ID: 1120029086

View in Genome Browser
Species Human (GRCh38)
Location 14:79619914-79619936
Sequence TGGTCCCCATGTCAGAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120029086_1120029088 16 Left 1120029086 14:79619914-79619936 CCTTAGTTCTGACATGGGGACCA 0: 1
1: 0
2: 0
3: 15
4: 119
Right 1120029088 14:79619953-79619975 AAAAGCTCTATGAAGTGATTTGG 0: 1
1: 0
2: 2
3: 26
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120029086 Original CRISPR TGGTCCCCATGTCAGAACTA AGG (reversed) Intronic
900016968 1:158552-158574 AGGTCCCCATGCCTGGACTATGG + Intergenic
900047229 1:517144-517166 AGGTCCCCATGCCTGGACTATGG + Intergenic
900069443 1:759001-759023 AGGTCCCCATGCCTGGACTATGG + Intergenic
900428243 1:2590202-2590224 TGGTCCCCAGGTCTGGACTAGGG - Exonic
902749022 1:18493684-18493706 TGGTTCACTTGTCACAACTAAGG + Intergenic
904855678 1:33496705-33496727 TGGTCCCCATGCCAAGACTGAGG + Intergenic
907813466 1:57895257-57895279 TAATCCCCAGGTCAGACCTATGG + Intronic
912637602 1:111312475-111312497 TGGTCCCCATCTCAGATCCATGG - Intronic
922104807 1:222504400-222504422 AGGTCCCCATGCCTGGACTATGG + Intergenic
922265116 1:223976914-223976936 AGGTCCCCATGCCTGGACTATGG + Intergenic
924346981 1:243081924-243081946 AGGTCCCCATGCCTGGACTATGG + Intergenic
1066030867 10:31422331-31422353 TGGTCCACACATCAAAACTAAGG - Intronic
1066381679 10:34907087-34907109 TGGACACCATGACAAAACTAGGG - Intergenic
1067795714 10:49320280-49320302 TGGTCCCCATGTCACAAGGCAGG + Intronic
1072888263 10:99299146-99299168 TGGGGCCCCTCTCAGAACTAGGG - Intergenic
1074316718 10:112368008-112368030 TGGGCCCCAGATCAGACCTACGG + Intergenic
1076973570 11:153767-153789 AGGTCCCCATGCCTGGACTATGG + Intergenic
1080120770 11:28674554-28674576 TGGTCCACATGCCAGAGCTGTGG + Intergenic
1084416620 11:69036163-69036185 TGGTCCCCAGGGCAGGACAAGGG + Intergenic
1085035915 11:73299923-73299945 GGGTACCCACGTCAGAACGATGG - Intergenic
1085254640 11:75165529-75165551 TGGACCCCATGTTAGAACATGGG - Intronic
1085517789 11:77121596-77121618 TGGTGCCCATGTCACAGCTGAGG - Intronic
1087290236 11:96313315-96313337 TCATCCCCATCTCAGAACTGGGG + Intronic
1088777527 11:113100185-113100207 TGGTCCCCTTCACAGAACTTAGG + Intronic
1089016313 11:115168153-115168175 AGGTCCCCATATCAGAGGTAGGG - Intergenic
1093088330 12:14891789-14891811 TGGACCCCATGTCTAACCTAAGG + Intronic
1095158907 12:38892219-38892241 TGGTGCCCATGTCTGAGATAAGG + Intronic
1096862226 12:54538086-54538108 TGGTCCCGATATAAGAACCAGGG + Intronic
1100393149 12:94161795-94161817 TGCTCCCCAAGGCAGAACCAAGG + Intronic
1100677714 12:96886345-96886367 TGGTCCCAATGTCATCACAAGGG - Intergenic
1101797053 12:107984823-107984845 TGGTCCCCACCTCAGACCTACGG + Intergenic
1104091739 12:125523444-125523466 TGGGCCCCATGTCATCACAAGGG - Intronic
1104110280 12:125698124-125698146 TCATCCCCTTGTGAGAACTAGGG - Intergenic
1110686738 13:78384462-78384484 TGGTCCACATTTTAGAGCTAAGG + Intergenic
1111464066 13:88585242-88585264 TGGACCCCATCTCAGAACTGAGG + Intergenic
1112870072 13:103960432-103960454 TGGTCACCATGTCATCAATAAGG - Intergenic
1115855342 14:37624372-37624394 TGGAGCCTATGTCAGAAGTAGGG - Intronic
1118678565 14:68215381-68215403 TTGTACCCATTTCAGAAATAAGG + Intronic
1119476678 14:74934569-74934591 AAGTCCCCATGTCAGAACCTGGG - Intergenic
1120029086 14:79619914-79619936 TGGTCCCCATGTCAGAACTAAGG - Intronic
1121694164 14:95899371-95899393 TGGTCCCCATCTCAGAGCTGAGG - Intergenic
1121897389 14:97661206-97661228 TGCCCCACATGTCAGAACTAAGG - Intergenic
1124710308 15:32004768-32004790 TTATCCCCATGTTAGAACTGAGG + Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1128359710 15:66953439-66953461 TGGTCCCCATGGCAGAGAAAAGG - Intergenic
1128450887 15:67805323-67805345 TGGACCACAGGTCAGAACTGTGG - Intronic
1128886893 15:71296336-71296358 TGGGCCCCATGCCAGACCTCAGG - Intronic
1133489282 16:6251317-6251339 TGGTACCCATGTCACAAGCAGGG - Intronic
1139328836 16:66172099-66172121 AGGCCCCCAAGGCAGAACTAGGG + Intergenic
1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG + Intergenic
1142446692 16:90143905-90143927 AGGTCCCCATGCCTGGACTATGG - Intergenic
1142460813 17:91564-91586 AGGTCCCCATGCCTGGACTATGG + Intergenic
1146309780 17:31758797-31758819 TGGGCCCCATCTCTGTACTATGG + Intergenic
1146525512 17:33564006-33564028 TGGTTCCAGTGTCAGGACTATGG - Intronic
1148910488 17:50939899-50939921 TGCTCCCCAGGCCAGAACTTGGG + Intergenic
1149927878 17:60719904-60719926 TGGTCCCCAGGTCAAGACTCTGG - Intronic
1156396343 18:36703469-36703491 ATGTCCCCATGTGAGAAATAAGG - Intronic
1157276833 18:46316502-46316524 TGGTCCCAATTCCAGAACAAGGG - Intergenic
1160650515 19:223926-223948 AGGTCCCCATGCCGGGACTATGG + Intergenic
1161609276 19:5231909-5231931 TGGTCCCCATGCCAGAAACTGGG + Intronic
1165121648 19:33562851-33562873 TGGTCCCCATCTCTGGACTCTGG - Intergenic
1165138763 19:33686975-33686997 TGGTCCCCATCTGAGAGCCATGG + Intronic
1168451612 19:56470799-56470821 TGGTCCCCATCTCTGTACGAAGG - Intronic
927906651 2:26863253-26863275 TGGGGCCCATGTCAGAGCTGTGG - Intronic
934562346 2:95319914-95319936 TGAGCCCCATCTCAGAACAAGGG + Intronic
934922520 2:98357422-98357444 TGGTCCCTAAGGCAGAATTAAGG + Intronic
935885014 2:107608263-107608285 GAGTCCCCAGGTCAGAAGTAAGG - Intergenic
941194240 2:162426587-162426609 TGGTCAGCATATCAGAATTAAGG - Intronic
943634915 2:190295939-190295961 TCATCCCCATTTCAGAACTGAGG + Intronic
943871962 2:193011473-193011495 TGGTCCCCAAGTCAGATCTGGGG - Intergenic
946746128 2:222847692-222847714 AGGTCCCCATGTCAGAAAGATGG - Intergenic
1175331395 20:58167043-58167065 GGGTCCCCATGTCACAGCTGGGG - Intergenic
1181345435 22:22216647-22216669 TGGTCACTTGGTCAGAACTAAGG + Intergenic
1183034117 22:35127827-35127849 TGTAGCACATGTCAGAACTATGG + Intergenic
1184313687 22:43665733-43665755 TGGTCCCCAAATCAGAAATCTGG + Intronic
951364054 3:21758881-21758903 TGGACACCATGTCATAACTTTGG + Intronic
952178618 3:30894495-30894517 TAGTCCCCAGGTCAAAAATAAGG + Intronic
955001181 3:54929193-54929215 TTGTCCCCATGTCAGAGATGGGG - Intronic
955047084 3:55370571-55370593 TGGTCCTCATTCCAGCACTAAGG + Intergenic
962645915 3:137439988-137440010 TGGTGCCAATGTCAGCACTAGGG - Intergenic
966138657 3:176730056-176730078 TGGTCCCCTGTTCAGAACTAGGG + Intergenic
966296999 3:178435651-178435673 TGCTTCTCATGTCAGCACTATGG + Intronic
967451282 3:189626217-189626239 TCCTCCCCATGACAGAACTTTGG + Intergenic
968367318 3:198196059-198196081 AGGTCCCCATGCCTGGACTATGG - Intergenic
968488987 4:880081-880103 TGGTCCACATGTCAGAGCTGTGG - Intronic
968488998 4:880137-880159 TGGTCCACATGTCAGAGCCATGG - Intronic
968489019 4:880249-880271 TGATCCACATGTCAGAGCTGTGG - Intronic
972346034 4:38193111-38193133 GGGGCCCCATCTCAGACCTATGG + Intergenic
975253669 4:72210214-72210236 TGGTGCCAAGCTCAGAACTATGG + Intergenic
977765225 4:100789509-100789531 TTGTCCACATGTTATAACTATGG - Intronic
978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG + Intronic
979332607 4:119434774-119434796 AGGTCCCCATGCCTGGACTATGG + Intergenic
979974070 4:127174072-127174094 TGGTGCCCATGTGAGAAATAAGG - Intergenic
982563006 4:156954222-156954244 TTGTCCACATGCCAGAACTAAGG + Intronic
985924827 5:3007528-3007550 TGGTCACCATCTCAGAATGAGGG + Intergenic
987854854 5:23407536-23407558 TGCTCCCCATGTCAAAAGTAGGG + Intergenic
990244006 5:53844481-53844503 TAGTCACCCTGTCACAACTAAGG - Intergenic
992758387 5:79930515-79930537 GGGTGCCCAGGTCAGAACTGAGG + Intergenic
998822053 5:146066057-146066079 TTGTCCCCATTTCAGAGCCAAGG + Intronic
1000361445 5:160451434-160451456 TGAGCCCCATGCCAGAACAATGG - Intergenic
1003085673 6:3059144-3059166 TTTTCCCCATGTCAGCAATAAGG - Intergenic
1008686892 6:53935093-53935115 AGATCCCCCTTTCAGAACTAAGG - Intronic
1009521955 6:64694467-64694489 TGCTCCCCAGGTCAGACCGAGGG - Intronic
1009874476 6:69488705-69488727 TCATCCCCATTTTAGAACTAAGG + Intergenic
1011008535 6:82676516-82676538 TGGTACATATGTCACAACTAAGG - Intergenic
1013632721 6:112000843-112000865 TGATCTCCAAGTCAGAAATAGGG + Intergenic
1013722567 6:113048529-113048551 TGGTCCCAATGTCATCACAAGGG - Intergenic
1016257178 6:142121526-142121548 TTTTCCCCATGTCAGCAATAAGG - Intergenic
1016707468 6:147127660-147127682 TGATCCTCATATCAAAACTAGGG + Intergenic
1020127321 7:5540199-5540221 TGTCCCCCATATCAGAACCACGG - Intronic
1020467429 7:8496651-8496673 TGGGCCCCATCCCAGAACTCAGG + Intronic
1023523393 7:41071947-41071969 TGATCCCCATTTGAGAAGTATGG - Intergenic
1024071430 7:45788898-45788920 AGGTCCCCATGCCTGGACTATGG - Intergenic
1024619337 7:51144289-51144311 TGGTCCTCATTTCACAGCTAAGG + Intronic
1025909205 7:65813921-65813943 AGGTCCCCATGTCTGGGCTATGG - Intergenic
1025979775 7:66395838-66395860 AGGTCCCCATGTCTGGGCTATGG + Intronic
1026043762 7:66890430-66890452 AGGTCCCCATGTCTGGGCTATGG - Intergenic
1027164097 7:75822516-75822538 TTGTCCCCATGTCACCAGTAAGG + Intronic
1027204641 7:76088098-76088120 AGGTCCCCATGTCTGGGCTATGG + Intergenic
1027386851 7:77667303-77667325 TGATGCCTATGTCACAACTAAGG - Intergenic
1032048060 7:128626474-128626496 AGGTCCCCATGCCTGGACTATGG - Intergenic
1035922623 8:3694229-3694251 TGGACTCCATGACAGAGCTATGG - Intronic
1043737022 8:83761289-83761311 CGGTCCCCATGCCACAACTGTGG - Intergenic
1052122081 9:24730543-24730565 TGGGCCCCATGTCAGCACCCAGG + Intergenic
1054910958 9:70454837-70454859 TGTTCCCCATTTCTGAACTGGGG - Intergenic
1058906850 9:109488957-109488979 TAGTCATCATCTCAGAACTAGGG + Intronic
1061729565 9:132603289-132603311 TGGTCCCAATGTTATAGCTACGG - Intronic
1061892638 9:133630842-133630864 TGGACCCCATGTCATCACAAAGG - Intergenic
1062751673 9:138258908-138258930 AGGTCCCCATGCCTGGACTATGG - Intergenic
1203770026 EBV:45194-45216 TGGCCCCCATGTTTGGACTAAGG - Intergenic
1186569690 X:10701206-10701228 TGGTTGCGATGTAAGAACTAAGG - Intronic
1187736960 X:22314653-22314675 TGTTCCCCATTTGATAACTATGG + Intergenic
1190129443 X:47733506-47733528 TGGACCCTATGCCAGACCTACGG + Intergenic
1197422923 X:126260233-126260255 GGCTGCCTATGTCAGAACTAAGG + Intergenic
1200775156 Y:7164000-7164022 GGGTCCCCCTGCCAGAACTTGGG + Intergenic