ID: 1120024777

View in Genome Browser
Species Human (GRCh38)
Location 14:79570517-79570539
Sequence CGCACATATTTTCTGACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120024777_1120024781 8 Left 1120024777 14:79570517-79570539 CCTCAGGTCAGAAAATATGTGCG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 223
1120024777_1120024782 27 Left 1120024777 14:79570517-79570539 CCTCAGGTCAGAAAATATGTGCG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120024777 Original CRISPR CGCACATATTTTCTGACCTG AGG (reversed) Intronic