ID: 1120027902

View in Genome Browser
Species Human (GRCh38)
Location 14:79606511-79606533
Sequence CTGACTCATTTCAACCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120027902 Original CRISPR CTGACTCATTTCAACCAGGA TGG Intronic
900868349 1:5284393-5284415 CTCACTCCTGTCACCCAGGATGG - Intergenic
901818577 1:11810501-11810523 CAGCCCCAATTCAACCAGGAAGG - Intronic
902186361 1:14728530-14728552 CTGACTCAGGTCACCTAGGATGG + Intronic
902537981 1:17132540-17132562 CTCACTCATTACCACGAGGAGGG - Intergenic
902570867 1:17346367-17346389 CTGAGTGTTTTCAAGCAGGAAGG - Intronic
902696756 1:18145468-18145490 CTGCCTCATGGGAACCAGGAGGG - Intronic
903023196 1:20408936-20408958 CTGACCCCCTTCTACCAGGAAGG + Intergenic
904120628 1:28195407-28195429 CTCACTCTTGTCAACCAGGCTGG - Intergenic
904592657 1:31623629-31623651 CTGCTTCACTTCAGCCAGGAAGG - Exonic
908029677 1:59986341-59986363 CAGACTCAGTTTATCCAGGATGG - Intergenic
910193266 1:84615608-84615630 CTCACTCTTTTCACCCAGGCTGG - Intergenic
911112698 1:94208159-94208181 CTCAATCATGTTAACCAGGATGG + Intronic
913448228 1:118972626-118972648 CTCACTCTTTTCATCCAGGCTGG + Intronic
915737160 1:158092435-158092457 GAGACTCATTTGAACCCGGAAGG - Intronic
916659882 1:166913515-166913537 CTGACTCATTTCTTCTGGGAAGG - Exonic
917481250 1:175414087-175414109 CTTACTCTTATCACCCAGGATGG - Intronic
918538699 1:185603934-185603956 CTCACTCTTGTCACCCAGGATGG + Intergenic
918566793 1:185943514-185943536 CTGAGTCATATCTACAAGGAAGG - Intronic
920510199 1:206545378-206545400 CTCACTCTTTTCACCCAGGCTGG + Intronic
921195926 1:212757679-212757701 CTCACTCATTACCACAAGGAGGG + Intronic
923090035 1:230733326-230733348 CTGTATCATTTCAATCAGAAAGG - Intergenic
924655303 1:245969504-245969526 CTGACTGATTTACAACAGGATGG - Intronic
1063819759 10:9820337-9820359 CTGACACATGCAAACCAGGATGG + Intergenic
1063876161 10:10481031-10481053 CTCACTCTTGTCAACCAGGCTGG - Intergenic
1066430683 10:35348602-35348624 CTGACTCATCCCACCCTGGACGG - Intronic
1066734171 10:38455959-38455981 TTGACTCTTTTCACCCAGGCTGG + Intergenic
1067116922 10:43442531-43442553 GAGAATCATTTCAACCCGGAGGG - Intronic
1067778559 10:49180147-49180169 CTGACTCTTTCCTAGCAGGAAGG - Intronic
1068712605 10:60150613-60150635 CTTACTCACTACAACAAGGAGGG - Intronic
1069461358 10:68598299-68598321 CAGAATCATTTGAACCCGGAAGG + Intronic
1070093957 10:73318032-73318054 CTGTCTCATTACAATCATGATGG - Intronic
1070837653 10:79460268-79460290 CTCACTCATTACCACAAGGATGG - Intergenic
1071560393 10:86642469-86642491 GAGAATCATTTCAACCTGGAAGG - Intergenic
1072803470 10:98409235-98409257 GTCACTCATTTCAGCCAAGAGGG - Intronic
1073550560 10:104396821-104396843 CTGAGCCATCTCACCCAGGAAGG - Intronic
1075312963 10:121430193-121430215 CTCACTCATTACCACAAGGATGG + Intergenic
1075863920 10:125701871-125701893 CTGTTTCATTTCTACCAGGTAGG + Intergenic
1078144262 11:8712400-8712422 CTGCCTCCTCTCAGCCAGGAGGG - Intronic
1079016585 11:16874033-16874055 CTGCCTCATTTCCACCTGGAGGG + Intronic
1080953535 11:37065289-37065311 CTGTCTCATTTCAAGCAGGGAGG + Intergenic
1081327755 11:41766983-41767005 CTCACTCATTACCACAAGGATGG + Intergenic
1083539639 11:63503639-63503661 CTTCCTCATTTCACCCAGGAAGG + Intergenic
1085100637 11:73797030-73797052 CTCACTCTTTTCACCCAGGCTGG - Intronic
1086476075 11:87176189-87176211 CTCACTCATTACCACAAGGAAGG - Intronic
1087305591 11:96486384-96486406 CAGAATCATATCAAGCAGGAAGG + Intronic
1089138827 11:116270423-116270445 CTGACTTCTTTCCACCAGGCAGG + Intergenic
1089601108 11:119615858-119615880 CTTACTCATTTTACCAAGGAGGG + Intergenic
1090319832 11:125832720-125832742 CTCACTCATTACAATGAGGATGG + Intergenic
1091080856 11:132666389-132666411 CTCACTCATTACAGCCAGGAGGG + Intronic
1091773918 12:3172022-3172044 CTGAGTTATCACAACCAGGATGG - Intronic
1092819012 12:12335810-12335832 CTCACTCTTTTCACCCAGGCTGG - Intronic
1094825011 12:34263256-34263278 GAGACTCACTTGAACCAGGAAGG - Intergenic
1095309845 12:40685652-40685674 CTGGCTGATTCCAAACAGGATGG - Intergenic
1096058089 12:48672454-48672476 CTCACTCTTGTCACCCAGGATGG + Intronic
1096965011 12:55619023-55619045 CTCACTCTTGTCAACCAGGCTGG - Intergenic
1097647091 12:62249428-62249450 CTTACTCATTACCACAAGGATGG - Intronic
1100354826 12:93819092-93819114 CTGACTCATGTCACCCATGTGGG + Intronic
1102700782 12:114837605-114837627 GTGAATCATTTCAACCCGGGAGG - Intergenic
1102712622 12:114941486-114941508 CTTACTCATTACTACAAGGAGGG + Intergenic
1103780106 12:123392815-123392837 CTCTCTGATTTCACCCAGGAAGG + Intronic
1106559799 13:30838405-30838427 CTCACTCATTACTACAAGGAGGG + Intergenic
1107136208 13:36946662-36946684 CTCACTCATGTCACCCAGGCTGG + Intergenic
1107655751 13:42590807-42590829 CTTTCTCATTTAAACCATGAAGG + Intronic
1108293865 13:48991802-48991824 CTGACATATTTTAACCAGGTGGG - Intronic
1108618255 13:52157136-52157158 CTGAAGCATTTTAACCAAGAAGG + Intronic
1108855776 13:54791104-54791126 CTCACTCATTACCACAAGGATGG + Intergenic
1109079102 13:57875419-57875441 CTCACTCATTTCCATAAGGATGG + Intergenic
1110014244 13:70380489-70380511 CAGAATCATTTGAACCTGGAAGG - Intergenic
1110607671 13:77451703-77451725 CTTGCTCTTGTCAACCAGGATGG - Intergenic
1111915974 13:94360729-94360751 CTCACTCATTTCAAAAAAGATGG - Intronic
1112348493 13:98612909-98612931 CAGAATCACTTCAACCAGGGAGG - Intergenic
1118922864 14:70165996-70166018 CTGACTCAATTCAACTAGGCTGG + Intronic
1119161580 14:72457052-72457074 CTGACTCTTGTCACCCAGGCTGG - Intronic
1119744343 14:77033578-77033600 CTGACTGATTTCTTCCTGGAGGG + Intergenic
1120027902 14:79606511-79606533 CTGACTCATTTCAACCAGGATGG + Intronic
1120101022 14:80445748-80445770 CTCACTCATTACAATGAGGATGG - Intergenic
1121814384 14:96917857-96917879 CTGTCTCATTGTAACCAGAAAGG - Intronic
1124259083 15:28171395-28171417 CTGAGTAATTTGAACCAGAAAGG + Intronic
1124566595 15:30820785-30820807 CTGAGTAATTTGAACCAGAAAGG - Intergenic
1124954844 15:34353596-34353618 CTAAGTCATGTCACCCAGGAGGG - Intronic
1126301620 15:47203094-47203116 CTGAGTCAGTTCAAACAGGCAGG - Intronic
1126477126 15:49077245-49077267 CTGGCTAATTTTAACCAGGCTGG + Intergenic
1128670943 15:69574369-69574391 CTGACTCATTTCTTCCATGAAGG + Intergenic
1128789852 15:70425158-70425180 CTCACTCATTACCACAAGGATGG + Intergenic
1128869286 15:71140426-71140448 CTCACTCATTACCACAAGGAGGG + Intronic
1130052297 15:80493861-80493883 CTTACTCATTTCCACAGGGAGGG - Intronic
1132289880 15:100692536-100692558 CTGGCTCATAGCAACCATGAAGG - Intergenic
1132321813 15:100930777-100930799 CTGACTCAGGCAAACCAGGAGGG - Intronic
1134244079 16:12526899-12526921 CTGACTGATGGCAACCAGCATGG - Intronic
1134819312 16:17233315-17233337 CTCACTGTTTTCAAGCAGGATGG - Intronic
1134863209 16:17579487-17579509 CATACTCCTTTCAGCCAGGAAGG + Intergenic
1135641485 16:24123437-24123459 CTGAGACATTTTAAGCAGGAGGG + Intronic
1135977303 16:27117137-27117159 CTCACTCATTACCACCAGGAGGG + Intergenic
1136023040 16:27452122-27452144 CTCACTCATACCAGCCAGGAGGG - Intergenic
1140704926 16:77618976-77618998 CTGAATCATATCAAACAGTAAGG + Intergenic
1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG + Intronic
1140942952 16:79739203-79739225 CTGACTCATTCCAGCTAAGAAGG - Intergenic
1142469912 17:157489-157511 CTGACTCTTGTCACCCAGGCTGG + Intronic
1143075953 17:4343472-4343494 CTCACTCTTTTCATCCAGGCTGG - Intronic
1144214004 17:13038719-13038741 CTCACTCACTACCACCAGGATGG - Intergenic
1144218975 17:13082987-13083009 CTCACTCATTACCACGAGGACGG + Intergenic
1145327757 17:21844728-21844750 ATGACTGAGTTCAACCATGACGG - Intergenic
1150458189 17:65325302-65325324 TTGGAGCATTTCAACCAGGAGGG + Intergenic
1153286108 18:3456003-3456025 CTGCCACATTTGAAACAGGAAGG - Intronic
1153368466 18:4286428-4286450 ATGACTCATTTCAAGCACGGAGG + Intronic
1154299322 18:13179323-13179345 CTAATTCATATCCACCAGGATGG + Intergenic
1155719349 18:28991827-28991849 CTGCCTCATTACATCCAGAATGG + Intergenic
1156500810 18:37556660-37556682 CTGTCTGAGTTCAAACAGGATGG - Intronic
1156919696 18:42506025-42506047 CTTAATCATCTCAACCAGAATGG - Intergenic
1158108996 18:53919041-53919063 TTGACTGATTTAAACCAGGATGG + Intergenic
1159011853 18:63065544-63065566 CTTACCCATTCCAAGCAGGAAGG + Intergenic
1159544147 18:69818258-69818280 TTGAGACATCTCAACCAGGAGGG + Intronic
1159710396 18:71751035-71751057 CAGAATCATTTGAACCCGGAAGG + Intronic
1161067145 19:2244262-2244284 CTGACTCAGAACCACCAGGAAGG + Intronic
1161330888 19:3687161-3687183 CTCACTCTTTTCACCCAGGCTGG - Intronic
1161882299 19:6964447-6964469 CTCACTCTTTTCACCCAGGCTGG - Intergenic
1163181860 19:15609601-15609623 CTCACTCAAAACAACCAGGATGG - Intergenic
1164710880 19:30356403-30356425 CTCACTCATCTGTACCAGGACGG - Intronic
1167864443 19:52313164-52313186 CTCACTCTTTTCCCCCAGGATGG + Intronic
1168606124 19:57761373-57761395 CTGTTTCATTTCGACCTGGAAGG + Intergenic
925800537 2:7595114-7595136 CTGGCACATTTGATCCAGGAAGG - Intergenic
926139820 2:10361744-10361766 CTCACTCTTGTCAACCAGGATGG + Intronic
926210269 2:10864130-10864152 TGGGCTCATTGCAACCAGGAAGG + Intergenic
926647371 2:15304190-15304212 CTCACTCATTACCACCAGAACGG - Intronic
927645002 2:24872048-24872070 CTGACACACTTCACCCAGCAGGG + Intronic
928705010 2:33940257-33940279 CTTACTCATTACCACAAGGATGG - Intergenic
929289928 2:40178394-40178416 CTCACTCATCTCCACCAGGCGGG + Exonic
929513825 2:42587624-42587646 CTGACTCTTGTCACCCAGGCTGG + Intronic
930638979 2:53836015-53836037 CTCACTCATTACTGCCAGGATGG - Intergenic
932490553 2:72117310-72117332 CTCACTCATTGCCACAAGGAGGG + Intergenic
933129150 2:78651401-78651423 CAGAATTATTTCAACCAGGAAGG - Intergenic
935685819 2:105681688-105681710 CAGAATCATTTGAACCTGGAAGG + Intergenic
936959103 2:118054983-118055005 CTGACACATTTCTATCAGGAAGG + Intergenic
938291929 2:130155100-130155122 CTGAATCATCTCAGCCAGGTTGG + Exonic
938464622 2:131517864-131517886 CTGAATCATCTCAGCCAGGTTGG - Intergenic
939678549 2:145102392-145102414 CTCACTCATTACAAGGAGGATGG + Intergenic
939696750 2:145335263-145335285 GTGAGTTATTTGAACCAGGAAGG + Intergenic
943477656 2:188378720-188378742 CTCACTCATTACCACCAGGATGG + Intronic
943769558 2:191701796-191701818 CTCACTCATTTCCACAAGGACGG - Intergenic
944228108 2:197368205-197368227 CTGTCTCATTGCACCCAGGCTGG - Intergenic
945219128 2:207466401-207466423 CTGACTCCTGTCACTCAGGAAGG + Intergenic
945985677 2:216351757-216351779 CTGACTCATCTCAAAGATGAAGG + Intronic
946812403 2:223539852-223539874 CTCACTCTTTTCACCCAGGCTGG - Intergenic
947980076 2:234401120-234401142 CTGACTCCTTTCTAACAGGAAGG - Intergenic
1168772661 20:425456-425478 CTGCCTCATTGTAACCAGCATGG + Intronic
1170422183 20:16204179-16204201 CTTACTCATCTCACTCAGGATGG + Intergenic
1170876993 20:20259281-20259303 CTGACTCCTGTCACCCAGGCTGG + Intronic
1174001398 20:47377560-47377582 CTGACTCCCTGCACCCAGGATGG + Intergenic
1174776225 20:53345578-53345600 CTGAGTCATGGTAACCAGGAGGG - Intronic
1174933879 20:54846109-54846131 CTGCCTCCTTTCAAGCTGGAAGG + Intergenic
1176043707 20:63081616-63081638 CTGACTCACTTCCTCTAGGAAGG - Intergenic
1176518680 21:7807839-7807861 CTCACTCTTTTCACCCAGGCTGG - Intergenic
1177785359 21:25665644-25665666 CTGACTTCTCTCAAGCAGGAGGG - Intronic
1177966848 21:27738324-27738346 CTCACTCATTACCACAAGGATGG + Intergenic
1178506649 21:33168377-33168399 TTGACACATTTTAGCCAGGATGG - Intronic
1178652708 21:34437852-34437874 CTCACTCTTTTCACCCAGGCTGG - Intergenic
1179607879 21:42529522-42529544 CTCACTCATGTCACCCAGGCTGG - Intronic
1183903040 22:41020803-41020825 CTTACTCAGTTCACCCAGGCTGG - Intergenic
1184267721 22:43358538-43358560 CTGGCTCATTTCACCCAGGCTGG - Intergenic
1184600466 22:45540391-45540413 CTGACTCATTTGACTGAGGAGGG + Intronic
951713546 3:25611970-25611992 CTCACTCTTGTCAACCAGGCTGG + Intronic
952901174 3:38112540-38112562 CTGAGGCATTTCAGGCAGGAGGG + Intronic
953202304 3:40788265-40788287 CTCACTCATTACCACAAGGAGGG - Intergenic
953856523 3:46503523-46503545 CTCACTCATTACACCAAGGATGG + Intergenic
955246065 3:57226265-57226287 CTAACTCAGTTCAATCAGGAAGG + Intronic
955339077 3:58110933-58110955 CTGGCTCCTTACAACCAAGAAGG + Intronic
956334643 3:68149622-68149644 CTCATTCATTACAACAAGGATGG + Intronic
956675458 3:71728263-71728285 CTTACATATTTCAAACAGGAAGG - Intronic
956739577 3:72265061-72265083 GTAACTGATATCAACCAGGATGG + Intergenic
957391953 3:79586422-79586444 CTGACTCATGTCAACAAGCCTGG - Intronic
959411494 3:106029046-106029068 CTGATTCATTACCTCCAGGAAGG - Intergenic
963041400 3:141072447-141072469 CTCACTCATTACCACGAGGAGGG - Intronic
965007910 3:163049671-163049693 CTCACTCTTGTCAACCAGGTTGG + Intergenic
965671895 3:171156307-171156329 CTTACTGATTTAAACCAGGGAGG + Intronic
965808047 3:172562539-172562561 CTGAATCACTTGAACCTGGAAGG + Intergenic
966891381 3:184409845-184409867 CAGACTCATGTCTGCCAGGAGGG - Intronic
967870953 3:194228655-194228677 CTGTCTCTTCTCAACCAGAATGG + Intergenic
968141374 3:196260322-196260344 CTACTTCATATCAACCAGGATGG + Intronic
968466839 4:756300-756322 GAGACTCACTTCAACCAGGGAGG - Intronic
970361493 4:15312726-15312748 GTTCCTCATTTCCACCAGGATGG + Intergenic
972799542 4:42460475-42460497 GAGACTCATTTGAACCAGGGAGG - Intronic
973032956 4:45366855-45366877 CTCACTTATTGCCACCAGGATGG - Intergenic
974771584 4:66421644-66421666 GTGGGTCATTTCACCCAGGAGGG + Intergenic
977907449 4:102494370-102494392 TTTAGTTATTTCAACCAGGAAGG - Intergenic
978191787 4:105922475-105922497 CAGAATCATTTCAACCTGGGAGG - Intronic
979291227 4:118981223-118981245 CTGACCCATTTGTTCCAGGATGG + Intronic
981073917 4:140572278-140572300 CTGCCTTATTTAAACCTGGAAGG + Intergenic
981194100 4:141898458-141898480 CTCACTCATTACTCCCAGGATGG - Intergenic
981419386 4:144532073-144532095 CTCACTCATTCCCTCCAGGAGGG - Intergenic
981703834 4:147638592-147638614 CTCTCCCATTTCAACCTGGATGG + Exonic
981797918 4:148619051-148619073 CTCACTCATTACCACAAGGATGG - Intergenic
982341403 4:154303009-154303031 CTCACTCTTTTCCCCCAGGAGGG + Intronic
983049789 4:163032915-163032937 CTGATTGATTTCAGTCAGGAGGG + Intergenic
984694052 4:182761387-182761409 CTCACTCTTTTCACCCAGGCTGG - Intronic
985031650 4:185796295-185796317 GTGAGACATTTCAAGCAGGAAGG - Intronic
986010061 5:3706143-3706165 CTGCCTTATTTCAACCACTATGG + Intergenic
986181151 5:5393955-5393977 CTGGCTCATCACAACAAGGAAGG - Intergenic
987706981 5:21470555-21470577 CTGGCTCATCACAACAAGGAAGG + Intergenic
987709968 5:21493511-21493533 CTGAGTCAAGTTAACCAGGAGGG - Intergenic
988749644 5:34180652-34180674 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
988793538 5:34631418-34631440 CTGACTCAGTTCCTCCAGTATGG + Intergenic
989198862 5:38743018-38743040 CTCACTCATTACCACGAGGAAGG - Intergenic
989447107 5:41542627-41542649 CTGTCTTATATCAGCCAGGATGG + Intergenic
989948877 5:50273558-50273580 CTCACTCTTGTCAACCAGGCTGG + Intergenic
990097858 5:52140414-52140436 CTTACTCATTACCACTAGGATGG - Intergenic
990716128 5:58639179-58639201 CTCACTCATTTCAATGAGCAAGG - Intronic
990820925 5:59839370-59839392 CTGAGTAATATCAACCAGGCAGG - Intronic
991737901 5:69643856-69643878 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
991760293 5:69912568-69912590 CTGAGTCAAGTTAACCAGGAGGG - Intergenic
991787039 5:70205532-70205554 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
991789477 5:70223582-70223604 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
991814225 5:70498692-70498714 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
991817360 5:70519984-70520006 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
991839524 5:70787619-70787641 CTGAGTCAAGTTAACCAGGAGGG - Intergenic
991879484 5:71205922-71205944 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
991881924 5:71223951-71223973 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
992616337 5:78549329-78549351 CTGCCACATTTCAGCCATGAAGG + Intronic
994234009 5:97340273-97340295 CTTACTCATTACCACCAAGATGG + Intergenic
994604045 5:101943878-101943900 CTCACTCATTACCTCCAGGAGGG - Intergenic
996385479 5:122905848-122905870 AGGACTGAGTTCAACCAGGAAGG - Intronic
996727263 5:126683549-126683571 CTCACTCATTACTACGAGGATGG - Intergenic
997820074 5:137057197-137057219 CTCACTCTTTTCAAGCAGGAGGG + Intronic
998348950 5:141488437-141488459 CTGAATCAGGTCACCCAGGAGGG - Intronic
998928599 5:147155664-147155686 CTCACTCTTGTCAACCAGGCTGG - Intergenic
999933234 5:156456440-156456462 CTGACACTTTACAACAAGGATGG - Intronic
1001535391 5:172494432-172494454 CTCACTCATGTCGCCCAGGATGG - Intergenic
1001593422 5:172881968-172881990 CTGACTAATGTCAGCCAGGGAGG + Intronic
1004535321 6:16494955-16494977 ATGACTCATGGCAACCAGAAAGG - Intronic
1004608544 6:17216847-17216869 CTGACTAATTTTAGCCAGGATGG - Intergenic
1005059695 6:21764184-21764206 GAGAATCATTTAAACCAGGAAGG - Intergenic
1005547714 6:26886998-26887020 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
1006223032 6:32510815-32510837 CTCACTCATTTCAGCTAGGATGG - Intergenic
1006229679 6:32573453-32573475 CTCACTCATTACAGCTAGGATGG - Intronic
1007214470 6:40226750-40226772 CTCACTCATTACCATCAGGAAGG + Intergenic
1007599534 6:43073205-43073227 CTCACTCCTTTCTGCCAGGATGG + Exonic
1009018477 6:57928072-57928094 CTGAGTCAAGTTAACCAGGAGGG + Intergenic
1009021244 6:57949944-57949966 CTGGCTCATCACAACAAGGAAGG - Intergenic
1009515152 6:64606689-64606711 CTGACTCACTTCAATCTGAAAGG - Intronic
1014733437 6:125062604-125062626 CTCACTCTTTTCACCCGGGATGG + Intronic
1017194064 6:151681641-151681663 GATATTCATTTCAACCAGGACGG - Intronic
1019958605 7:4437319-4437341 CGGACTCATTTCAACAACCATGG + Intergenic
1020528876 7:9302718-9302740 CTGACTCTTTTCACACATGAAGG + Intergenic
1020975363 7:14999552-14999574 CTCACTCATTACCACAAGGAAGG - Intergenic
1021856647 7:24863559-24863581 CTGGCTCATTTCTACCAGGTAGG + Exonic
1023847801 7:44132588-44132610 CCGACCCATGCCAACCAGGAGGG + Intergenic
1024300878 7:47886561-47886583 CTCACTCATTACAGCGAGGAGGG - Intronic
1026238566 7:68551200-68551222 CTCACTCTTTTCACCCAGGCTGG - Intergenic
1026428357 7:70318962-70318984 CTGTCTCTTTTCAAGCAAGATGG + Intronic
1026442661 7:70457678-70457700 CTGACTCATTTGTACCACCATGG - Intronic
1027154888 7:75759955-75759977 CTTAGTCATTTCAACCTTGAAGG - Intergenic
1029733762 7:102454363-102454385 CTCACTCATTTTACCCAGGCTGG - Exonic
1032088658 7:128898083-128898105 CTCACTCTTTTCACCCAGGCTGG + Intronic
1032270526 7:130400570-130400592 CTGACTCCTTTCAGCCAGCATGG + Intronic
1032928740 7:136640311-136640333 CTCACTCATTACTGCCAGGATGG + Intergenic
1037515307 8:19625063-19625085 CTGAACCATCTCAGCCAGGAAGG + Intronic
1040641259 8:49336484-49336506 CTGTATCATTCCAACCAAGATGG + Intergenic
1041324593 8:56651436-56651458 CTCACTCATTACCACGAGGAGGG + Intergenic
1043146921 8:76670312-76670334 CTCACTCATTTTCAACAGGATGG - Intergenic
1043779119 8:84310133-84310155 CAGAATCATTTCAACCAGGGAGG - Intronic
1043846044 8:85165154-85165176 CTGACACATTTAATCCAGAAAGG - Intergenic
1043846713 8:85171931-85171953 CTCACTCATTGCCACTAGGAGGG + Intergenic
1044306769 8:90647488-90647510 CTGACTCAGCCCAACCAGGGTGG - Intronic
1045694852 8:104797389-104797411 CTGAGTCATTTCAGGCAGAATGG + Intronic
1047094989 8:121615424-121615446 GAGAATCATTTGAACCAGGAAGG - Intronic
1047666908 8:127101474-127101496 CTAACTTATTTCCTCCAGGATGG - Intergenic
1050044941 9:1533247-1533269 CGCATCCATTTCAACCAGGACGG + Intergenic
1050305453 9:4300904-4300926 CTCACTCATTTCATTCATGATGG - Intronic
1050481351 9:6090392-6090414 CTCACTCATTACAAAGAGGATGG - Intergenic
1050625072 9:7494753-7494775 CAGAATCACTTGAACCAGGAAGG - Intergenic
1051347519 9:16165672-16165694 CTCACTCATTACCACGAGGATGG + Intergenic
1051520401 9:17981006-17981028 CTCACTCATTGCCACGAGGATGG + Intergenic
1051800242 9:20924689-20924711 GTGACTCATTTAAACCAAAAAGG + Intronic
1055102048 9:72475968-72475990 CTCGCTCTTTTCACCCAGGACGG - Intergenic
1055635284 9:78271728-78271750 CTCACTCATGTCACCCAGGCTGG + Intronic
1058837181 9:108868059-108868081 CTCACTCATTACCACGAGGATGG - Exonic
1061152912 9:128838991-128839013 CTCACTCATGTCACCCAGGCTGG + Intronic
1186985517 X:15009628-15009650 CTCACTCCTATCACCCAGGATGG + Intergenic
1187383142 X:18823595-18823617 CTGGCTCTTTTCACCCAGGCTGG - Intronic
1187710607 X:22049772-22049794 GTGAATCACTTGAACCAGGAGGG + Intronic
1188465090 X:30470863-30470885 CTCACTCTTGTCACCCAGGATGG + Intergenic
1193794983 X:85863180-85863202 CAGACTCACTTGAACCAGGGAGG - Exonic
1196174466 X:112625863-112625885 CTGACTCAGTTGAACTGGGATGG + Intergenic
1198171057 X:134105630-134105652 CTCGCTCATTACCACCAGGATGG + Intergenic
1199406175 X:147463364-147463386 CTGAATCATTTCAACATGGCTGG - Intergenic
1199539755 X:148945878-148945900 CTGACTCTTTAAAACCAGTAAGG + Intronic