ID: 1120024781

View in Genome Browser
Species Human (GRCh38)
Location 14:79570548-79570570
Sequence CCTGAGATGCTGACTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120024775_1120024781 10 Left 1120024775 14:79570515-79570537 CCCCTCAGGTCAGAAAATATGTG 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 223
1120024776_1120024781 9 Left 1120024776 14:79570516-79570538 CCCTCAGGTCAGAAAATATGTGC 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 223
1120024777_1120024781 8 Left 1120024777 14:79570517-79570539 CCTCAGGTCAGAAAATATGTGCG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 223
1120024774_1120024781 18 Left 1120024774 14:79570507-79570529 CCTCGTTTCCCCTCAGGTCAGAA 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120024781 Original CRISPR CCTGAGATGCTGACTGTGCA AGG Intronic
900717867 1:4156765-4156787 GCTGAGATGCAGACTGACCAGGG - Intergenic
901414619 1:9108124-9108146 CCTGGGATGCTGACGGCCCAGGG + Intronic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904792535 1:33034588-33034610 CATGAAATGCTGAATGAGCAAGG + Intronic
905482448 1:38270905-38270927 GCTCAGAGGCTGTCTGTGCAGGG - Intergenic
906193446 1:43913935-43913957 CCTGAGTTGCTGCCTCTGCATGG - Intronic
907506584 1:54923489-54923511 CAAGAGATGCTGGCTGGGCAAGG - Intergenic
908679821 1:66648225-66648247 CCTGAGGTGCTGACAGTTGAAGG + Intronic
908984864 1:70005752-70005774 GATGAGATGCTGCCAGTGCAGGG - Intronic
909332582 1:74431745-74431767 TCTGAGCTGCTGACACTGCAAGG + Intronic
914286977 1:146236204-146236226 ACTGAGATCCAGACTGTGCCAGG - Intergenic
914548010 1:148686946-148686968 ACTGAGATCCAGACTGTGCCAGG - Intergenic
915636525 1:157190738-157190760 CCTGAGATAGTCACTGAGCACGG - Intergenic
916673959 1:167050652-167050674 CCTCAGTTGCTTACTGGGCATGG - Intergenic
918186255 1:182130110-182130132 CCTGAGACACTGTCTGTGGAAGG + Intergenic
918494591 1:185120090-185120112 CTTCAGATGCTGACTGGACATGG + Exonic
919723633 1:200866909-200866931 CCTTAGATGTTGAGGGTGCAGGG + Intergenic
920569570 1:207006303-207006325 CCTGAGCTGTTGCCTGTGCTGGG + Intergenic
922982337 1:229838136-229838158 ACTGAGATGATGGCTTTGCATGG + Intergenic
923552915 1:234978517-234978539 CCTGAGATGCTGCCTGTAGGGGG - Intergenic
924515158 1:244759922-244759944 CCTGAGATGCAGGCTGGGCGCGG + Intergenic
1063742726 10:8841390-8841412 CCAGTGATGTTGACTATGCAGGG + Intergenic
1064074774 10:12259958-12259980 CCTGAGAATCTGACTGTGTTTGG + Intergenic
1067089205 10:43258061-43258083 CCTGAGATCCTGAATGGGGAAGG - Intronic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1070144946 10:73767049-73767071 CCTAGGCTGCTGAGTGTGCAGGG + Exonic
1070260372 10:74849055-74849077 CCTGGGATGCTGAGGTTGCAGGG - Intronic
1070689032 10:78511160-78511182 ACTTAGAGGCTGACTGTGCCTGG - Intergenic
1072620146 10:97074362-97074384 CCAGACAGGCTGGCTGTGCATGG + Intronic
1072688545 10:97554053-97554075 CCTGAGGTGATGACTTTGAAAGG + Intronic
1073454206 10:103626840-103626862 TCAGAGAGGCTGACTGTGTAGGG + Intronic
1074066162 10:110016055-110016077 CCTGAAATGCTGACTGGTCAAGG - Intronic
1075096589 10:119475377-119475399 GGTGAGATGTTGCCTGTGCAGGG - Intergenic
1075587844 10:123670218-123670240 CCTGAGTGGCTGACTCTGGAGGG + Intronic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1080165402 11:29230618-29230640 CCTGAAATGCTGCCAGTGCTTGG + Intergenic
1083879527 11:65541125-65541147 CCTGAGCTGTAGACTGGGCAGGG + Exonic
1084118182 11:67053990-67054012 CCCCAGGTGATGACTGTGCAGGG + Intergenic
1085459008 11:76681869-76681891 GCTGACATGCTGCCTGTGCCTGG + Intergenic
1087056846 11:93945167-93945189 ACTGAGATCCAGACTGTGCCAGG + Intergenic
1091319217 11:134637988-134638010 CCTGAGGTGCTGACAGGGCAGGG - Intergenic
1091326090 11:134689242-134689264 CCTGTGAAGCAGACTGAGCAGGG + Intergenic
1093764586 12:22948368-22948390 CCTTAGATGAGGACTTTGCATGG - Intergenic
1094660235 12:32463078-32463100 CCTCAGATGCTGACTGAACTGGG + Intronic
1096182265 12:49557477-49557499 CCGGAGGTGCTGGCTGGGCACGG - Exonic
1096858897 12:54508509-54508531 CATGAGATGCTGCATGGGCATGG + Exonic
1097688231 12:62710804-62710826 GCTGAAATGCTGCCTCTGCAAGG - Intronic
1103179549 12:118898092-118898114 CCTGAGATGCTGTTTGAGAATGG - Intergenic
1103639003 12:122333399-122333421 CCTGAGGTGCTGACATTTCAGGG + Intronic
1103834624 12:123808976-123808998 CCTGAGATGCCGTCTGAGCAAGG - Intronic
1104214545 12:126723353-126723375 CCTGTGATGCACACTGTGCCCGG + Intergenic
1104397320 12:128445545-128445567 CCTGGGAAGCTGCCTGTCCACGG + Intronic
1104877963 12:132049688-132049710 CCAGGAATGCTGTCTGTGCAAGG - Intronic
1104943224 12:132404498-132404520 CCTGAGGGGCTGTCTCTGCAGGG + Intergenic
1105332554 13:19431799-19431821 CCTGAGATGGTGCCAGTGCTGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105879131 13:24587978-24588000 CCTGAGATGGTGCCAGTGCTGGG + Intergenic
1105920706 13:24961074-24961096 CCTGAGATGGTGCCAGTGCTGGG - Intergenic
1107128792 13:36872815-36872837 CATGAGTGGCTCACTGTGCAGGG + Exonic
1107555680 13:41515441-41515463 CCTGAAGTGCTGGCTGGGCACGG - Intergenic
1107838730 13:44434646-44434668 CCTGCGATGCTGGCTGGGCGGGG + Exonic
1107883636 13:44855735-44855757 CATGAGATTCTGGCTGGGCACGG - Intergenic
1111871564 13:93839381-93839403 CCTGGGATGTTGAATTTGCATGG + Intronic
1114039318 14:18661510-18661532 TATGAGATGATGACTGGGCATGG + Intergenic
1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG + Intergenic
1118463226 14:66006050-66006072 CCTGAGATGCTGCCTTGGCAGGG - Intergenic
1118473446 14:66095292-66095314 CCTGAAATGGTATCTGTGCAGGG + Intergenic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1121272205 14:92645264-92645286 CCTGAAATGCTGACTATACAAGG - Intronic
1122299979 14:100726093-100726115 ACTGAGATGCTGTGTGTGCGGGG + Intronic
1122559663 14:102603398-102603420 CCTGAGAGGCTGAGGATGCAGGG - Intronic
1122605613 14:102945648-102945670 CCCGAGATGGTGAGTGAGCAGGG - Exonic
1202941843 14_KI270725v1_random:156414-156436 ACTTATATGCTGACTGTACACGG + Intergenic
1124070153 15:26384102-26384124 CCAGAGATGCTGATTGAGAATGG + Intergenic
1125115609 15:36087627-36087649 CCTGATGTGATCACTGTGCATGG + Intergenic
1125959091 15:43813798-43813820 CCTGGGATGATGGCTGGGCACGG - Intronic
1127272450 15:57413574-57413596 ACTGAGATGCTGGCCGGGCATGG - Intronic
1129192962 15:73948012-73948034 CCTCAGATGCTGCCTCTGCTCGG - Intronic
1129318223 15:74759071-74759093 CCTGAGATGATGCGTGTCCAGGG - Intergenic
1131394546 15:92076311-92076333 CCTGAGGTTCTGACTGGGAAGGG - Intronic
1132652339 16:1027209-1027231 CTGGAGATGCTGCCTGGGCAGGG + Intergenic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1133289835 16:4712692-4712714 CATGAGAGGCTGACTGTAAAAGG - Intronic
1135898726 16:26434917-26434939 CCAAAGATGGTGACTGAGCAGGG + Intergenic
1137625102 16:49902724-49902746 CCTGAGATGCTGACGTGGGAGGG + Intergenic
1137826171 16:51497667-51497689 CCTGTGATGGTGACTTTGTATGG + Intergenic
1143204580 17:5133062-5133084 TCTGAGAGGCTGACGGTGCCAGG - Intronic
1144875648 17:18395747-18395769 TCTGAGAGGCTGACGGTGCCAGG - Intergenic
1145156578 17:20548674-20548696 TCTGAGAGGCTGACGGTGCCAGG + Intergenic
1145760306 17:27421780-27421802 TCTGAGAGGCTGACGGTGCCAGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146883578 17:36456834-36456856 TCTGAGAGGCTGACGGTGCCAGG + Intergenic
1148069974 17:44903017-44903039 CCTGAGCTCTTGACTGTCCATGG - Exonic
1148688393 17:49513256-49513278 CCTGAGATGGTGACGGGGCAGGG - Exonic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1150550430 17:66204634-66204656 CCAGAAATGCTGTCTGGGCAGGG - Intergenic
1150625799 17:66840362-66840384 CGGGAGATGCTGACTCTGAAAGG - Intronic
1152582618 17:81173269-81173291 CCTGAGCAGCTGTCTGTCCATGG - Intergenic
1152692034 17:81722668-81722690 GCTGAAATGCTGACTCAGCAGGG - Intergenic
1154334355 18:13454024-13454046 CATGAGAAGCTGGGTGTGCACGG - Intronic
1157872426 18:51242736-51242758 CCTGAGTTGGTGACATTGCATGG + Intergenic
1158805650 18:60968861-60968883 ACAGAGATGCTGACTGTGTAGGG - Intergenic
1158990090 18:62859373-62859395 CCTGAGATCCTGGCTGTGGGAGG + Intronic
1162111120 19:8400320-8400342 GCTGGGATGCTGGCTGGGCAGGG - Intronic
1162698426 19:12495550-12495572 CCGGAAATGGTGACTGTGCGGGG + Intronic
1162967060 19:14161041-14161063 CATGTGAAGCTGACTGTGCCTGG + Intronic
1163210579 19:15836918-15836940 CCGGAAATGCTGAGTGTGCGGGG - Intergenic
1166023772 19:40058867-40058889 CATGAGATGCTTACTGCTCAGGG + Intergenic
1167394454 19:49218846-49218868 CCTAAGATGCTGTCTGTTCCAGG + Intergenic
1167502597 19:49856254-49856276 CCTGGGAGGCTGACTGTGCATGG + Intronic
926305947 2:11637317-11637339 GCTGGGATGCTGACTGTGGGTGG + Intronic
928204114 2:29271948-29271970 GCTCAGAGGCTGTCTGTGCAGGG - Intronic
929119879 2:38475933-38475955 CCTCAGATGATGCCAGTGCATGG - Intergenic
929843369 2:45495453-45495475 AGTGAGATGCTTACTGTGGAAGG - Intronic
929963889 2:46519186-46519208 ACTGAGATTCTGAGTGTGCAAGG - Exonic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
933833917 2:86231121-86231143 CCAGAGAAGGGGACTGTGCAGGG - Intronic
934710956 2:96513695-96513717 TCTGTGCTGCTGACTGTGCTAGG - Intergenic
936086617 2:109473798-109473820 GCTAAGGTGCTGGCTGTGCACGG - Intronic
938575318 2:132597923-132597945 CCAGAGATGATCACTATGCATGG - Intronic
940026122 2:149210353-149210375 CCTGAGAGGCTGACTCTTAATGG + Intronic
940306903 2:152236774-152236796 GTTGAGATGCTGATTATGCATGG + Intergenic
942017018 2:171827984-171828006 GCTTAGATGCTGTCTGTGGAGGG - Intronic
943201451 2:184831552-184831574 CCTGAGATTCTGAATTTCCAAGG - Intronic
944312904 2:198254577-198254599 ACTGATATGCTGTCTGTGCCAGG - Intronic
945657952 2:212648593-212648615 ACTAAGATGCTGACCATGCAAGG - Intergenic
946163647 2:217850545-217850567 GCTGGGCTGCTGACTGTACAGGG - Intronic
946317440 2:218926444-218926466 TCTGAAATGTGGACTGTGCATGG + Intergenic
946895437 2:224319111-224319133 ACTGTGATGCTCACAGTGCAAGG - Intergenic
948780634 2:240319597-240319619 CCTTGGATACTAACTGTGCAAGG - Intergenic
1171009123 20:21498383-21498405 GCGGAGAGGCTGCCTGTGCAGGG - Intergenic
1172197653 20:33103090-33103112 CCTGTGAGGCTGGCTGGGCATGG + Intronic
1172477406 20:35249126-35249148 CCTGAGATGGGGAGTGTTCAGGG + Intronic
1172578490 20:36028281-36028303 CCGCAAATGCTGACTGAGCAGGG - Intronic
1173486709 20:43446452-43446474 CCTGAGATGAGCACTGTGCCCGG + Intergenic
1173696170 20:45015516-45015538 CATGTGATGCTGACTGTGAGTGG - Intronic
1174702837 20:52626330-52626352 CCTGAGATGCTTATTCTGGAGGG - Intergenic
1175329402 20:58152860-58152882 CCTTAGATGCTCACTGCCCAGGG + Intronic
1176107806 20:63397800-63397822 CATGGGATGCTGGGTGTGCATGG + Intergenic
1176740467 21:10596738-10596760 CCTGAGATGGTGCCAGTGCTGGG + Intronic
1177839815 21:26223090-26223112 CCTGGGATGTTAAGTGTGCAAGG - Intergenic
1178567767 21:33703908-33703930 CCTGAGGTGCTGCCTCTGCTTGG + Intronic
1180219782 21:46351198-46351220 CCTGAGATTCTGAAAGTGCCTGG + Intronic
1180788051 22:18557904-18557926 CCTGGGCTTGTGACTGTGCAGGG - Intergenic
1181233687 22:21437414-21437436 CCTGGGCTTGTGACTGTGCAGGG + Intronic
1181244963 22:21497429-21497451 CCTGGGCTTGTGACTGTGCAGGG - Intergenic
1181504902 22:23346896-23346918 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181656016 22:24299517-24299539 GCTGAGATGCAGACTGTTCAAGG - Intronic
1181709890 22:24677143-24677165 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181744111 22:24943816-24943838 CCTGAGATTCTGCCTTTGTATGG - Intronic
1181939497 22:26464317-26464339 CCTGAGATGCTGACCCAGCATGG - Exonic
1183582500 22:38734276-38734298 CCTAAGCTGCTGGCTGTTCAAGG + Intronic
1184998276 22:48226436-48226458 CCTGCAATGCTGAGTGGGCATGG - Intergenic
1185162846 22:49239895-49239917 CCTGCGAGGCTGTCTGTGGATGG + Intergenic
1185374776 22:50477350-50477372 CCTGAGATGAGGAGTGGGCAGGG - Intergenic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
956651177 3:71505965-71505987 CCAGAGAGGCAGACTGTGCCTGG - Intronic
958637927 3:96769193-96769215 ACTGAGATGATGGCTGGGCATGG + Intergenic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
959707323 3:109350140-109350162 CCTGAGATTCTGACTTTGCAAGG - Intergenic
960571143 3:119186393-119186415 CCTGAGATGGTGATTGGGTAGGG - Intronic
961412475 3:126732778-126732800 CCTGAGACTCTCACTGGGCATGG + Intronic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
962755956 3:138465533-138465555 CCTGACATAGTGACTGTGCCAGG + Intronic
963836908 3:150067399-150067421 CCTGATATGCTCACAGAGCAGGG - Intergenic
964490110 3:157227258-157227280 CCTGAGCAGCTGAATGTGGAGGG + Intergenic
964661299 3:159123432-159123454 TCTTAGAAGCTGACTGGGCAGGG - Intronic
964768818 3:160203514-160203536 CGGGAGATGCTGGCTGGGCACGG + Intergenic
968258430 3:197298985-197299007 CCTGCGATGCTGACCGGGCGGGG - Intronic
968902835 4:3439354-3439376 CCTACCATGCTGTCTGTGCAGGG + Intronic
969391387 4:6893544-6893566 ACTGGGCTGCTGACTGGGCATGG + Intergenic
975883297 4:78937179-78937201 CATGGAATGCTGACTGTACATGG + Intronic
976519545 4:86010056-86010078 ACCTAGATGCTGACTGAGCATGG - Intergenic
976656542 4:87494538-87494560 CCTGTTCTGCTGACTGTTCATGG + Exonic
978450165 4:108823790-108823812 AGTGAGATGCTGCCTTTGCAGGG + Intronic
980205329 4:129712171-129712193 CCTGATATGCTAACTTTCCAGGG + Intergenic
984185554 4:176538750-176538772 CCTCAGGTGATGACTGAGCAAGG - Intergenic
986072616 5:4300918-4300940 CCTGTGAGGCTGACACTGCAGGG - Intergenic
986299201 5:6465275-6465297 ACTAAAATGCTGACTGTGCGTGG - Intronic
986384199 5:7215927-7215949 GCTGAGATGATGGTTGTGCATGG - Intergenic
986418352 5:7550784-7550806 GCTGAGATGCTGAGTGTGAGTGG - Intronic
988088554 5:26504202-26504224 CATGTGATTCTGACTGTGCAGGG + Intergenic
989395319 5:40949600-40949622 CCTAAGAAGCTGACTGTAAATGG + Intronic
990137177 5:52660271-52660293 CCTGTAATGCTGACAGTGCTTGG + Intergenic
991099781 5:62780026-62780048 CATGAGATGCTGGCTGGGCGCGG + Intergenic
992171651 5:74107821-74107843 GCTGAGATGGTGAGTGGGCAAGG + Intergenic
992499939 5:77332035-77332057 CCTGAGATGCTGGGTGAGCTTGG - Intronic
993071325 5:83167378-83167400 CATGAGATTCTGACAGTACAAGG + Intronic
995837891 5:116416274-116416296 CCTGAGAGTCTGACTGTGACTGG + Intergenic
996638967 5:125730017-125730039 CCTGAGAGCCACACTGTGCAAGG + Intergenic
997559478 5:134833634-134833656 CCTGATATGTTGACTGTTAACGG + Intronic
998216742 5:140243231-140243253 CCTGGGAGGCTAACTTTGCAGGG + Intronic
998877866 5:146618694-146618716 CATGAGAGGCTCACTGTCCAAGG + Intronic
1001703006 5:173721088-173721110 CCAGAGGCACTGACTGTGCAGGG + Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1003326301 6:5093924-5093946 CTAGGGATGCTGCCTGTGCAGGG + Intergenic
1003370580 6:5522165-5522187 CCAGAGCTTATGACTGTGCATGG - Intronic
1004766705 6:18737054-18737076 GCTGATAGGCTGAATGTGCAGGG + Intergenic
1005137736 6:22590271-22590293 CCTCATGTGCTTACTGTGCAAGG - Intergenic
1010185650 6:73140544-73140566 CCTGGGATTCTGACTGAGTAGGG + Intronic
1010475037 6:76276394-76276416 CCTGAGAATCTGCCTGGGCATGG + Intergenic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1019134384 6:169899155-169899177 GCGGTGATGCTGTCTGTGCATGG + Intergenic
1019374690 7:683176-683198 TCTGAGATGCTCACTCTCCAGGG + Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1028830576 7:95323112-95323134 CTTGAGATTCTGCCTGTACAGGG + Intronic
1030736514 7:113055056-113055078 CCTGAGATGTTCTCTCTGCAAGG - Intergenic
1032549490 7:132771355-132771377 GCTGAGCTGGTGACTTTGCATGG + Intergenic
1033655124 7:143368110-143368132 CCTGAGGTGCTGTGTGTGCTTGG - Intergenic
1033932176 7:146537700-146537722 CCTGAAATGCTCACTGTCCCAGG - Intronic
1034970056 7:155413210-155413232 CCTGAGATGCGGTCACTGCAGGG + Intergenic
1036382868 8:8249889-8249911 CCTCAGCTGCTGGCTGGGCATGG + Intergenic
1036415954 8:8548861-8548883 CCAGAGAGGCTGCCTGAGCAGGG - Intergenic
1036436328 8:8737325-8737347 CCTGAGATGACCACTGAGCATGG + Intergenic
1036595674 8:10209784-10209806 CCTGGGAGGCCCACTGTGCATGG + Intronic
1037480250 8:19298502-19298524 CATGAGATGCTGACTTGGAAGGG + Intergenic
1037788201 8:21915370-21915392 CCTGAGATGCTGCCGGTGGTGGG + Intergenic
1039804261 8:40985037-40985059 CCCGAGATGGTGGCTGAGCATGG - Intergenic
1040439124 8:47422848-47422870 CCTGAGTAGCTGACTTTGCTGGG + Intronic
1041911001 8:63087893-63087915 CAAGAGGGGCTGACTGTGCAAGG + Intergenic
1045114770 8:98970987-98971009 CCTAAGAAGCTGGCTGGGCATGG + Intergenic
1048453864 8:134559496-134559518 CATGAAATGCTTACTGTGCAGGG - Intronic
1049462938 8:142738514-142738536 CCTGGGGTGGTGGCTGTGCATGG + Intergenic
1050687675 9:8190354-8190376 CCTGGGATTCTGCCTGGGCATGG - Intergenic
1050937325 9:11414400-11414422 CCAGGCATGCTGGCTGTGCAGGG - Intergenic
1055641063 9:78319407-78319429 CCTGAGATGGTGCCTGGGAAAGG - Intronic
1057208542 9:93187092-93187114 CCTCAGGTGCTGCCTCTGCAGGG + Intronic
1059999834 9:119948306-119948328 CCCGTGATGCTGAGTGTACATGG - Intergenic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1061053993 9:128212156-128212178 CCTGAGATCCTGGCTGTGGAAGG - Intronic
1061189323 9:129072356-129072378 CCTAAGATGGTGCCTGAGCAGGG - Intergenic
1062674596 9:137733212-137733234 CCTGAGATCCTGATTCAGCACGG - Intronic
1203688914 Un_GL000214v1:23665-23687 CCTGCCAGGCTGAGTGTGCAGGG + Intergenic
1203611340 Un_KI270749v1:8567-8589 ACTTATATGCTGACTGTACACGG - Intergenic
1203647361 Un_KI270751v1:80388-80410 CCTGCCAGGCTGAGTGTGCAGGG - Intergenic
1186190255 X:7061058-7061080 CCTGAGATGCTGATGGAGCCTGG + Intronic
1188349722 X:29113099-29113121 GTTGACATGCTGACTGGGCACGG - Intronic
1188672151 X:32893472-32893494 TGAGAGATGCTAACTGTGCAAGG - Intronic
1190742738 X:53300737-53300759 CCTTTGATGCTGTGTGTGCAAGG + Intronic
1190931994 X:54956713-54956735 CCTGAGATGAGGACTGTGGGAGG - Intronic
1191914551 X:66187586-66187608 CCTGTGATGCGAACTGTGTATGG + Intronic
1198413095 X:136391339-136391361 GCTGAGATGCTGCCTGTTCTGGG - Intronic
1201714845 Y:17033240-17033262 CCTGAGATGCAGTCTCTTCAAGG + Intergenic