ID: 1120024777 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:79570517-79570539 |
| Sequence | CGCACATATTTTCTGACCTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 108 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 102} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1120024777_1120024782 | 27 | Left | 1120024777 | 14:79570517-79570539 | CCTCAGGTCAGAAAATATGTGCG | 0: 1 1: 0 2: 0 3: 5 4: 102 |
||
| Right | 1120024782 | 14:79570567-79570589 | AAGGCTGTTCAGACCCAGTCAGG | 0: 1 1: 0 2: 1 3: 14 4: 128 |
||||
| 1120024777_1120024781 | 8 | Left | 1120024777 | 14:79570517-79570539 | CCTCAGGTCAGAAAATATGTGCG | 0: 1 1: 0 2: 0 3: 5 4: 102 |
||
| Right | 1120024781 | 14:79570548-79570570 | CCTGAGATGCTGACTGTGCAAGG | 0: 1 1: 0 2: 2 3: 18 4: 223 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1120024777 | Original CRISPR | CGCACATATTTTCTGACCTG AGG (reversed) | Intronic | ||