ID: 1120024775

View in Genome Browser
Species Human (GRCh38)
Location 14:79570515-79570537
Sequence CACATATTTTCTGACCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120024775_1120024781 10 Left 1120024775 14:79570515-79570537 CCCCTCAGGTCAGAAAATATGTG 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 223
1120024775_1120024782 29 Left 1120024775 14:79570515-79570537 CCCCTCAGGTCAGAAAATATGTG 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120024775 Original CRISPR CACATATTTTCTGACCTGAG GGG (reversed) Intronic