGGGAGGAGCACTTGAGG + Intronic
969253086 4:5982786-5982808 GGGGGTGGGGGGAAGCTTTCTGG + Intronic
969341855 4:6547030-6547052 TGGGGTTGGGGGAGCATTTGGGG + Intronic
969580450 4:8061672-8061694 GGGGGTAAAGGGAGCATTTCGGG - Intronic
969757957 4:9162249-9162271 GGTGGTGGGAGGGGCAGTTGGGG + Intergenic
970464153 4:16306388-16306410 GGGGGTAGGAGGAGCATTTGGGG - Intergenic
970535212 4:17023479-17023501 CGAGGTGGGAGGATCATTTGAGG - Intergenic
971073286 4:23119569-23119591 GGTGGGGGGAAGAGCATCTCAGG + Intergenic
971369115 4:26001601-26001623 GGGGGTGGGAGGACCAGTGAAGG + Intergenic
971371778 4:26025302-26025324 GTGGATGGTAGGAGTATTTCTGG - Intergenic
971380127 4:26088957-26088979 GGGGGTGGGTGGAGCAGGTGTGG + Intergenic
972162468 4:36244110-36244132 GGGGGTGGGAGGACCCTGTCTGG - Intronic
972337666 4:38122111-38122133 GGTGGTGAGTGGAGCATCTCTGG + Intronic
972577645 4:40366609-40366631 TGAGGTGGGAGGATCATTTGAGG + Intergenic
972735385 4:41835734-41835756 GGGGGTGGGAGGTACATGTAAGG + Intergenic
972760428 4:42097661-42097683 TGGGGTGGGAGGATCACTTGAGG + Intergenic
972916162 4:43882782-43882804 GGGGTTGGGAGGATAATTTCAGG - Intergenic
973132907 4:46670851-46670873 AGGACTGGGTGGAGCATTTCAGG + Intergenic
973578077 4:52312910-52312932 CAGGGTGGGAGGAGAATATCTGG + Intergenic
973805358 4:54520658-54520680 GGAGGTGGGAGGATCACTTGAGG - Intergenic
973848553 4:54937798-54937820 AGGAGTGGGAGGGGCATTTCAGG + Intergenic
975441803 4:74419718-74419740 GGGGGTGGGGGGATGGTTTCAGG + Intergenic
976782402 4:88775469-88775491 TGAGGTGGGAGGATCATTTGAGG + Intronic
977330997 4:95637222-95637244 GCCGGTAGGAGGAGCATTCCCGG + Intergenic
977569278 4:98612803-98612825 GAGGGAGGAAGGAGCATTTCAGG - Intronic
978107906 4:104926951-104926973 GGAGGTGGGAAGAGCCTTTTTGG - Intergenic
978198855 4:106001234-106001256 GGGGAAGGGAAGAGCATTTCAGG + Intronic
979622019 4:122808809-122808831 GGAGGTGGGAGGATCACCTCAGG + Intergenic
980186222 4:129464282-129464304 GAAGGTGGGAGGATCATTTGAGG - Intergenic
980729910 4:136811995-136812017 GGGGGAAGGGGGAGCCTTTCTGG + Intergenic
980927217 4:139149960-139149982 CGAGGTGGGTGGATCATTTCAGG + Intronic
981589246 4:146339573-146339595 GGGGGTGGCAGGAGGATCTGTGG - Intronic
982724274 4:158888955-158888977 AGAGGTGGGAGGAGCACTTGGGG + Intronic
984874602 4:184356041-184356063 TGAGGTGGGAGGATCATTTAAGG + Intergenic
985101149 4:186459888-186459910 AGGGGTGGGAGGAGGAATTCTGG - Intronic
985377203 4:189354373-189354395 GGCGATGGAAGGAGCTTTTCAGG + Intergenic
985383390 4:189419477-189419499 GGGACTGTGAGGAGCACTTCAGG + Intergenic
985451944 4:190067551-190067573 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985452931 4:190070842-190070864 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985453920 4:190074135-190074157 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985454908 4:190077428-190077450 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985455894 4:190080725-190080747 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985456879 4:190084019-190084041 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985457867 4:190087315-190087337 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985458855 4:190090612-190090634 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985463107 4:190173375-190173397 GGGGGAGGGGGGCGCGTTTCGGG - Intergenic
985507246 5:290375-290397 GGGGGTGGGGGGAGGCATTCCGG - Intronic
985556303 5:559891-559913 CAGGGTGGGAGGATCATTTGAGG - Intergenic
985746048 5:1648382-1648404 GAGGGTGGGATCAGCAGTTCTGG - Intergenic
985886718 5:2685928-2685950 GGAGGAGGGAGGAACATTTCAGG + Intergenic
986130179 5:4922921-4922943 GGTGGATGGAGGAACATTTCTGG + Intergenic
986419513 5:7564677-7564699 GGTGGCAGGATGAGCATTTCAGG - Intronic
986628101 5:9741766-9741788 GGGACTGGGAGGAGCTTTTAGGG - Intergenic
986869747 5:12032120-12032142 GGAGGTGGGAGGATCACTTGAGG - Intergenic
987311493 5:16685442-16685464 TGAGGTGGGAGGATCATTTGAGG - Intronic
987484874 5:18512634-18512656 TGAGGTGGGAGGATCATTTGAGG + Intergenic
988069637 5:26271049-26271071 AGGGGTGGGAGGATCACTTGAGG - Intergenic
988518554 5:31925984-31926006 TGAGGTGGGAGGATCATTTGAGG + Intronic
988595253 5:32585181-32585203 TGGGGTAGGAAGACCATTTCTGG + Intronic
990361964 5:55029786-55029808 TGAGGTGGGAGGATCATTTGAGG - Intronic
990727158 5:58768658-58768680 GGAGATGGGAGGAGCATCTCAGG + Intronic
990948801 5:61276346-61276368 CGTGGTGGGAGGATCATTTGAGG + Intergenic
990966570 5:61454814-61454836 CGAGGTGGGTGGATCATTTCAGG - Intronic
991034128 5:62110461-62110483 GGGGCAGGGAGGAGCATGCCTGG + Intergenic
991713535 5:69431018-69431040 GGAGGTGGGAGGATCACTTGAGG - Intronic
992299603 5:75364607-75364629 GGGGTTGGGAGGATGATTTTGGG + Intergenic
992952737 5:81876683-81876705 CGAGGTGGGTGGATCATTTCAGG - Intergenic
993743008 5:91563083-91563105 GGGGATGGGAGTGTCATTTCAGG - Intergenic
993846903 5:92955266-92955288 GGAGTTTGAAGGAGCATTTCAGG + Intergenic
995955908 5:117776098-117776120 CGAGGTGGGAGGATCATTTGAGG + Intergenic
996095724 5:119396758-119396780 GGAGGTGGGAGGATCACTTGAGG + Intronic
996189061 5:120516189-120516211 GGAGGTGGGAGGATCACTTGAGG + Intronic
996609019 5:125357646-125357668 GGGGATGGGAGGTGCTTCTCAGG + Intergenic
996694399 5:126377703-126377725 GAGGGTGGTAGGAGTATTCCTGG - Intronic
996850321 5:127944085-127944107 GGGGATGGGAGGAGTATTATTGG + Intergenic
997391975 5:133524661-133524683 CGGGGTGGGGGGTGCATTTCTGG - Intronic
997568603 5:134908152-134908174 TGAGGTGGGAGGATCATTTTAGG - Intronic
997749476 5:136330556-136330578 AGGTGTGGGAGGAGCATTCAAGG + Intronic
998957704 5:147454042-147454064 GGGGGCGCGAGGGGCTTTTCGGG + Intronic
999128360 5:149263812-149263834 TGAGGTGGGAGGATCATTTGAGG - Intergenic
999201155 5:149817129-149817151 AGAGGTGGGAAGAGCATTGCAGG - Intronic
999266270 5:150268996-150269018 GGAGGTGGGAGGATCACTTGAGG - Intronic
999777828 5:154824854-154824876 GGAGGTGGGAGGATCACTTGAGG + Intronic
999872851 5:155770374-155770396 GTGGGTGGGAAGAACATTCCAGG + Intergenic
1000074590 5:157773049-157773071 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1000230070 5:159307600-159307622 TGGGGCAGGAGGCGCATTTCAGG - Intergenic
1000350077 5:160346133-160346155 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1000656383 5:163884169-163884191 GGGGCTGGGAGGATGGTTTCGGG + Intergenic
1001415073 5:171539989-171540011 GGGGGTGGGCGGATCACTTGAGG - Intergenic
1002014732 5:176311473-176311495 TGAGGTGGGAGGATCATTTGAGG - Intronic
1002062408 5:176633540-176633562 TGAGGTGGGAGGATCATTTGAGG - Intronic
1002429585 5:179195229-179195251 GGGTGTGGGAGGAGCATGCTGGG - Intronic
1002476597 5:179469827-179469849 GGGGGTGGGAGGGACCTTTGGGG - Intergenic
1003517236 6:6827332-6827354 TGCGGTGGGAGGAGCATCACAGG - Intergenic
1004232731 6:13847704-13847726 GTGGGTGGGAGGAGTGTCTCAGG - Intergenic
1004506656 6:16252468-16252490 CGAGGTGGGTGGATCATTTCAGG - Intronic
1004607738 6:17209600-17209622 GGAGGTGGGAGGATCACTTGAGG - Intergenic
1005281495 6:24279269-24279291 AGAGGTGGGAGGATCATTTGAGG + Intronic
1005401206 6:25436444-25436466 GGAGGTGGGAGGGGGATTTTGGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005562538 6:27055399-27055421 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1005682837 6:28224269-28224291 GGAGGTGGGAGGATCACTTGAGG + Intergenic
1006018837 6:31104604-31104626 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1006115775 6:31775523-31775545 AGGGGTGGGAGGGGACTTTCGGG - Intronic
1006422204 6:33942077-33942099 GTGGGTGGGAGGAGCTTTAGTGG + Intergenic
1006471537 6:34232112-34232134 GGGTGTGGGTGGAGCATCCCAGG - Intergenic
1006670577 6:35727718-35727740 GGGGGCGGGAGGAGGATAGCTGG - Intronic
1006715897 6:36120369-36120391 GGGGGTGGGAGGAGGAGTGAAGG - Intergenic
1006922138 6:37634045-37634067 AGGGGTGGAAGGAGCATTCCAGG + Exonic
1007088880 6:39169576-39169598 GGGGGTGGGAGGCGGGTGTCCGG + Intergenic
1007137003 6:39531959-39531981 TGTGGTGGAAGGAGCATTTTAGG - Intronic
1007161218 6:39792998-39793020 GGCGGGGGAAGGAGCATCTCAGG + Exonic
1007197303 6:40073859-40073881 GGGAGTGGGACTGGCATTTCTGG - Intergenic
1007766554 6:44163933-44163955 TGAGGTGGGAGGATCACTTCAGG - Intronic
1007830461 6:44634463-44634485 GGGGTTGTGATGAGCAATTCAGG + Intergenic
1008251933 6:49250926-49250948 TGAGGTGGGAGGATCACTTCAGG + Intergenic
1008932262 6:56953952-56953974 GGGGGAGGGAGGAGGAGTCCTGG + Intronic
1009556054 6:65168594-65168616 GAGGGTGGGTGGAGCCTTTAAGG - Intronic
1009960089 6:70509199-70509221 GGAGGTGGGAGGATCACTTGAGG + Intronic
1010169311 6:72956636-72956658 GGAGGTGGGAGGATAGTTTCAGG - Intronic
1010422801 6:75693165-75693187 CAGGGTGGGAGGATCATTTGAGG + Intronic
1010573155 6:77502706-77502728 CGAGGTGGGTGGATCATTTCAGG - Intergenic
1011047211 6:83098115-83098137 TGAGGTGGGAGGATCATTTGAGG - Intronic
1011271747 6:85587110-85587132 GGAGGTGGGAGGATCACTTGAGG - Intronic
1011506125 6:88046011-88046033 GTGGGTCAGAGGAGCATATCAGG + Intergenic
1011697429 6:89924849-89924871 GGGGGTGGGGGGATGTTTTCGGG + Intergenic
1011729698 6:90248629-90248651 GGAGGTGGGGTGGGCATTTCAGG + Intronic
1012335324 6:98048101-98048123 GGGGGTGGGGGAAGCCTTTGTGG + Intergenic
1012869820 6:104659475-104659497 GGGGATGGGAGGTGGTTTTCAGG - Intergenic
1013491940 6:110656012-110656034 GTGGGTGGGGAGAGCATTCCAGG - Intronic
1013594693 6:111649905-111649927 GGGGGTGGGGGGAGGGTTTCGGG + Intergenic
1014436511 6:121426604-121426626 TGTGGTGGGAGGATCATTTGAGG - Intergenic
1014512054 6:122334999-122335021 GGAAGTGGGAGGACCACTTCAGG + Intergenic
1015221751 6:130812442-130812464 GTGGGTGGTAGGAGTATTTCTGG + Intergenic
1015224134 6:130836988-130837010 GAGGGTTGTGGGAGCATTTCTGG - Exonic
1015812328 6:137173137-137173159 GGAGGTGGGTGGATCATTTGAGG + Intronic
1015819030 6:137240611-137240633 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1016349909 6:143155801-143155823 GGGACTGGGAAGAGCATTTGGGG + Intronic
1016806548 6:148217777-148217799 GGAGGTGGGAGGATCCTTTGAGG + Intergenic
1016922909 6:149313845-149313867 GGAGGTGTGGGGAGCAGTTCTGG + Intronic
1017205394 6:151799815-151799837 AGGGATGGGAGGAAGATTTCAGG + Intronic
1017359418 6:153548948-153548970 GGGGTTGGGAGTATAATTTCAGG + Intergenic
1017467359 6:154706940-154706962 TGAGGTGGGAGGATCACTTCAGG - Intergenic
1017746125 6:157448109-157448131 TGGGGTGGGAGGATCACTTGAGG - Intronic
1017916211 6:158833777-158833799 TGGGGTGGGAGGATCACTTGAGG - Intergenic
1018410145 6:163536974-163536996 TGTGGTGGGAGGATCATTTGAGG + Intronic
1018537681 6:164838765-164838787 GGAGGTGGGAGGATCACTTAAGG - Intergenic
1018581630 6:165312982-165313004 GGGGGTGGGATGAGAATTCTTGG + Intergenic
1019994854 7:4717425-4717447 GGTGGTGGGAGGTGCATGACTGG + Intronic
1020159059 7:5754392-5754414 CGAGGTGGGAGGAGCACTTGAGG - Intronic
1020850937 7:13351657-13351679 TGGGGTGGGAGGATCATTTGAGG + Intergenic
1021124892 7:16840275-16840297 GGAGGTGGGAGGATCTTTTGAGG + Intergenic
1021278205 7:18682748-18682770 GGAGGTGGGTGGATCATTTGAGG + Intronic
1021959418 7:25857610-25857632 GGCGTTGGGAGGAGCCTCTCAGG + Intergenic
1022648439 7:32253079-32253101 TGGGGTGGGAGGGGCAATTGGGG + Intronic
1022973760 7:35538874-35538896 AGAGGAGGGAAGAGCATTTCAGG - Intergenic
1023062165 7:36338523-36338545 GGAGGTGGGAGGATCATTTGAGG - Intronic
1023757318 7:43431836-43431858 AGGGGTGGGAGGAACATTCCAGG - Intronic
1023938611 7:44756336-44756358 GGGGTTGGGGGTGGCATTTCTGG + Intronic
1024367486 7:48537638-48537660 AGTGGTGGGATGAGCAGTTCTGG + Intronic
1024934098 7:54695230-54695252 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1025060599 7:55803168-55803190 GGAGGTGGGCGGATCATTTGAGG - Intronic
1025098604 7:56116634-56116656 GGAGGTGGGAGGATCCCTTCAGG + Intergenic
1025101675 7:56140720-56140742 GGAGGTGGGGGGATCATTTGAGG - Intergenic
1025267202 7:57473284-57473306 TGAGGTGGGAGGATCATTTGAGG + Exonic
1025800327 7:64780751-64780773 GGAGGTGGGAGGATCACTTCAGG - Intergenic
1025936994 7:66045360-66045382 GGAGGTGGGAGGATCACTTGAGG - Intergenic
1025947131 7:66113306-66113328 GGAGGTGGGAGGATCACTTGAGG + Intronic
1025999702 7:66551388-66551410 TGGGGTGGGAGGATCACTTGAGG - Intergenic
1026024873 7:66736440-66736462 GGGAGTGGTAAGAGCATTTTGGG + Intronic
1026321092 7:69268156-69268178 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1026327262 7:69321450-69321472 CGAGGTGGGAGGATCATTTGAGG - Intergenic
1026523462 7:71135318-71135340 GGGGATGGGTGGAGCCTCTCTGG - Intronic
1026665994 7:72340303-72340325 GGGGGTGGGAGGATTACTTGAGG - Intronic
1026845719 7:73698061-73698083 TGAGGTGGGAGGATCATTTGAGG + Exonic
1027047830 7:75002853-75002875 GGAGGTGGGAGGATCACTTGAGG + Intronic
1027132434 7:75600341-75600363 AGAGGTGGGAGGATCATTTGAGG - Intronic
1027169219 7:75858912-75858934 TGAGGTGGGAGGATCACTTCAGG - Intronic
1027201489 7:76066785-76066807 AGGGGCGGGAGGAGCATGTACGG - Exonic
1027753677 7:82183877-82183899 GGTGGTGGGAGGAGCAGAGCTGG - Intronic
1028850321 7:95530516-95530538 GGAGGTGGGGAGAGCATTCCAGG + Intronic
1029110984 7:98212918-98212940 GGGGCTGGGAGGAGCAGGCCAGG - Exonic
1029119444 7:98257118-98257140 GGAGGTGGGAGGATCACTTCAGG + Intronic
1029373702 7:100165596-100165618 TGAGGTGGGAGGATCATTTGAGG + Intronic
1029385169 7:100238793-100238815 GGAGGTGGGAGGATCACTTGAGG - Intronic
1029535477 7:101154946-101154968 GGGTGTGGGAGGGGAGTTTCCGG + Intronic
1029592092 7:101514101-101514123 CGGGGTGGGTGGATCATTTGAGG + Intronic
1029621891 7:101695351-101695373 GGGGGTGGGAGGATCGCTTGAGG - Intergenic
1029652886 7:101905918-101905940 TGAGGTGGGAGGATCACTTCAGG - Intronic
1029655960 7:101924661-101924683 TGAGGTGGGAGGATCATTTGAGG - Intronic
1029725857 7:102403930-102403952 TGAGGTGGGAGGATCCTTTCAGG + Intronic
1029859926 7:103559670-103559692 TGAGGTGGGAGGATCATTTGAGG - Intronic
1030060822 7:105619646-105619668 TGGGGTGGGAGGATCGCTTCAGG - Intronic
1031980693 7:128122495-128122517 GGGGGTGGGGGGGGCATTGGGGG - Intergenic
1032436557 7:131905694-131905716 GGGGGTGGGGTTTGCATTTCAGG + Intergenic
1032592041 7:133200507-133200529 GGGGGTGGGAGGAGTAGGTGTGG - Intergenic
1032602207 7:133309705-133309727 CGAGGTGGGAGGATCATTTGAGG + Intronic
1032651470 7:133883407-133883429 TGGGGTGGGAGGATCATTTGAGG + Intronic
1032860051 7:135868176-135868198 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1033237904 7:139652908-139652930 CGGGGTGGGTGGATCATTTGAGG + Intronic
1033402858 7:141043367-141043389 CGAGGTGGGAGGATCATTTGAGG + Intergenic
1033975481 7:147095266-147095288 CGAGGTGGGAGGATCATTTCAGG - Intronic
1034145951 7:148871805-148871827 TGGGGTGGGAGGATCAGTTGAGG - Intronic
1034244465 7:149634161-149634183 TGGGGTCGTAGGACCATTTCAGG + Intergenic
1035860090 8:3019148-3019170 TGGGGTGGGAGGATCACTTGAGG - Intronic
1036143503 8:6229674-6229696 GTGGGTGATAGGAGCATTCCTGG - Intergenic
1036700354 8:11009093-11009115 GGGGGTGGGAGGTCCTGTTCTGG + Intronic
1037014692 8:13887414-13887436 CGAGGTGGGAGGATCACTTCAGG - Intergenic
1037866995 8:22452270-22452292 GGAGGTGGGAGGAACACTTGAGG - Intronic
1038029673 8:23626789-23626811 GGGGGTGGGAGGAGCTTAACTGG + Intergenic
1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG + Intronic
1038517360 8:28198821-28198843 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1038883047 8:31635903-31635925 AGGGGTGGGAAAACCATTTCAGG + Intergenic
1038913568 8:31994418-31994440 CGAGGTGGGAGGATCACTTCAGG + Intronic
1039669722 8:39582295-39582317 GGGGGTGGGAGGATACTTTATGG + Intergenic
1039805207 8:40991944-40991966 GGGAGAGAGGGGAGCATTTCTGG + Intergenic
1040090185 8:43390668-43390690 TGGGGTGGGTGGATCATTTGAGG - Intergenic
1040541721 8:48363340-48363362 TGAGGTGGGAGGATCACTTCAGG + Intergenic
1040553048 8:48453444-48453466 GGGGGTGGGGGGTGCAGCTCTGG + Intergenic
1040672804 8:49712878-49712900 GGGAGGGGGAGGAGAATCTCAGG + Intergenic
1041996677 8:64070028-64070050 TGAGGTGGGAGGACCCTTTCAGG - Intergenic
1042018386 8:64342802-64342824 GAAGGTGGGAGGATCATTTGAGG + Intergenic
1042139558 8:65664046-65664068 TGAGGTGGGAGGATCACTTCAGG - Intronic
1042288883 8:67146353-67146375 TGAGGTGGGAGGATCATTTGAGG - Intronic
1042609988 8:70587982-70588004 CGAGGTGGGAGGATCATTTGAGG + Intronic
1043287721 8:78555284-78555306 GGAGGAGGGAAGAGAATTTCAGG - Intronic
1043916289 8:85926429-85926451 GGAGGTGGGAGGATCCTTTGAGG - Intergenic
1044110267 8:88264431-88264453 TGAGGTGGGAGGAGAACTTCAGG - Intronic
1044340404 8:91040675-91040697 GGCGGTGGGAGTGACATTTCCGG + Exonic
1044676857 8:94737926-94737948 TGAGGTGGGAGGATCATTTGAGG + Intronic
1045135212 8:99209637-99209659 TGAGGTGGGAGGATCATTTGAGG - Intronic
1045566264 8:103319195-103319217 AGAGGAGGGAAGAGCATTTCGGG + Intronic
1046611651 8:116432483-116432505 GGGGATGGGAGGTGGGTTTCTGG - Intergenic
1047413777 8:124646941-124646963 TGAGGTGGGAGGACCATTTGAGG - Intronic
1047570302 8:126090772-126090794 GGGGGTTGGAGAAGCATGGCTGG - Intergenic
1047736762 8:127772354-127772376 TGAGGTGGGAAGAGCATTCCAGG + Intergenic
1048198681 8:132353328-132353350 GGGGAAGGGAGGGGAATTTCAGG + Intronic
1048244703 8:132781081-132781103 TGAGGTGGGAGGATCATTTGAGG - Intronic
1049361761 8:142215438-142215460 GGGGATGGGAGGGGCAGTTCTGG - Intronic
1049424459 8:142531932-142531954 AGGGGTGGGAGCAGCATTGGTGG + Intronic
1050195148 9:3074972-3074994 GGGGCTGAGAGGATCATTTGAGG + Intergenic
1050365145 9:4867229-4867251 TGAGGTGGGAGGATCACTTCAGG + Intronic
1050397421 9:5214318-5214340 AGAGGTGGGTGGATCATTTCAGG - Intergenic
1051020897 9:12541347-12541369 GGGAGAGGGAGGAGCGTTTAAGG + Intergenic
1052274135 9:26658821-26658843 GGAGTTGGGAGGGGCATGTCAGG + Intergenic
1052597755 9:30582315-30582337 GAGGGTGGGTGGAGGGTTTCAGG + Intergenic
1052820887 9:33137263-33137285 GAGAGTGGGAAGGGCATTTCTGG - Intronic
1053085334 9:35215171-35215193 TGGGGTGGGAGGATCACTTGAGG + Intronic
1053207414 9:36198442-36198464 TGGGGTGGGTGGATCATTTGAGG + Intronic
1053340355 9:37321359-37321381 TGAGGTGGGAGGATCACTTCAGG - Intronic
1054872111 9:70057098-70057120 GGGGGTGGGAAGATGCTTTCAGG - Intronic
1054992058 9:71339762-71339784 GGGGGTAGCAGGAGAATTTTGGG + Intronic
1055318164 9:75054912-75054934 GGTGGTGGGAGGATCACTTGAGG - Intergenic
1056206291 9:84322610-84322632 TGAGGTGGGAGGATCATTTGAGG + Intronic
1056955692 9:91079302-91079324 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1057435724 9:95038852-95038874 GGAGGTGATAGGAGCAGTTCTGG + Intronic
1057469110 9:95341960-95341982 TGGGGTGGGAGGATCACTTGAGG + Intergenic
1057622388 9:96647758-96647780 GGAGGTGGGAGGATCACTTGAGG - Intronic
1057671821 9:97097455-97097477 GGAGGTGGGAGGATCACTTGAGG - Intergenic
1057693867 9:97310074-97310096 GAGGCTGGGAGCAGCCTTTCAGG + Intronic
1057775852 9:98008873-98008895 GGGGGTGGGGGGATGGTTTCAGG - Intronic
1057973457 9:99579288-99579310 AGGGATGGGAAGAGCATTGCAGG + Intergenic
1058936897 9:109778168-109778190 GGGAGTAGAAGGACCATTTCTGG + Intronic
1058999290 9:110331649-110331671 GGGGGTGGGGGGATGGTTTCAGG + Intronic
1059227770 9:112688586-112688608 TGAGGTGGGAGGATCATTTGAGG + Intronic
1059246095 9:112850798-112850820 GGGGGTGGGAGGCCCCTTTGTGG + Intronic
1059251118 9:112889121-112889143 GGAGGTGGGAGGATCACTTGAGG - Intronic
1059260264 9:112969454-112969476 TGGGGTAGGGGGAGCATTTTTGG + Intergenic
1059448044 9:114351247-114351269 GTGGGTGGGAGGAGGGGTTCTGG - Intronic
1059528474 9:115014972-115014994 TGGGGTGGGCGGATCATTTGAGG - Intergenic
1060261690 9:122080593-122080615 TGGGGTGGGAGGATCACTTGAGG + Intronic
1060348038 9:122833862-122833884 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1060403099 9:123359680-123359702 TGAGGTGGGAGGATCACTTCAGG - Intronic
1060490777 9:124082650-124082672 TGGGGTGGGAGGAGCCCTTGAGG + Intergenic
1060563081 9:124563841-124563863 TGGGGTGGGAGAATCATTTGAGG + Intronic
1060575806 9:124692616-124692638 GGGGATTGCAGGACCATTTCTGG - Intronic
1060616453 9:125019565-125019587 CGAGGTGGGAGGATCATTTGAGG + Intronic
1060740130 9:126092405-126092427 GGGGGTGGAGGGAGCATGCCAGG + Intergenic
1060872593 9:127054744-127054766 GGGGGTGGGAGGATCGCTTAAGG + Intronic
1060915519 9:127387266-127387288 GGGTGTCTGAGGAGAATTTCGGG - Exonic
1061320025 9:129823123-129823145 TGGGGTGGGAGGAGCAGCACAGG - Intronic
1061454133 9:130684816-130684838 GGGTTTGTGAGGAGGATTTCTGG - Intergenic
1061721340 9:132553367-132553389 TGAGGTGGGAGGATCATTTGAGG + Intronic
1061750255 9:132772151-132772173 GGTGGTGGCAGGAGCATTCTGGG - Intronic
1061807962 9:133147091-133147113 GGGGGTGGGAGGGGCAGCCCAGG - Intronic
1061864404 9:133485019-133485041 GGGGCTGGGTGGAGCATCCCTGG + Intergenic
1061970743 9:134043901-134043923 GGAGGTGGGAGGATCACTTGAGG - Intronic
1062243481 9:135551822-135551844 GGAGGTGGGTGGAGTATCTCTGG + Intergenic
1062311652 9:135941171-135941193 CGGGGTGGGAGGATCACTTGAGG + Intronic
1062640559 9:137516033-137516055 GGGGTGGGGAGGGGGATTTCGGG - Intronic
1185555396 X:1017090-1017112 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1185560411 X:1056466-1056488 GGGGGTGGGGGGATCACTTGAGG - Intergenic
1186062899 X:5730057-5730079 GGGGCAGGGAGGAGCATGTCTGG - Intergenic
1186323376 X:8453218-8453240 GGGGGAGGGGGGAGAATTGCAGG + Intergenic
1187298510 X:18026156-18026178 AGGGGTGGGAGGAGGCTTTAGGG - Intergenic
1187690499 X:21861604-21861626 TGAGGTGGGAGGATCACTTCAGG + Intronic
1187735196 X:22296004-22296026 GGGAGAGGGAAGAGCATTTACGG - Intergenic
1188575934 X:31650185-31650207 GGGGGTGGGAGGATCACTAGAGG - Intronic
1188918804 X:35946103-35946125 GGAGGTGGGAGGATCACTTGAGG - Intronic
1189278595 X:39805105-39805127 GGCAGAGGGAGGAGCATTCCAGG + Intergenic
1189363226 X:40369227-40369249 TGAGGTGGGAGGATCATTTGAGG - Intergenic
1189790441 X:44598653-44598675 GGAGGTGGGTGGATCACTTCAGG + Intergenic
1189916346 X:45859405-45859427 GGGGTTGGGAGCTGCAGTTCAGG - Intergenic
1190870371 X:54420055-54420077 AAGGGTGGGAGGAGCATTCGAGG + Intergenic
1191105411 X:56769176-56769198 AGTGGTGGGAGGAGCATGCCGGG + Intergenic
1191106404 X:56774578-56774600 AGTGGTGGGAGGAGCATGCCGGG + Intergenic
1191107397 X:56779980-56780002 AGTGGTGGGAGGAGCATGCCGGG + Intergenic
1191108066 X:56784416-56784438 AGGGGTGGGAGGGGTATTCCAGG + Intergenic
1191145169 X:57157753-57157775 GGGGGTAGGAGGATAATTGCTGG + Intergenic
1191201683 X:57789661-57789683 GGGGGTGGGAGGAGAAGGTATGG + Intergenic
1192317850 X:70066264-70066286 GGGGGTGGGGGGAGCAGGTTAGG + Intergenic
1193118036 X:77794524-77794546 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1193129888 X:77908583-77908605 TGAGGTGGGAGGATCATTTGAGG + Intergenic
1193903706 X:87216952-87216974 GGGAGAGGGAGGAGCAATGCAGG - Intergenic
1194809247 X:98370780-98370802 TGAGGTGGGAGGATCACTTCAGG + Intergenic
1194820909 X:98505845-98505867 TGGGGTGGGAGGATCACTTGAGG + Intergenic
1195119104 X:101731952-101731974 TGGGGTGGGAGGATCACTTGAGG + Intergenic
1196556230 X:117087645-117087667 GGGTGTGGGAGGGGAATCTCAGG - Intergenic
1197837308 X:130709404-130709426 GGAGGTGGGTGGATCATTTGAGG + Intronic
1198060802 X:133043808-133043830 TGAGGTGGGAGGATCAGTTCAGG + Intronic
1198540905 X:137638684-137638706 GGGGGTGGGTGGATCACTTGAGG - Intergenic
1198640982 X:138756376-138756398 GGGGGTGGGAGGAGTCTGCCTGG + Intronic
1198667012 X:139035749-139035771 GGAGGGTTGAGGAGCATTTCAGG + Intronic
1198677207 X:139143943-139143965 GGGGGTGGCAGGTGCATATTAGG - Intronic
1200392985 X:155963224-155963246 AGAGGTGGGAGGATCACTTCAGG + Intergenic
1200614884 Y:5368067-5368089 TGAGGTGGGAGGATCATTTAAGG + Intronic
1202379164 Y:24261091-24261113 AGGGGTGGGAGGAGCTGTCCTGG + Intergenic
1202491618 Y:25409030-25409052 AGGGGTGGGAGGAGCTGTCCTGG - Intergenic