ID: 1120024782

View in Genome Browser
Species Human (GRCh38)
Location 14:79570567-79570589
Sequence AAGGCTGTTCAGACCCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120024775_1120024782 29 Left 1120024775 14:79570515-79570537 CCCCTCAGGTCAGAAAATATGTG 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024780_1120024782 -4 Left 1120024780 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 170
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024776_1120024782 28 Left 1120024776 14:79570516-79570538 CCCTCAGGTCAGAAAATATGTGC 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024777_1120024782 27 Left 1120024777 14:79570517-79570539 CCTCAGGTCAGAAAATATGTGCG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128
1120024779_1120024782 -3 Left 1120024779 14:79570547-79570569 CCCTGAGATGCTGACTGTGCAAG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120024782 Original CRISPR AAGGCTGTTCAGACCCAGTC AGG Intronic