ID: 1120024782

View in Genome Browser
Species Human (GRCh38)
Location 14:79570567-79570589
Sequence AAGGCTGTTCAGACCCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120024779_1120024782 -3 Left 1120024779 14:79570547-79570569 CCCTGAGATGCTGACTGTGCAAG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024780_1120024782 -4 Left 1120024780 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 170
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024776_1120024782 28 Left 1120024776 14:79570516-79570538 CCCTCAGGTCAGAAAATATGTGC 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024775_1120024782 29 Left 1120024775 14:79570515-79570537 CCCCTCAGGTCAGAAAATATGTG 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024777_1120024782 27 Left 1120024777 14:79570517-79570539 CCTCAGGTCAGAAAATATGTGCG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120024782 Original CRISPR AAGGCTGTTCAGACCCAGTC AGG Intronic
900468455 1:2837687-2837709 AAGGGTGTTCAGCCACAGTGGGG - Intergenic
903522134 1:23959214-23959236 AAGGCGGTTCAGACACACGCGGG - Intronic
907563604 1:55413611-55413633 AAGCCTGTACTGACCCAGCCTGG - Intergenic
907599055 1:55748337-55748359 TAGTCTGTTCATACCCACTCTGG - Intergenic
907642283 1:56203096-56203118 AAAGCTGTACAGATACAGTCAGG + Intergenic
908469525 1:64430202-64430224 AAGGCTTTTCAGAGTCAGACTGG - Intergenic
916247696 1:162705261-162705283 GGGGCTGTTAAGACGCAGTCAGG - Intronic
918799347 1:188953097-188953119 AAGGCTGTTCTGACCCTGAAGGG + Intergenic
922355113 1:224767975-224767997 AGGGCATTTCAGACCCAGTGGGG + Intergenic
923798112 1:237179824-237179846 AAGGTTCTTCAGACTCAGCCCGG - Intronic
924265982 1:242282732-242282754 AAGCCTGTTCAGAAACAGTCAGG - Intronic
924608000 1:245551739-245551761 AAGGCTGTGCAGATCCACCCTGG - Intronic
924766058 1:247032525-247032547 ATGGGGGTTCAGACCCAGCCCGG + Intergenic
1063312438 10:4966948-4966970 AAGGCTGGTCGGACCAACTCTGG - Exonic
1063315495 10:5000623-5000645 AAGGCTGGTCGGACCAACTCTGG + Exonic
1063325510 10:5097455-5097477 AAGGCTGGTCGGACCAACTCTGG - Exonic
1066307339 10:34158528-34158550 GAAGCTGTACTGACCCAGTCAGG - Intronic
1066718852 10:38315805-38315827 AAGCCTGTTCAGAAACAGTCAGG + Intergenic
1069782851 10:70967781-70967803 AAGGCTGTTCACCCCCTGCCTGG + Intergenic
1074457924 10:113611682-113611704 GAGGCTGCTCAGAACCTGTCAGG - Intronic
1075044911 10:119139241-119139263 AAGGCTTTTCAGGCCCGGTGCGG + Intergenic
1077214042 11:1387870-1387892 TAGGCTGCTCAGACACAGACAGG + Intergenic
1077266497 11:1653321-1653343 AAGACTGTTCAGACCAGGCCAGG - Intergenic
1080161295 11:29179807-29179829 AAGCCTGGTGAGACCCAGGCTGG + Intergenic
1081937385 11:46914610-46914632 ATGGCAGTCCAGACACAGTCTGG + Intronic
1082162657 11:48901253-48901275 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1082175051 11:49049251-49049273 GAAGCTGTTCTGGCCCAGTCAGG - Intergenic
1082238768 11:49851481-49851503 GAGGCTGTTCTGGCCCAGTCAGG + Intergenic
1082243376 11:49892846-49892868 GAGGCTGTTCTGGCCGAGTCAGG - Intergenic
1082657874 11:55873672-55873694 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1082909415 11:58353690-58353712 AAAGGTGTTGAGACCAAGTCAGG + Intergenic
1084681658 11:70669993-70670015 ATGTCTGATCAGACCCAGGCGGG + Intronic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1086697804 11:89864670-89864692 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1086708358 11:89979818-89979840 GAGGCTGTTCTGGCCCAGTCAGG + Intergenic
1086715082 11:90052824-90052846 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1087326540 11:96730189-96730211 ACGTCTGTTCACACCCAGTGGGG + Intergenic
1088524638 11:110739476-110739498 AAGGCTGTTTACACACAGTTTGG + Intergenic
1089322092 11:117633303-117633325 AAGGGTGGCCAGACCCAGGCTGG - Intronic
1089895580 11:121927259-121927281 AAGGCTGGAAAGATCCAGTCTGG - Intergenic
1094129449 12:27059793-27059815 AACCCTGTTCAGGACCAGTCTGG + Intronic
1102935732 12:116895341-116895363 AAGGCTGTTCAAACACAATCAGG + Intergenic
1104842086 12:131830170-131830192 TTGGCTGATCAGACCCAGTGCGG + Intronic
1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG + Intergenic
1112553416 13:100444411-100444433 AAGGTTGTTCAAAACCAGCCTGG - Intronic
1113661359 13:112108245-112108267 AAGGCTGCCCAGGCCCAGCCAGG - Intergenic
1116087531 14:40259726-40259748 AAGACTGTGCAGACCCACTAGGG + Intergenic
1116186546 14:41606723-41606745 AAATCGGTTCAGAACCAGTCTGG + Intergenic
1118767598 14:68920634-68920656 AAGGGTGTGCAGACACAGGCTGG - Intronic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1122049062 14:99042850-99042872 AAGGCTGAACAGACCTGGTCTGG - Intergenic
1122685108 14:103500433-103500455 AAGGCTGTTAACGCCCAGGCAGG - Intronic
1122795896 14:104206066-104206088 CAGGCTGTGCAGTCGCAGTCGGG - Intergenic
1123991396 15:25686142-25686164 ACAGCTGCTCAGATCCAGTCAGG - Intronic
1135931837 16:26744703-26744725 AAGGTTTTTCAGACCTAGACAGG + Intergenic
1139023399 16:62781632-62781654 AAGGCTGTCAGCACCCAGTCTGG - Intergenic
1139471222 16:67179128-67179150 AAGGCTGGTCAGGCCCTGACCGG - Intronic
1141611191 16:85182089-85182111 AAGGCTGTTCACACCAAGCATGG + Intronic
1142477991 17:201026-201048 AAGTGTGTAAAGACCCAGTCTGG + Intergenic
1152386052 17:79975430-79975452 AAGGCTGCTGAGAGCCAGCCAGG + Intronic
1152526154 17:80889381-80889403 AAGGCTGCTCAGCCCCAGCCAGG + Intronic
1152963560 18:95789-95811 ACCGCTGTGCAGACCCAGGCTGG + Intergenic
1154106894 18:11531348-11531370 AGGGCTGTTCAGAGCCAGCCTGG - Intergenic
1154163002 18:11993857-11993879 AAGGCCCTTCACACCCAGCCAGG - Intronic
1161344198 19:3759871-3759893 GAGGCTCTTCAGGACCAGTCTGG + Exonic
1163584887 19:18158124-18158146 GAAGCTGTTCTGACCCAGGCCGG + Intronic
1165134641 19:33660087-33660109 AAGGCTGGTCAGACACAGCAAGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166868341 19:45854611-45854633 CAGGCTGTTCCTCCCCAGTCAGG + Intronic
925624241 2:5826250-5826272 AAGGCTGGTCTTGCCCAGTCAGG - Intergenic
928719601 2:34103952-34103974 AAGGCGGCACATACCCAGTCAGG - Intergenic
932381400 2:71287133-71287155 GAGGCTGTTAAGACCCAGCTAGG + Intronic
935091303 2:99897491-99897513 AGGCCTGCTCAGACCCACTCGGG + Intronic
938015311 2:127862408-127862430 AAGGCAGTTCAGTTCCAGTTCGG + Exonic
940285724 2:152031544-152031566 AAGGCAGGTCAGACACAGCCAGG + Intronic
943787612 2:191895878-191895900 ATGGCTGTTCAGAGACAGTTAGG - Intergenic
944884175 2:204046097-204046119 AAGCCAGTTCAGGACCAGTCTGG - Intergenic
946307515 2:218864797-218864819 AAGGGTGGTCAGGCCCAGCCTGG - Intronic
946370500 2:219278963-219278985 AAGGCAGTTCTGACCTACTCAGG + Intergenic
1171461755 20:25301968-25301990 AAGGATGTACAGACCCACACGGG - Intronic
1173384535 20:42575349-42575371 AAGGCTGTGAAGAGCCAGCCAGG + Intronic
1174836098 20:53856433-53856455 AAGGCAGTGTAGTCCCAGTCAGG + Intergenic
1175329822 20:58155869-58155891 AAGGCAGGGCAGACCCAGGCAGG + Intronic
1176408333 21:6434024-6434046 AAGCGTGTGCACACCCAGTCAGG - Intergenic
1179092848 21:38283934-38283956 AAGGCTACTCAGGCTCAGTCTGG + Intronic
1179683826 21:43042350-43042372 AAGCATGTGCACACCCAGTCAGG - Intergenic
1180003052 21:45003801-45003823 AAGGCTGGGCAGAGCCAGCCTGG - Intergenic
1180877588 22:19181918-19181940 AAGGCTGTGCAGCCACAGTGTGG + Intronic
1184690509 22:46115234-46115256 CAGTCTGTTCAGACACAGACAGG - Intergenic
950764028 3:15260106-15260128 AAGGCTGTTCAGAGCCTCACAGG + Intronic
951506169 3:23447063-23447085 ATGGCTGATCTGACCTAGTCAGG - Intronic
952077583 3:29715896-29715918 AAGGCTAATCAGACCCATTTAGG - Intronic
952925271 3:38315487-38315509 AAGGCTGTTCAGATGCCTTCTGG + Intronic
952976538 3:38701252-38701274 AATACTGTTAAGGCCCAGTCTGG - Intronic
953355361 3:42251769-42251791 GATGCTGTTGAGACCCTGTCAGG + Intergenic
953420458 3:42749849-42749871 AAGGGTGTTCAGCTCCACTCTGG + Intronic
953721778 3:45362444-45362466 CAGGATGTTCAGACACTGTCTGG + Intergenic
954302188 3:49705909-49705931 AGGCTTCTTCAGACCCAGTCTGG - Intronic
958990561 3:100839417-100839439 TAGGATCTTCAGACCCAGACAGG + Intronic
961634609 3:128325162-128325184 CAGTCTGTGCAGACCCAGCCAGG + Intronic
962492549 3:135908405-135908427 AAGGCTGTTCCCACCCAGTGAGG - Intergenic
969350214 4:6593956-6593978 ATTTGTGTTCAGACCCAGTCAGG + Intronic
969881982 4:10182147-10182169 AAGGCCATTCAGACCCACACTGG - Intergenic
971002620 4:22339601-22339623 AAGGCTGTTGCTTCCCAGTCTGG - Intergenic
975533403 4:75423854-75423876 AAGGCCGTTCAGACTCACTGTGG - Intergenic
976878831 4:89892836-89892858 AAGACTGTTCAAACCTGGTCTGG - Intronic
980131088 4:128816607-128816629 AAGGCTTTCCAGTCCAAGTCTGG - Intronic
986729563 5:10625160-10625182 GAGGCTGTTTAGGCCCAATCAGG + Intronic
992782821 5:80143547-80143569 AAGCTTTTTCAGACCCACTCAGG + Exonic
993875331 5:93299969-93299991 AAGGCTGCCCAGTCCCAGTGGGG - Intergenic
994965075 5:106659236-106659258 CAGACTGTTCAGAGCCAGGCTGG - Intergenic
997372792 5:133372680-133372702 AAGGCTGTTCAGAATGTGTCTGG - Intronic
998615897 5:143740292-143740314 AAGTCTGTCCAAACCCAGCCTGG + Intergenic
1001406716 5:171482048-171482070 AGGGCTGTGCAGCCCCAGCCAGG + Intergenic
1003521012 6:6858460-6858482 AAGGCTATTCATACCAAGTCAGG - Intergenic
1007417329 6:41699395-41699417 TAGGCTGCTCTGCCCCAGTCTGG - Intronic
1011795502 6:90947741-90947763 AAGTCTGTGCACACCCAGCCAGG - Intergenic
1013944628 6:115706782-115706804 TAGGCTGTTCAGACCCCTTAGGG - Intergenic
1018803374 6:167240173-167240195 AAGGCTGTGCACAGCCACTCAGG + Intergenic
1021556774 7:21927798-21927820 TCAGCTGTTCAGCCCCAGTCAGG + Intronic
1022482493 7:30753060-30753082 AAGCTTGGTCACACCCAGTCCGG - Intronic
1025776364 7:64564168-64564190 AAGGATGTTCAAGCCCAGTGTGG - Intergenic
1031987211 7:128170960-128170982 AATGTTGTTCAGACACACTCAGG - Intergenic
1035612318 8:975880-975902 AAAGCTGTACAGACCAAGACGGG + Intergenic
1038530454 8:28314363-28314385 AAGACTGTCCAGAGCCAGGCTGG - Intergenic
1039983719 8:42429980-42430002 CAGGCCGTTCAGACACAGCCGGG + Intronic
1045211911 8:100107585-100107607 CTGGCTGTTCAGACCAAATCTGG - Intronic
1048888022 8:138924309-138924331 CAGGCTGGGCAGACCCAGGCTGG - Intergenic
1049594691 8:143477919-143477941 AAGGCTGCTCAGGGCCAGCCTGG + Intronic
1049646774 8:143739143-143739165 AAGGCAGCTCTGATCCAGTCAGG - Intergenic
1050724441 9:8631450-8631472 AAGGTTGTTCATACCCAGATGGG - Intronic
1051137094 9:13934743-13934765 ACGGCTGTGCAAACCCAGTCTGG + Intergenic
1052267915 9:26595556-26595578 GAGGCTGTTAAAACCCAGCCTGG - Intergenic
1055953929 9:81756522-81756544 AAGGCTCTTCTGAACCAGACAGG + Intergenic
1061512018 9:131067323-131067345 AAGGCTGTCCAGCCTCAGGCAGG + Intronic
1061967907 9:134026258-134026280 ACGGCTGTTCTGACCCACCCTGG - Intergenic
1061978296 9:134084662-134084684 AAGGCTCTTCAGAAACAGTGGGG + Intergenic
1062734536 9:138127937-138127959 ACCGCTGTGCAGACCCAGGCTGG - Intergenic
1203485833 Un_GL000224v1:53652-53674 AAGCCTGGTGAGACACAGTCTGG + Intergenic
1187921114 X:24202852-24202874 CAGTCTTTTAAGACCCAGTCTGG - Intronic
1188447950 X:30276390-30276412 AAGTCTTTCCAGATCCAGTCTGG + Intergenic
1192198284 X:69047051-69047073 AATGCTGATGAGACCCAGTGGGG + Intergenic
1195929943 X:110064391-110064413 AAGGATATTCAGACCAAGGCTGG + Intronic
1196535724 X:116841376-116841398 TAGGCTGTTCAGTGCCAGTAGGG - Intergenic