ID: 1120031888

View in Genome Browser
Species Human (GRCh38)
Location 14:79651050-79651072
Sequence AATCACGTGGTTCAATTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120031888 Original CRISPR AATCACGTGGTTCAATTAAC TGG Intronic
906699282 1:47846200-47846222 AATCAAGTTTTTTAATTAACTGG - Intronic
908416673 1:63919894-63919916 AATAAGGTGGTTCAACTATCCGG + Intronic
922399352 1:225236300-225236322 GAGCACGTTGTTCAATTTACAGG + Intronic
1077618722 11:3699256-3699278 ATTCACGGGGTTCATTTAGCTGG + Exonic
1078495952 11:11817312-11817334 AAACATGTAGTTCAATCAACAGG + Intergenic
1084408453 11:68992285-68992307 AATCACGTCGTTCCAGTAAATGG - Intergenic
1089119615 11:116124481-116124503 AATAATGTTGTTCAAATAACAGG - Intergenic
1093957610 12:25239267-25239289 AACCATTTGGTTCAAGTAACAGG - Intronic
1097906315 12:64922864-64922886 AATTAACTGGTACAATTAACTGG - Intergenic
1102022257 12:109691853-109691875 AATCACATGGTTCATTTTTCTGG - Intergenic
1104394693 12:128422462-128422484 AATCACACTGTTCAATTAAGTGG - Intronic
1104587729 12:130061087-130061109 AATCACTCGGTTCCATGAACAGG + Intergenic
1107500602 13:40970759-40970781 AAACATGTGGTTTAATTAAGGGG + Intronic
1111401406 13:87740939-87740961 AATCACGTGGTTCACAGAATGGG - Intergenic
1113401300 13:109996114-109996136 AATCACCTGTTGCAATGAACGGG - Intergenic
1120031888 14:79651050-79651072 AATCACGTGGTTCAATTAACTGG + Intronic
1120702671 14:87715023-87715045 ATTCACGTGGCTCCATTAAGGGG - Intergenic
1144487521 17:15679497-15679519 AATCACTTTGTTTAGTTAACAGG - Intronic
1146240685 17:31220835-31220857 AAAAACGTGGTACAATTTACTGG - Intronic
1148996811 17:51717347-51717369 AATCACATGGTTCATTTTCCTGG - Intronic
1149473465 17:56939206-56939228 ATTTACGTGGCTGAATTAACCGG - Intronic
1150599886 17:66641634-66641656 AATCAAGTAGTTCAATAACCTGG - Intronic
1153369339 18:4296446-4296468 AAGCACGTGGTTCATTTGAGTGG - Intronic
1155083181 18:22430468-22430490 AAACACGTGGTGCAAATAACTGG - Intergenic
1163952644 19:20604567-20604589 AATCACAAGGTTCAACTAACTGG + Intronic
1166063053 19:40339169-40339191 AATCTCTTGGTTAAATTCACAGG - Intronic
930083722 2:47477010-47477032 AAAAACGTGGTTCAAGTTACAGG - Intronic
931787805 2:65636711-65636733 AAGAACGTGGTTTAAGTAACAGG + Intergenic
938577219 2:132615959-132615981 AATCACTTGCTTAAAATAACTGG - Intronic
943216199 2:185039417-185039439 AATTACCTGGTGCAATTACCTGG - Intergenic
943745240 2:191455365-191455387 AATCATGTGATACAATTACCAGG - Intergenic
1184292688 22:43506504-43506526 ACCCACTTGGTTCAATTAAGAGG - Exonic
952465061 3:33575213-33575235 AATCAAGTGGCTGAAGTAACGGG + Intronic
962413136 3:135158977-135158999 AATCAATTTGTTCAAATAACTGG + Intronic
969502572 4:7562112-7562134 AATCGAGAAGTTCAATTAACTGG - Intronic
971749401 4:30626979-30627001 AATCACCTGGTTCAGGTATCTGG - Intergenic
974851961 4:67414405-67414427 AATCACGTGGTTTTTGTAACAGG + Intergenic
975810460 4:78163433-78163455 AATTAGGTAATTCAATTAACTGG - Intronic
977483702 4:97614224-97614246 AATGACATGGTTAAATTCACAGG - Intronic
991361467 5:65825357-65825379 AATCCCCTGGATCAATTACCAGG - Exonic
996102764 5:119461472-119461494 AAACACGTGGTTCTATTTTCAGG + Intronic
996833904 5:127770066-127770088 AATAAATTGGTTCATTTAACTGG - Intergenic
997581595 5:135020548-135020570 AAACCCTTGGTTCAATTAAATGG + Intergenic
1013041778 6:106441574-106441596 AATGAATTAGTTCAATTAACTGG - Intergenic
1013891197 6:115029633-115029655 ATTCACTGGGTTCAATTAAGTGG + Intergenic
1014866892 6:126543406-126543428 AATCAAGTGGTTCTGTTAGCAGG - Intergenic
1019386616 7:760401-760423 AATCACGTGTTTAAATTACATGG + Intronic
1022467018 7:30658805-30658827 AATCAGGTGGTTGAATTTGCAGG - Intronic
1027127611 7:75568178-75568200 AAGTAAGTGGTTCAAGTAACAGG - Exonic
1034888805 7:154820949-154820971 AATTAGTTGGTTCAGTTAACAGG - Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037266553 8:17068584-17068606 AATCAAGTGATTCAAATCACAGG - Intronic
1039771945 8:40696056-40696078 AATCAGGAGTTTCAATTGACTGG + Intronic
1039933248 8:42014447-42014469 AAAAATGTGGTTCATTTAACTGG - Intronic
1041441401 8:57900929-57900951 AAACAGGTTGTGCAATTAACCGG + Intergenic
1041904726 8:63019926-63019948 TTTGACGTGGTTCAATTCACAGG + Intronic
1043979395 8:86620535-86620557 AATCACCTGTTTCAGTAAACAGG + Intronic
1051271570 9:15360254-15360276 ATTCACGTGGTTCAAAAACCAGG + Intergenic
1196624902 X:117867312-117867334 AATCTCATGGTTCAATAAAGTGG + Intergenic
1199545061 X:148999789-148999811 AATATCATGGTTCAATTAAACGG + Exonic
1201664799 Y:16438799-16438821 AAACACTTGGTTCAATTACATGG - Intergenic