ID: 1120031725

View in Genome Browser
Species Human (GRCh38)
Location 14:79649284-79649306
Sequence GAGGCACTTACCCCGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120031725_1120031729 28 Left 1120031725 14:79649284-79649306 CCAGGATCCGGGGTAAGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1120031729 14:79649335-79649357 AGCTCTTCTCCTGATGGAAGAGG 0: 1
1: 0
2: 1
3: 19
4: 199
1120031725_1120031728 22 Left 1120031725 14:79649284-79649306 CCAGGATCCGGGGTAAGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1120031728 14:79649329-79649351 AGCTAAAGCTCTTCTCCTGATGG 0: 1
1: 0
2: 4
3: 19
4: 151
1120031725_1120031730 29 Left 1120031725 14:79649284-79649306 CCAGGATCCGGGGTAAGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1120031730 14:79649336-79649358 GCTCTTCTCCTGATGGAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120031725 Original CRISPR GAGGCACTTACCCCGGATCC TGG (reversed) Intronic
902791015 1:18768023-18768045 GAGGCACTGCACCCGGCTCCAGG + Intergenic
914428648 1:147600326-147600348 GTGCCACTTACCCCGGAGGCAGG - Intronic
917702474 1:177595213-177595235 TAGGCACCTACCCAGGAGCCAGG + Intergenic
1065828985 10:29597328-29597350 GAGGCATTTACCCTTGATCCTGG - Intronic
1066957774 10:42189152-42189174 CAGGCACTTACTCCGGATATGGG + Intergenic
1072473309 10:95734212-95734234 GATGCACTTTCCCCAGATTCTGG + Intronic
1076886983 10:133267486-133267508 GAGGCAGGAACCTCGGATCCTGG - Intronic
1077350783 11:2092277-2092299 CAGGCACAGACCCCGGACCCTGG - Intergenic
1079598526 11:22284087-22284109 GAGGCATTTAACCACGATCCTGG - Intergenic
1081566608 11:44264624-44264646 GAGGCCCTGACCCCTGCTCCCGG - Exonic
1083807862 11:65085667-65085689 AAGGCTCTTACCCCAGATTCAGG - Intronic
1091408506 12:223903-223925 GAGGCAGATACCCTGGCTCCCGG - Intronic
1113849357 13:113409204-113409226 GCAGAACTTACCCCGGACCCAGG - Intergenic
1120031725 14:79649284-79649306 GAGGCACTTACCCCGGATCCTGG - Intronic
1126864033 15:52918221-52918243 GAAACACTTATCCCGGGTCCTGG - Intergenic
1128514368 15:68333240-68333262 CAGGCACTTACCACCGCTCCTGG + Intronic
1128570506 15:68730026-68730048 GAGGCACTTACCTCGGCCACAGG + Intergenic
1133282628 16:4675948-4675970 TAGGCCCTTGCCCTGGATCCTGG + Intronic
1141610827 16:85180261-85180283 GAGGCACCTGCCCCGGGCCCTGG - Intronic
1142012133 16:87720923-87720945 GAGGGACTTGACCCGGTTCCAGG - Intronic
1149612787 17:57969922-57969944 TAGGCACTTAACCCAGATCTTGG - Intergenic
1151322875 17:73361937-73361959 GAGGCCCCTACCCAGGGTCCCGG - Intronic
1154056249 18:11015291-11015313 GGGGCACTTCACCCAGATCCGGG + Intronic
1155897136 18:31343572-31343594 GTGGCACTTACCCTGGGTTCAGG - Exonic
1157475734 18:48022289-48022311 GAGCCACTAACCCCAGAGCCAGG - Intergenic
1159840459 18:73393249-73393271 GAGGCACTTATCCAGACTCCTGG - Intergenic
1160120245 18:76123688-76123710 CAGGCACTTACCTAGGGTCCAGG - Intergenic
1162118398 19:8445678-8445700 GAGGCACTTCCCGCGGAGCGCGG - Intronic
1165410100 19:35654660-35654682 GAGGCACATACCCAGGATGTGGG - Exonic
927701605 2:25272651-25272673 GAGGCACTTACCCCTGTGCGTGG - Intronic
929758633 2:44788147-44788169 GAGGCACTGACCCCACCTCCGGG - Intergenic
937601838 2:123746300-123746322 GAGGGACTGCCCCAGGATCCTGG + Intergenic
939038532 2:137161519-137161541 GACTCACTTACCCCTGTTCCTGG + Intronic
945511354 2:210706791-210706813 GAGGCACTTATCCGAGATCATGG + Intergenic
948429610 2:237911377-237911399 GAGGCAGTGGCCCTGGATCCAGG - Intronic
948834435 2:240619393-240619415 GAGACACTTCCTCCGGAGCCAGG - Intronic
1172301163 20:33851445-33851467 GGGGCACTTACCCCTGACCCGGG + Intronic
1180054608 21:45351353-45351375 GAGGCCCTTCCCCCCCATCCTGG - Intergenic
1184225870 22:43128614-43128636 AAGGCTCTTACCCAGGACCCGGG - Exonic
1185406623 22:50655896-50655918 GAGGCAATCACCACGGGTCCTGG + Intergenic
951303568 3:21028581-21028603 GAGGAATTTACCCCGTATGCAGG - Intergenic
953673522 3:44982303-44982325 CAGGCACCTACCCCTGGTCCTGG + Intronic
955055079 3:55447474-55447496 GAGGAACTTACTCAGGAGCCAGG + Intergenic
963919869 3:150895088-150895110 GAAGCACTTATCCCAGAGCCTGG - Intronic
973118579 4:46490113-46490135 TAGACACTTACTCCGGATACAGG + Intergenic
982766355 4:159353557-159353579 GAGGAACTTTCCCAGGATCAGGG + Exonic
982855202 4:160373479-160373501 GATGCACTTACCATGGATTCCGG + Intergenic
984984114 4:185310783-185310805 GAGGCCCTTCCCCCTCATCCAGG - Exonic
986337578 5:6766814-6766836 GAGGCTCTGGCCCCGGAGCCTGG + Intergenic
987251172 5:16102830-16102852 AAGGCACTTGCCCTGGCTCCTGG + Intronic
990144306 5:52741729-52741751 GAGGCACTTAATCCAGACCCGGG - Intergenic
993412423 5:87590750-87590772 TAGACACTTACTCCGGATCTGGG - Intergenic
997603393 5:135155779-135155801 GGGGCACTGACCTCAGATCCAGG + Intronic
1001398502 5:171433198-171433220 GTGGCACTTCCCCAGGATGCGGG - Intronic
1006094124 6:31645110-31645132 GAGGCACCTCCCCCTGGTCCTGG - Exonic
1008499124 6:52162872-52162894 GAAGCACTTACAACAGATCCTGG + Intergenic
1017987934 6:159460733-159460755 CAGGCTCTTACCCTGCATCCAGG - Intergenic
1018780963 6:167064985-167065007 TAGACACTTACCCTGGATACGGG - Intergenic
1019361657 7:608140-608162 GAGGCACCTACCCCAGAACACGG + Intronic
1026980047 7:74521108-74521130 GAGGCTGTTACCCCAGAGCCAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1033579136 7:142715787-142715809 GAGGAATTTCCCCCTGATCCTGG + Intergenic
1038350866 8:26775025-26775047 GAGGCACCCACCCCTGAACCAGG - Intronic
1038404791 8:27313499-27313521 GTGGCATTTAACCCTGATCCTGG + Intronic
1043508552 8:80926784-80926806 GTGGCATTTACCCTGGATCAGGG + Intergenic
1044868964 8:96599854-96599876 GAGGCACTGTGCCCGGCTCCTGG - Intronic
1050211589 9:3264544-3264566 AAGGCACTTAACCCAGAGCCTGG - Intronic
1053161052 9:35813674-35813696 GAGGCTCTTGTCCAGGATCCGGG + Exonic
1059744631 9:117188210-117188232 GAGGAAATCACCCCCGATCCTGG + Intronic
1060303441 9:122390127-122390149 CAGGAACTTACCCAGGCTCCAGG + Intronic
1060461921 9:123864471-123864493 GAGGCATTTACCCCGGGCCTCGG - Intronic
1061134907 9:128728326-128728348 GAAGCACTTAGCCCGGGGCCTGG + Intergenic
1191133898 X:57043452-57043474 TAGGCACTTACTCCAGATACGGG - Intergenic
1197825662 X:130587776-130587798 GAGGCCCTTAGACTGGATCCTGG + Intergenic
1198870680 X:141175216-141175238 GGTGCACTTGCCCAGGATCCGGG + Intergenic
1202255006 Y:22911841-22911863 GAGTCACTTAACCCGGATGTTGG - Intergenic
1202407997 Y:24545590-24545612 GAGTCACTTAACCCGGATGTTGG - Intergenic
1202462785 Y:25124491-25124513 GAGTCACTTAACCCGGATGTTGG + Intergenic