ID: 1120025973

View in Genome Browser
Species Human (GRCh38)
Location 14:79584655-79584677
Sequence CTGTACCCATAGCAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120025973_1120025978 21 Left 1120025973 14:79584655-79584677 CCCAGCTACTGCTATGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1120025978 14:79584699-79584721 GCTGACCACCTGAAGGTGACTGG 0: 1
1: 0
2: 1
3: 17
4: 171
1120025973_1120025982 30 Left 1120025973 14:79584655-79584677 CCCAGCTACTGCTATGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1120025982 14:79584708-79584730 CTGAAGGTGACTGGCTGGCTTGG 0: 1
1: 0
2: 1
3: 32
4: 251
1120025973_1120025979 25 Left 1120025973 14:79584655-79584677 CCCAGCTACTGCTATGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1120025979 14:79584703-79584725 ACCACCTGAAGGTGACTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 138
1120025973_1120025977 14 Left 1120025973 14:79584655-79584677 CCCAGCTACTGCTATGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1120025977 14:79584692-79584714 GGGCTCAGCTGACCACCTGAAGG 0: 1
1: 1
2: 1
3: 21
4: 185
1120025973_1120025976 -6 Left 1120025973 14:79584655-79584677 CCCAGCTACTGCTATGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1120025976 14:79584672-79584694 GTACAGCTTTAGTGCTCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1120025973_1120025975 -7 Left 1120025973 14:79584655-79584677 CCCAGCTACTGCTATGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1120025975 14:79584671-79584693 GGTACAGCTTTAGTGCTCTGCGG 0: 1
1: 0
2: 2
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120025973 Original CRISPR CTGTACCCATAGCAGTAGCT GGG (reversed) Intronic
904849417 1:33446194-33446216 GGGTACCCATAGCAGAGGCTTGG - Intergenic
908857910 1:68450113-68450135 CTGTTCCCATAACAGTTGTTTGG + Intergenic
917336071 1:173925497-173925519 CAGTAACCACAGCAGAAGCTGGG - Intergenic
921828653 1:219702334-219702356 CTGTACCCAAAGCATTAGAGGGG + Intronic
924701955 1:246463137-246463159 CTGAACCGAGAACAGTAGCTAGG + Intronic
1067434413 10:46266781-46266803 CTGGCCCCAGAGCAGCAGCTGGG - Intergenic
1069270990 10:66527180-66527202 CTTTACCCATAGAATTATCTGGG + Intronic
1079823692 11:25163596-25163618 CTGTGCACATAGCAATTGCTTGG + Intergenic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1082801430 11:57417742-57417764 CCTTACCCATAGCTGTAGTTGGG + Exonic
1084986174 11:72874300-72874322 CTGTAGCCTTCCCAGTAGCTAGG + Intronic
1088507262 11:110539039-110539061 CTGACCCCATAGCAGTGTCTAGG + Intergenic
1089113605 11:116076129-116076151 GTGTACCTATAGGAGTAGATGGG - Intergenic
1098231347 12:68374802-68374824 CTGTCCCCAGAGCTGTAGTTTGG - Intergenic
1099195486 12:79609937-79609959 CTGTCCCCATGGCAGTATCTAGG - Intronic
1099484831 12:83216212-83216234 CTGAACCCACAGCAATAGCTGGG - Intergenic
1106118335 13:26836755-26836777 CTGTACACAAAGCACTAGCATGG + Intergenic
1106314258 13:28579339-28579361 CTTTACCCAGGGAAGTAGCTGGG - Intergenic
1107679144 13:42829882-42829904 CTGTACCCAGACCAGTATATAGG + Intergenic
1108700848 13:52942913-52942935 CTGTACCGAGAGCAGTATCCTGG + Intergenic
1114522326 14:23347294-23347316 CTGTTCCCATGGCTCTAGCTGGG + Intronic
1114924855 14:27383877-27383899 CTGTCCCCACAGCAGTGGCTAGG + Intergenic
1118175320 14:63433883-63433905 CTGAACCCAAAGCAGCAGCAAGG - Intronic
1120025973 14:79584655-79584677 CTGTACCCATAGCAGTAGCTGGG - Intronic
1121274867 14:92660555-92660577 ATGTGTCCATGGCAGTAGCTGGG + Intronic
1124561115 15:30774242-30774264 CAGGACCCATAGGAGTAGCAGGG + Intergenic
1126192908 15:45897667-45897689 CTGTCCCCATAGCATTTTCTAGG + Intergenic
1128798273 15:70480275-70480297 CAGGACCCATAACAGTGGCTGGG - Intergenic
1133762168 16:8807818-8807840 TTGTACCCATGGCAGAAGGTAGG - Intronic
1135417970 16:22283650-22283672 CTGGACCAATCGCTGTAGCTTGG + Intronic
1136546213 16:30956630-30956652 ATGTACACATATCAGGAGCTTGG + Intergenic
1141041905 16:80679822-80679844 CTGGACCAATAGCAGCATCTAGG + Intronic
1142740648 17:1930097-1930119 CTGTCCCCAAAGCAGTACCGGGG + Intergenic
1144333477 17:14247462-14247484 GTGTGCCCATGGCAGAAGCTAGG - Intergenic
1146438646 17:32874807-32874829 CTGTACACATAGGAGTTGTTAGG + Intronic
1148843843 17:50516994-50517016 CTTTACCCAGAGCTGTACCTTGG - Intronic
1151261076 17:72916501-72916523 CTGTTACCATGGCAGCAGCTGGG + Intronic
1157769954 18:50337251-50337273 CTGTACCGATGGCAGTAACCTGG + Intergenic
1158517726 18:58144804-58144826 CTGTGGACATAGCAGTAGCAAGG - Intronic
1158994520 18:62904260-62904282 CTGAACCCATAGAAGTAATTAGG + Intronic
1158995509 18:62914550-62914572 CTGTACCCTTTTGAGTAGCTGGG + Intronic
1161290290 19:3490507-3490529 CTGCACCCACAACAGGAGCTGGG + Intergenic
926782335 2:16484839-16484861 CAGTACCCAGTGCAGTAGCTGGG - Intergenic
930480417 2:51942183-51942205 CTGTATCCATACCAGTTGTTAGG + Intergenic
932972010 2:76555277-76555299 CTGTACCCATAGAAATATCATGG + Intergenic
934571853 2:95377534-95377556 CTGTCCCCATGGCAGGGGCTAGG - Intronic
935132291 2:100269542-100269564 CTGAACCTATAGAAGTAGCTTGG - Intergenic
935288428 2:101587801-101587823 GTGTACCCAGAGCAGCAGCTCGG + Intergenic
939587292 2:144020601-144020623 CTGACCCCATGGCAGTATCTAGG - Intronic
1173415802 20:42854769-42854791 CTCTGCCCAGAGCAGCAGCTGGG + Intronic
1176892869 21:14339566-14339588 GTGAACCCATAGGAGTAGATAGG + Intergenic
1178719929 21:34999156-34999178 CTGGACCCAGAGCCGGAGCTTGG + Intronic
1179434196 21:41349004-41349026 CTTTCCCCATAGCAGGAGCTTGG - Intronic
1181770120 22:25119122-25119144 CAGTACCCAGAACAGTGGCTAGG + Intronic
1182698537 22:32212318-32212340 CTGTGCCCATGGCAGCAGGTGGG + Intergenic
1182741518 22:32571361-32571383 CTCTACCCATTCCAGGAGCTTGG + Intronic
1184011895 22:41755113-41755135 CTCTATCCACAGCAGTACCTAGG - Intronic
950820348 3:15750664-15750686 TTGAACCCAGAGCAATAGCTGGG - Intronic
951645996 3:24891919-24891941 CTGCACCCACAGAAGTAGATGGG + Intergenic
952196714 3:31083351-31083373 CTGTACCTATTACAGTAGCCTGG + Intergenic
954043841 3:47911957-47911979 CTGTACCCATAGTGGTAGGCTGG + Intronic
960323344 3:116264715-116264737 CCTTAGCCATACCAGTAGCTGGG + Intronic
962508635 3:136075953-136075975 CTGTATTCTTAGCACTAGCTTGG - Intronic
962845160 3:139267498-139267520 CATTCCCCATAGAAGTAGCTTGG + Intronic
963048633 3:141123711-141123733 CAGTACCCATAGGGGCAGCTGGG + Intronic
964307985 3:155361433-155361455 CTGACCCCATGGCAGCAGCTGGG + Intergenic
964515868 3:157506871-157506893 CTGTAGCCAGAGCATTGGCTGGG - Intronic
964989840 3:162795871-162795893 CAGTACCCATAACAATACCTGGG + Intergenic
966106242 3:176337970-176337992 CTGTACTGATAGCAATATCTTGG + Intergenic
966733664 3:183171136-183171158 CTTGTCCCATAGCAGTAGCTTGG - Intergenic
966794353 3:183699082-183699104 CTGTGCTCTTTGCAGTAGCTTGG + Intronic
966822864 3:183938801-183938823 CTGTTGCCACAGCAGCAGCTGGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970105002 4:12572223-12572245 ATGTGCCCATAGCAGAAGCTAGG - Intergenic
970433790 4:16013609-16013631 ATGTACCCATAATAGTACCTAGG - Intronic
971887559 4:32473141-32473163 CTGAACCCAAAGCAGCATCTAGG + Intergenic
975990464 4:80254515-80254537 CTGTAACCTCTGCAGTAGCTGGG + Intergenic
976163641 4:82230243-82230265 CTGTATCCATAGCAGATGCTTGG - Intergenic
976602876 4:86954592-86954614 CTGGACCCCTGTCAGTAGCTGGG - Intronic
978319924 4:107482149-107482171 CTGTATCCACAGCAGTATGTGGG - Intergenic
978959537 4:114659511-114659533 CTATACCCATAGAAGTAGTCCGG + Intronic
980330745 4:131408325-131408347 CTGACCCCATAGCAGCGGCTAGG + Intergenic
981920645 4:150080544-150080566 ATGTAGTCATAGCAATAGCTTGG + Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
995446374 5:112248741-112248763 CAGTACCCTTAGAAGAAGCTAGG - Intronic
996463961 5:123778732-123778754 CTGTCCCCATGGCAGTGCCTAGG + Intergenic
1007414983 6:41686292-41686314 CTGCAACCAGAGCAGTAGCAAGG - Intronic
1014771592 6:125463851-125463873 CTGAACCCACATCAGTACCTTGG + Intergenic
1015201979 6:130592979-130593001 CTGAAGCCATAGGAGTAACTGGG + Intergenic
1016954518 6:149613750-149613772 TTAAAACCATAGCAGTAGCTGGG - Intronic
1017205132 6:151796834-151796856 ATGTTCACATAGCAGTAGTTTGG + Intronic
1022544920 7:31177539-31177561 CTGTACCTGGAGCAGTAGCTGGG + Intergenic
1022595404 7:31708910-31708932 CTCTACCCAAAGCTGTGGCTGGG - Intergenic
1026097919 7:67361468-67361490 CCATACGCATAGCAGCAGCTTGG - Intergenic
1028827583 7:95291101-95291123 CTGAACACACAGCAGTAGCAAGG - Exonic
1034528468 7:151680967-151680989 CTGTACCCAAAGAACTAGCAAGG - Intronic
1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG + Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1036632684 8:10526213-10526235 CTCGACCCCTAGCAGTTGCTAGG - Intronic
1038248635 8:25882181-25882203 CTGACCCCATAGCAGTGTCTAGG - Intronic
1041426510 8:57726662-57726684 CAGTCCCCATAGCACTAGGTAGG + Intergenic
1041629556 8:60070943-60070965 CTGTACCCAGTGCAGTAGGATGG - Intergenic
1043973650 8:86561583-86561605 CTGTACCCAGAAGAGTATCTTGG - Intronic
1047576058 8:126156618-126156640 CTGTACCCATCACAGTAGCTGGG + Intergenic
1048888508 8:138928183-138928205 CTGTGTCCATAGCAGCAACTTGG + Intergenic
1052692592 9:31834303-31834325 CTGTTCCCTTAACAGCAGCTTGG - Intergenic
1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG + Intergenic
1186372223 X:8959080-8959102 CTGTACCCGTAGTAGATGCTGGG + Intergenic
1188049929 X:25472587-25472609 CTTTAACCATCTCAGTAGCTTGG + Intergenic
1194211236 X:91072110-91072132 CTGAACCCATGGCAGTGTCTAGG + Intergenic
1194552515 X:95319583-95319605 CTGCATCCACAGCAGTAGATGGG + Intergenic
1196375190 X:115025795-115025817 CTGGACCCATGGCAGTATCTTGG - Intergenic
1198147082 X:133868210-133868232 CTGGCCCCATAGTAGTATCTAGG - Intronic
1199038240 X:143078860-143078882 CAGCAGCCATAGCAGTATCTGGG + Intergenic
1199425217 X:147693151-147693173 CTGTGCCCACAGCAGTGGGTAGG - Intergenic