ID: 1120024779

View in Genome Browser
Species Human (GRCh38)
Location 14:79570547-79570569
Sequence CTTGCACAGTCAGCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120024779_1120024782 -3 Left 1120024779 14:79570547-79570569 CCCTGAGATGCTGACTGTGCAAG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024779_1120024783 2 Left 1120024779 14:79570547-79570569 CCCTGAGATGCTGACTGTGCAAG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1120024783 14:79570572-79570594 TGTTCAGACCCAGTCAGGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 95
1120024779_1120024786 23 Left 1120024779 14:79570547-79570569 CCCTGAGATGCTGACTGTGCAAG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1120024786 14:79570593-79570615 GGCCCTGAATCCTTGTGATATGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120024779 Original CRISPR CTTGCACAGTCAGCATCTCA GGG (reversed) Intronic