ID: 1120026560

View in Genome Browser
Species Human (GRCh38)
Location 14:79592008-79592030
Sequence CTTTGTTATAGGGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120026560 Original CRISPR CTTTGTTATAGGGATGTGGA TGG (reversed) Intronic
900492896 1:2961493-2961515 CTTTGTTCTGGGGTTGAGGAGGG - Intergenic
901366856 1:8759632-8759654 CTTAGTTATTGGGATGGGAATGG - Intronic
902417917 1:16252910-16252932 CTTTTTTTTAGGGTTGTGGGGGG - Intronic
902418381 1:16257132-16257154 GTTTGTTAAAGGGATGGGAAGGG - Intronic
903060353 1:20664632-20664654 CTTGGTGAAAGGGATGTCGAGGG + Exonic
904801201 1:33094042-33094064 TTTTCTTACAGGGATATGGAAGG + Intronic
906794448 1:48686052-48686074 CTATCTCATAGGGATTTGGAGGG - Intronic
909498696 1:76309421-76309443 GTGTGTCATAGGGATGTGGGAGG - Intronic
910161729 1:84279404-84279426 CCTGGTTAGATGGATGTGGATGG - Intergenic
912860853 1:113212519-113212541 CTTTGTTTTAGGGTTGGGGGTGG - Intergenic
917386360 1:174480147-174480169 CTCTGTTTTAAGGATGTGGGTGG + Intronic
918274587 1:182941574-182941596 CTTTGTTATTGTGCTGTGAAAGG - Intronic
920412609 1:205774300-205774322 CTTTGTTGTGGGGCTGTGGGTGG - Intronic
920455063 1:206094789-206094811 CTTTGGGATAGCGAGGTGGAAGG - Intronic
920926200 1:210343969-210343991 TTTTCTTATAGGGTTGTTGAAGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921602956 1:217126005-217126027 CTCTGTCATAGGGTTTTGGATGG + Intronic
923188657 1:231598483-231598505 CTTTATCATAGGTATGTAGAGGG - Intronic
923299379 1:232627546-232627568 CTGTGTAATATGGATTTGGAAGG - Intergenic
923649322 1:235858789-235858811 CATTGTTATGGGGGTGGGGAAGG + Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
1064429163 10:15256599-15256621 GTTTGTTTTAGGGATGAAGAAGG - Intronic
1065618185 10:27550524-27550546 CTATATTATAGGGTCGTGGAAGG - Intergenic
1065758383 10:28957137-28957159 GTTTTTTGCAGGGATGTGGATGG + Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066624448 10:37392021-37392043 GTTTGTAATGTGGATGTGGAAGG + Intergenic
1068380672 10:56249910-56249932 TTTTGATACAGGGATGTGGGGGG + Intergenic
1069411253 10:68155754-68155776 CATAGTTATAAGGATGAGGATGG - Intronic
1070563559 10:77586271-77586293 CTTGGTTCTAGGGATGATGAAGG + Intronic
1073065788 10:100758472-100758494 GTTTGTTGTAGGGATGTTGGGGG + Intronic
1074521426 10:114228395-114228417 CTATGTTATTGATATGTGGAGGG + Intronic
1074659453 10:115636308-115636330 CTGTGAGATAGGGATGTGGTGGG - Intronic
1077522523 11:3044808-3044830 CTTTGAAACAGGGATGTGGGAGG + Intronic
1079230504 11:18645212-18645234 CTTTGTGCTAGAGATGTGGCTGG - Intergenic
1079327587 11:19507471-19507493 ATTTGGTATAGAAATGTGGAGGG + Intronic
1079925163 11:26484568-26484590 CTTTCTACTAGGGCTGTGGAGGG + Intronic
1081461849 11:43279389-43279411 CTATGTTTTAGGGATGATGAGGG - Intergenic
1084004318 11:66315104-66315126 CTTTGGAATGGGGATGTGTAGGG + Exonic
1084716584 11:70878171-70878193 TTTTGTAAGAGAGATGTGGATGG - Intronic
1085110029 11:73879693-73879715 GTTTTTTATAGAGATGGGGAGGG - Intronic
1085205120 11:74727026-74727048 CTTTGGAATAGGGATGTGGGAGG - Intronic
1086591768 11:88523456-88523478 CTTTGTTATATCTAAGTGGAAGG + Intronic
1089164288 11:116462601-116462623 ATTTGTTTTAGAGATGAGGAGGG - Intergenic
1089692413 11:120195116-120195138 CTTTCTTACAGAGTTGTGGAGGG + Intergenic
1090240478 11:125177928-125177950 CTTTGTAATAGGGAGTAGGAAGG + Intronic
1092076186 12:5675531-5675553 CTTTCTTATAGGAAAGAGGAAGG + Intronic
1094277270 12:28692029-28692051 CTTTATTATAGGTGTGTGAAAGG - Intergenic
1095342626 12:41109736-41109758 CTTTGTTATTATGATGTCGAAGG + Intergenic
1096662081 12:53132039-53132061 CATGGTGTTAGGGATGTGGATGG + Intergenic
1098164296 12:67677757-67677779 CTCTGTTATACTGATGTTGAAGG + Intergenic
1099341558 12:81442931-81442953 GTTTCTCATAGGGATGAGGAGGG - Intronic
1099602421 12:84758103-84758125 CTTAGCAATAGTGATGTGGATGG + Intergenic
1099842222 12:87980664-87980686 CTTTGTAATAGGGATATTGCTGG - Intronic
1099894645 12:88629696-88629718 CTTTGTTTTAGGGATTTGACAGG + Intergenic
1101425134 12:104581954-104581976 CTTTGAGATGGGGATGGGGATGG + Intronic
1102288283 12:111677503-111677525 CTTTGTTTTACAGATGAGGAGGG - Intronic
1102641476 12:114370944-114370966 CCTTGATATAGGGACTTGGAAGG - Intronic
1106806980 13:33319647-33319669 CTTGGTAACAGGGATGTGGCAGG - Intronic
1107982939 13:45750774-45750796 TTTTGTTATAGGGGTGTGTTAGG - Intergenic
1109199432 13:59413980-59414002 CTTGGCTACAGGGATTTGGATGG + Intergenic
1109344835 13:61101410-61101432 TTTTGTTATAGGTGTGTGGATGG + Intergenic
1111117247 13:83796047-83796069 TTTTGCAACAGGGATGTGGATGG + Intergenic
1112612804 13:100972605-100972627 CTTTGTTATAGGTCTATTGAGGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113274165 13:108709530-108709552 CTGTATTATAGAGGTGTGGAGGG + Intronic
1114897080 14:27004567-27004589 GTTTGGTATAGACATGTGGAAGG - Intergenic
1115132712 14:30072948-30072970 TTCTGCTAGAGGGATGTGGAAGG + Intronic
1115645301 14:35365200-35365222 CCTTCTTAGAGGGATGTGGAGGG + Intergenic
1116425202 14:44782388-44782410 CTGTGTTATAGGTATGTGAAAGG - Intergenic
1120026560 14:79592008-79592030 CTTTGTTATAGGGATGTGGATGG - Intronic
1121453417 14:94023785-94023807 CCTTGCTATTGGGATTTGGAGGG - Intergenic
1123585974 15:21760999-21761021 CTTTCTTATAGGAAAGAGGAAGG - Intergenic
1123622615 15:22203589-22203611 CTTTCTTATAGGAAAGAGGAAGG - Intergenic
1124269399 15:28266943-28266965 ATTTGTTAAATGAATGTGGATGG + Intronic
1127882380 15:63169717-63169739 TTGTGTCATAGGGAAGTGGATGG - Intergenic
1128462907 15:67884720-67884742 CTTTGTTCCAGGGATGGGGGAGG - Intergenic
1128574365 15:68760683-68760705 CTTTTTTTTAGAGATGTGGGGGG - Intergenic
1130142786 15:81244782-81244804 TTGTGTCATAGGGTTGTGGAAGG - Intronic
1130728123 15:86462199-86462221 CTCTGTTATTGGGATGTGGTGGG + Intronic
1130931793 15:88433999-88434021 CTTTGTTCTACTGATTTGGAAGG - Intergenic
1131746950 15:95458981-95459003 CTTTGGGATAGGGATGTGGGAGG - Intergenic
1133852476 16:9518397-9518419 CTATCTTTTAGTGATGTGGATGG - Intergenic
1135866173 16:26104339-26104361 CTTTGATACAGGGATGTGATTGG + Intronic
1139803814 16:69546584-69546606 GTTTGTTTTAGAGATGTGGGGGG - Intergenic
1140607714 16:76561496-76561518 CTTTGTGTTGGGGATGTGGGTGG + Intronic
1145831712 17:27921487-27921509 CCTTGTCCTAGGGATGAGGAAGG - Intergenic
1146466151 17:33088373-33088395 CTTTGATATAGCGCTGGGGAGGG - Intronic
1148473601 17:47912090-47912112 CTTTTTTGTAGGGTTTTGGATGG - Intronic
1148690234 17:49522919-49522941 CTTTATTATAGGGATAGGGAGGG + Intergenic
1150205131 17:63398515-63398537 CTTTTTTATAGGGAGGAGGAAGG + Intronic
1150338764 17:64348892-64348914 CTCTGTTACCAGGATGTGGAGGG + Intronic
1152164883 17:78696898-78696920 CTTGGCAATAGGAATGTGGAAGG + Intronic
1153062519 18:1008584-1008606 CTTTTTTTTAGGGATGAAGAAGG - Intergenic
1156059170 18:33052541-33052563 CTTCTTTATAGTGATTTGGATGG - Intronic
1157526937 18:48390746-48390768 TTTTGAGATAGGCATGTGGATGG - Intronic
1160185939 18:76676147-76676169 CATTGTTAAATGGATGTTGATGG - Intergenic
1160293991 18:77621293-77621315 ATTTGCTATAGGGGTGTCGAAGG - Intergenic
1165290300 19:34878469-34878491 CTTTTTTATATGAATGTGTATGG + Intergenic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
927978133 2:27356086-27356108 CTTTGTTGGAGGGATGTATAGGG - Exonic
930071286 2:47368876-47368898 CTTTTTTATAGTGTTCTGGAAGG + Intronic
933241555 2:79927062-79927084 ATTTGTTATAGGAATGTGTATGG + Intronic
933444554 2:82362926-82362948 CTTTATTGTAGGGATCTGGTCGG + Intergenic
937063429 2:118997834-118997856 CTTTGTTATCAGGATGACGATGG + Intergenic
937075211 2:119099354-119099376 CTTTGTTATCAGGATGATGATGG - Intergenic
940280620 2:151985773-151985795 CTCTGTTATTTAGATGTGGATGG - Intronic
941647470 2:168056830-168056852 CTGTGTGATAGGGAGCTGGAAGG - Intronic
942154916 2:173118387-173118409 CTTTGTTATAAGTTTGTGGTAGG + Intronic
942464947 2:176197914-176197936 CATTGTGATAGGCATTTGGATGG + Intergenic
945299671 2:208204345-208204367 CTTTGTTGCCAGGATGTGGAAGG + Intergenic
947132358 2:226941778-226941800 CTGTGTTATGGGTATGTGCATGG - Intronic
948080648 2:235202739-235202761 CTTCTTTATAGGCATGAGGAGGG - Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1169797744 20:9482855-9482877 CTGTGTAAAAGGGATTTGGAGGG - Intergenic
1170915392 20:20619265-20619287 CTTTGTTGCAGGTATGTGGCTGG - Exonic
1173762493 20:45575858-45575880 CTATGCTATGGGGATGAGGAGGG - Intronic
1175289137 20:57862078-57862100 CTGTGTTATGGGGCTGTGGCTGG + Intergenic
1176880380 21:14185186-14185208 CTTTGTTATAGAAATATGAAGGG + Intronic
1177084405 21:16684590-16684612 GTTTGTGATAGGGAGGTGGTGGG + Intergenic
1177109485 21:17007563-17007585 GTCTTTTACAGGGATGTGGATGG + Intergenic
1177137143 21:17317480-17317502 CTTTGGTATAAGGATGTTGCTGG - Intergenic
1179311980 21:40204550-40204572 CTATTTTATAGGTTTGTGGAAGG + Intronic
1179891426 21:44337297-44337319 CTTTGTTACGGGGAAGTTGAAGG - Intronic
1181280844 22:21719416-21719438 CTTTGTTAAAGGGAAGTCCAGGG - Intronic
1181580619 22:23826052-23826074 CTCTGTGGTAGGGATGGGGATGG + Intronic
1185276044 22:49950548-49950570 CTGTGTTATAGGGGGGTGGGGGG + Intergenic
949218398 3:1600177-1600199 CTTTGTTATAGGATCTTGGAGGG + Intergenic
949404800 3:3702939-3702961 CTTCTGTATATGGATGTGGAAGG + Intronic
950134083 3:10568311-10568333 CTTTGGTGTATGGTTGTGGAGGG - Intronic
951730023 3:25800000-25800022 CTTTAGTAGAGGCATGTGGATGG - Intergenic
952017247 3:28972098-28972120 AGTTGTTATAGTGATGGGGAAGG - Intergenic
952142464 3:30495144-30495166 CTTTCTTATAATGATGTGTAAGG + Intergenic
954819237 3:53310837-53310859 CTTTGTTATCAGAATGTAGAAGG + Intronic
955424626 3:58775580-58775602 TTTTCTTAAAGGGAAGTGGAAGG + Intronic
960107102 3:113809605-113809627 CTTTGTTCTAGTGTTGTGAAGGG + Exonic
960442883 3:117710840-117710862 CTTGGTTATAGTGATATAGATGG + Intergenic
961972595 3:130986140-130986162 CTTTGTTTTTGGGGTGGGGAAGG + Intronic
962894545 3:139702230-139702252 CTTTGATAGAGGGACGTGAAGGG - Intergenic
963712258 3:148759863-148759885 CTTTCTTATAGAGCAGTGGAAGG - Intergenic
963809760 3:149764321-149764343 CTTTGTTGGTGGGCTGTGGAAGG - Intronic
964574623 3:158151388-158151410 CTTTCTTTTGGGGATATGGAGGG + Intronic
965505447 3:169510220-169510242 CTCTGTGATTGGGATGTGAAGGG + Intronic
967878932 3:194285503-194285525 GTATGTTACAGGGATGGGGAAGG + Intergenic
972451596 4:39205552-39205574 CTTTGCTATAGGTATGGTGATGG + Exonic
973328226 4:48885660-48885682 CTTTTTAATAGAGATGTGGGGGG + Intronic
976867993 4:89754008-89754030 TTTTGTTCTTGGGATGTTGATGG + Intronic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
982178665 4:152729886-152729908 CTTTTTGATAGGGATGTCAAAGG + Intronic
985752529 5:1689096-1689118 GTTTGTTATAAAGATGTGGCTGG - Intergenic
985890473 5:2711677-2711699 CTGTGTCATAGAGATGTTGATGG - Intergenic
988260001 5:28874008-28874030 CTTTGTTATAGGGAGGCTTAGGG + Intergenic
990717293 5:58651786-58651808 TTTTGGTATAGGGATGGGGGTGG - Intronic
991040490 5:62169939-62169961 CTTTTTTGCAGGGACGTGGATGG + Intergenic
993999409 5:94760973-94760995 TTTTGTTATAGGGCTGGGCATGG - Intronic
996820048 5:127616422-127616444 CTAAGTTATAGGGATGAGAAGGG - Intergenic
997922921 5:137999662-137999684 TTTTGTTATAGTAATGTGAATGG - Intronic
997963187 5:138338059-138338081 CTTTGATTTAGGGATGGGGGTGG - Exonic
999039568 5:148392405-148392427 CTTTGTTTTGGGGAGGGGGAGGG + Intronic
999373376 5:151069611-151069633 CTCTGGTACAGGGAGGTGGAAGG + Intronic
1003926286 6:10881014-10881036 CTTGGTTAAAGGGAAGTGAAAGG + Intronic
1005870276 6:29970357-29970379 CTTTCTCACAGGGATGTAGATGG + Intergenic
1008016461 6:46525988-46526010 CTTAGTTTTATGGATTTGGATGG - Intergenic
1008895118 6:56544018-56544040 CATTGATATTGTGATGTGGATGG - Intronic
1009477280 6:64108813-64108835 CATTGTTAGAGTAATGTGGAAGG - Intronic
1009807519 6:68621427-68621449 CTTTGTTATAGGAAAGGGAAAGG - Intergenic
1012053212 6:94370531-94370553 CCAGGTTCTAGGGATGTGGAGGG + Intergenic
1015379721 6:132552726-132552748 CTTTGCTATGAGGATGTGAATGG + Exonic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017559169 6:155608078-155608100 TTTTGGTATAGGCATGGGGAAGG - Intergenic
1019710376 7:2515695-2515717 CTCTGTAATAGGGATATGGCTGG - Intronic
1021237924 7:18165904-18165926 CATTTTTATGGGGAGGTGGATGG + Intronic
1022491941 7:30827470-30827492 GGTGGTTAGAGGGATGTGGAAGG - Intronic
1024357437 7:48428471-48428493 CTGAGCTCTAGGGATGTGGAGGG + Intronic
1024573743 7:50747333-50747355 CTTTGTTTTGTGGATTTGGAGGG - Intronic
1029734144 7:102456181-102456203 CTTTGTGATGGGGCTGTGGTGGG - Exonic
1031102862 7:117504019-117504041 CTTTGTCAAAGGGATTGGGAGGG - Intronic
1031165647 7:118224431-118224453 CCTTGTGATGGGGATGGGGAGGG - Intronic
1031661060 7:124424822-124424844 CTTTGCTATAGTGAATTGGATGG - Intergenic
1034383193 7:150716934-150716956 CTTTGTTAAGGGAATGTGGGAGG - Intronic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1039852047 8:41377204-41377226 TTTTTTTATAGAGATGTGGGGGG - Intergenic
1043508607 8:80927447-80927469 CATAGCTATAGGGGTGTGGAGGG + Intergenic
1048919350 8:139213707-139213729 CTGGCTTAGAGGGATGTGGAGGG - Intergenic
1050245612 9:3686637-3686659 CTTTCTTATAGTGATGAGTACGG + Intergenic
1051222882 9:14869007-14869029 CTTTGTTAAAGGGATTTCGCCGG - Exonic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1053542613 9:38990387-38990409 GTTTGTTATTGGTTTGTGGAGGG + Intergenic
1053807067 9:41813904-41813926 GTTTGTTATTGGTTTGTGGAGGG + Intergenic
1054623525 9:67373523-67373545 GTTTGTTATTGGTTTGTGGAGGG - Intergenic
1058514636 9:105757849-105757871 CTATTTTAAAGGGATTTGGAGGG + Intronic
1059215592 9:112558723-112558745 CTTATTTTTAGGTATGTGGATGG - Intronic
1060169074 9:121445974-121445996 CCTTGGTAAAGAGATGTGGATGG - Intergenic
1060743643 9:126115787-126115809 CTTTGTAATAGAGAAGTGAACGG + Intergenic
1061106947 9:128538350-128538372 ATTTGTTTTAGGGATATAGAAGG + Intronic
1061399697 9:130361688-130361710 ATTTATTATGGGGATGGGGAGGG - Intronic
1061639720 9:131943106-131943128 CTTTGTATTAGGCATGTGAATGG - Intronic
1185846905 X:3446321-3446343 CTTTGTCATATGGATTTGGGGGG - Intergenic
1186390351 X:9152443-9152465 CTTTCTTGTAGGGATGGGGAAGG - Intronic
1188145553 X:26608122-26608144 CTTCTTTGCAGGGATGTGGATGG + Intergenic
1189711994 X:43822986-43823008 CTTGCTTATAGGGTTGTTGAGGG - Intronic
1190759757 X:53429707-53429729 CCGAGTTGTAGGGATGTGGAAGG - Intronic
1191976284 X:66875287-66875309 CTTTATGTTAGGCATGTGGAGGG - Intergenic
1193872577 X:86819317-86819339 CTGAGTTATAGGAATTTGGATGG - Intronic
1194688520 X:96954568-96954590 CTTTTATATTGGGATGAGGATGG + Intronic
1195098346 X:101527986-101528008 CTTTGTTATCAGGATGAGGTTGG - Intronic
1198520834 X:137450772-137450794 CTTTCTTCTTGGGCTGTGGATGG + Intergenic
1199076296 X:143530258-143530280 TTTTGTGGCAGGGATGTGGAGGG - Intergenic
1200817563 Y:7549286-7549308 CTTTGTCATATGGATGTGGGGGG + Intergenic