ID: 1120032414

View in Genome Browser
Species Human (GRCh38)
Location 14:79657220-79657242
Sequence GGGACCTGCTCAAGATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 1, 2: 20, 3: 96, 4: 504}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120032413_1120032414 -9 Left 1120032413 14:79657206-79657228 CCATGGATAGTTGAGGGACCTGC 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG 0: 1
1: 1
2: 20
3: 96
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120032414 Original CRISPR GGGACCTGCTCAAGATCACA TGG Intronic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901629573 1:10641592-10641614 GGGACCTGCCCAGGTTCAGAGGG - Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
901878333 1:12179675-12179697 GGGAGCAGGACAAGATCACAGGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902554770 1:17240441-17240463 GCAACCTGCTCAAGTGCACAAGG - Intronic
902671669 1:17978857-17978879 ATTACCTGCTCAAGGTCACATGG - Intergenic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903496240 1:23769514-23769536 GTGACATGCTCAAGTCCACATGG - Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903739531 1:25550677-25550699 GGGACCTGTGCAAGGTAACATGG - Intronic
903755105 1:25655176-25655198 AGGACTTTCCCAAGATCACACGG - Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904753573 1:32755500-32755522 GGAATCTGCTCAAGGTCACCAGG - Intronic
904767881 1:32864337-32864359 AGCACCTGCCCAAGGTCACAAGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905772639 1:40648246-40648268 AGGACCTGCTCAGGATCACATGG - Intronic
905835463 1:41116410-41116432 GGAGCTTGCTCAAGATCACGTGG - Intronic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
907195636 1:52684341-52684363 GGGAGCTGCACCAGTTCACAGGG + Intergenic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907329043 1:53659496-53659518 AGGACTTCCTCAAGGTCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
912433022 1:109639569-109639591 GGGCTCTGCTCAAGTGCACATGG - Intergenic
912570053 1:110614812-110614834 AGGACCTGCTCAAGGTTGCATGG + Intronic
912713028 1:111963034-111963056 GTGGCCTGCTCAAGATCTCCTGG - Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915605471 1:156947643-156947665 TGGACCTGCTCCAGCACACAGGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
917808883 1:178638429-178638451 AGGACATGCTCAAGACAACAAGG - Intergenic
919340445 1:196300221-196300243 GGGAGCTCCTCAAGATGGCAAGG + Intronic
923221409 1:231897650-231897672 GTGACCAGCTCAAAATCAGATGG - Intronic
1063628992 10:7716915-7716937 AGGACCTGCTCAAGACCCCATGG - Intronic
1064084510 10:12335144-12335166 AGAACTTGCCCAAGATCACAAGG - Intergenic
1064186751 10:13168465-13168487 GGGGCTTGTTCAGGATCACATGG - Intronic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1066634891 10:37490594-37490616 AGAACTTGCCCAAGATCACATGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1070179284 10:73998528-73998550 AGGACTCGCTCAAGGTCACAGGG - Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070720807 10:78755652-78755674 GGGACTTGCTGAAGACCGCATGG - Intergenic
1072189243 10:93066855-93066877 GGGAACTGCCCAAGGTCATACGG - Intronic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074183323 10:111081707-111081729 GCGACTTGCTCAGGATCCCAAGG + Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075050266 10:119178444-119178466 GGCGCTTGCCCAAGATCACAGGG + Intronic
1075837412 10:125466564-125466586 GGAATCTGCTCAAGGTCACATGG + Intergenic
1076391945 10:130110137-130110159 GAGACTTGCACAAGATCCCAGGG - Intergenic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077117446 11:891545-891567 GGGACCAGCTCAGGAGCCCAGGG - Intronic
1077913647 11:6596397-6596419 GAGGCCTGGGCAAGATCACACGG + Exonic
1078661005 11:13285497-13285519 GGTACCTTATCTAGATCACAGGG + Intronic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079129490 11:17738961-17738983 GGGACCTGCCCAAGGGCACTCGG + Intronic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1080008465 11:27433855-27433877 GGGACTTGCTTCAGGTCACATGG - Intronic
1080821971 11:35816030-35816052 GGGACCTGGCCTAGTTCACAAGG + Exonic
1080928520 11:36783625-36783647 GGAACCTGCTCAGTATCAGATGG - Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082140868 11:48607570-48607592 GGCAACTGCTGAAGAACACAAGG - Intergenic
1082568039 11:54704345-54704367 GGCAACTGCTGAAGAACACAAGG - Intergenic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083622016 11:64053829-64053851 GGGGAGTGCTCAAGGTCACATGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083870759 11:65487066-65487088 GTGACCTGCTGAAGGTCCCAGGG + Intergenic
1084773523 11:71359746-71359768 GGGGCCTCCTCAAAGTCACATGG - Intergenic
1084901236 11:72311492-72311514 GTGACCTGCTTAAGGTTACAGGG + Intronic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1086262478 11:84957160-84957182 AGTACCTGCCCAAGATCACATGG + Intronic
1087118271 11:94545677-94545699 GGGACCGGCCCAAGAGCATACGG + Exonic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1089529585 11:119117828-119117850 GTTGCCTGCTCAAGATCACTTGG - Exonic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1089614634 11:119688358-119688380 GGGGTCTGCTCAGGATCACAGGG - Intronic
1089656360 11:119949814-119949836 GACATCTGCTGAAGATCACATGG + Intergenic
1089679754 11:120112629-120112651 GGGACCAGCCCCTGATCACAGGG - Intronic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089729328 11:120510979-120511001 GGGACCAGGCCAAGAACACACGG - Intergenic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1091311143 11:134576087-134576109 AGGACCTGCTTAAGGTCTCATGG - Intergenic
1091402690 12:190197-190219 GGGACTTTTTCAAGTTCACATGG - Exonic
1091566063 12:1649070-1649092 GGGACCTGCTCAGGATCTGGAGG - Intergenic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092225474 12:6745531-6745553 GGGAGCTGTTCAAGATCAGTAGG + Intergenic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092765736 12:11851041-11851063 GGGACTTGTTCAAGGTCACCTGG + Intronic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1095274374 12:40262860-40262882 GGGACTTGCCCCAGACCACACGG + Intronic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1098595474 12:72270061-72270083 GTGACCTGCTGAGGATCGCAGGG + Intronic
1098649047 12:72941307-72941329 TGGACCTGCTCTGGACCACAGGG - Intergenic
1098870239 12:75809280-75809302 GAGTCTTGCTCAAGACCACATGG + Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100773997 12:97954702-97954724 AGGATATGCTCAAGATCACATGG - Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101116028 12:101532136-101532158 GGTACTTGCTCAAGATCATATGG - Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101309513 12:103563715-103563737 AGGACCTGCTGGAGAGCACATGG + Intergenic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101649404 12:106661131-106661153 AGGACCTGCCCATCATCACATGG - Intronic
1101919457 12:108920435-108920457 GGGACTAGCCCAAGACCACATGG - Intronic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102396484 12:112590383-112590405 AGGACCTGCTCAAGGTCACTGGG - Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1102980562 12:117237734-117237756 GTGAACTGCTCAAGGTAACAAGG + Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103340230 12:120217011-120217033 GGGTCCTGCTCAAGGTGGCAGGG + Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104201487 12:126593933-126593955 GGGATATGCTCAAGGTCACCAGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104360921 12:128132509-128132531 GTGGCCTGTCCAAGATCACACGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105547072 13:21358727-21358749 TGGATCTGCACAAGAGCACAAGG - Intergenic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1107457791 13:40570904-40570926 GACACCAGCTCCAGATCACAAGG + Intronic
1109168739 13:59069485-59069507 GTGGCCTGCTCCAAATCACAAGG + Intergenic
1109573532 13:64223732-64223754 GGCACTTGCTCAAGATCAGGAGG + Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1110910160 13:80950376-80950398 CAGACCTGCAGAAGATCACAAGG + Intergenic
1111364482 13:87223805-87223827 GGTTCCTGCCCAAGCTCACAGGG - Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115040059 14:28913191-28913213 GGGACATGATCTAGCTCACAGGG - Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1118387422 14:65267777-65267799 AGGGCCTGCTCAAGGGCACATGG + Intergenic
1118920919 14:70149380-70149402 GGGTCTTGCTCCAGATCACTTGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1119750746 14:77075726-77075748 GGGAACTTCTGAAGAACACAGGG + Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120142310 14:80942275-80942297 GGGACTTGCCTAAGATCATATGG + Intronic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121346924 14:93143116-93143138 GGAACCTGCCCGAGGTCACAGGG - Intergenic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121641723 14:95489096-95489118 GGGACCTGCTCCAATTCTCAGGG + Intergenic
1121861698 14:97324754-97324776 AGGACCTGCTAAAGGTCACATGG - Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1122261330 14:100524758-100524780 CGGATTTGCTCAAGGTCACAGGG - Intronic
1124494270 15:30176815-30176837 GCAACCTGCTCAAGTTCCCATGG - Intergenic
1124749300 15:32361830-32361852 GCAACCTGCTCAAGTTCCCATGG + Intergenic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1125496356 15:40198154-40198176 AGGACCTACTCTAGATTACATGG + Intronic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1127969208 15:63945681-63945703 GTGGCCTGCTTAAGCTCACATGG - Intronic
1128232610 15:66046163-66046185 GGGACCTGCTCCAGTTCACATGG + Intronic
1129199364 15:73989732-73989754 GAAACCTGTTCAAGGTCACATGG + Intronic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1129682669 15:77666639-77666661 GTTAGCTGCTCCAGATCACAAGG - Intronic
1129685870 15:77685932-77685954 GGGACCTGCTCAGGATCGTGGGG - Intronic
1129960825 15:79682374-79682396 GGGCCCTGCTGCAGAGCACATGG + Intergenic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134492888 16:14709088-14709110 GGGAACTGCTCAAGGGCACCAGG - Intronic
1134498269 16:14748210-14748232 GGGAACTGCTCAAGGGCACCAGG - Intronic
1134582305 16:15380881-15380903 GGGAACTGCTCAAGGGCACCAGG + Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134796333 16:17040285-17040307 GGAACATGCTCAGGGTCACAAGG - Intergenic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135313626 16:21424932-21424954 GGGAACTGCTCAAGGGCACCAGG + Intronic
1135366550 16:21857212-21857234 GGGAACTGCTCAAGGGCACCAGG + Intronic
1135445265 16:22513946-22513968 GGGAACTGCTCAAGGGCACCAGG - Intronic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136152768 16:28362656-28362678 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136193982 16:28638506-28638528 GGGAACTGCTCAAGGGCACCAGG - Intronic
1136210315 16:28752617-28752639 GGGAACTGCTCAAGGGCACCAGG - Intronic
1136310288 16:29403636-29403658 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136323737 16:29505426-29505448 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136397677 16:30001892-30001914 GAGACCTGCTCAAGGCCACGTGG - Intronic
1136438422 16:30245407-30245429 GGGAACTGCTCAAGGGCACCAGG + Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137571144 16:49567140-49567162 GAGACTTGCCAAAGATCACAAGG + Intronic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137624991 16:49901920-49901942 GGGACATGACCCAGATCACAGGG + Intergenic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139003717 16:62545432-62545454 TGGACATGTTCAAGATCACCTGG + Intergenic
1139214424 16:65113383-65113405 AGGACTTGCCCAAGATCCCACGG - Intronic
1139857970 16:69996022-69996044 GGGAACTGCTCAAGGGCACCAGG + Intergenic
1140378308 16:74463268-74463290 GTGACCTGCTCAAACTCCCAGGG - Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140662955 16:77205636-77205658 GGGATGTGCTCAACATCACGTGG - Intronic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140913947 16:79478351-79478373 GGAAGCTGCTCAAGGTCAAATGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141374869 16:83521417-83521439 GGAACCTGCTAAAGGTCACCTGG - Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141978293 16:87532971-87532993 TGGACCTGCCCAAGATCACTCGG - Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1141998535 16:87649758-87649780 GGGACCTGCTCAGAACCCCAGGG + Intronic
1142119928 16:88382254-88382276 GGAACCTGCCCAAGGCCACACGG - Intergenic
1142127925 16:88419425-88419447 AGAACCTGCCCAAGGTCACATGG - Intergenic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142480288 17:214807-214829 GGGGTCTGCTCAAGGTCACATGG + Intronic
1143278549 17:5732607-5732629 GGGACTTGCTCAAGATTTGAGGG + Intergenic
1143623215 17:8093035-8093057 GGGACTTGCTCAAGATCAGCTGG + Intergenic
1143849881 17:9802884-9802906 GCAACCAGCTCAAGGTCACATGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1147217853 17:38911388-38911410 GGGACCTGCCCAAGGTCATCTGG - Intronic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149276980 17:55052256-55052278 AGGACGTGCTCAAAATGACAGGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1152021731 17:77783194-77783216 GGGAGCTGCCCAAGATGACTGGG - Intergenic
1152265666 17:79293225-79293247 GTGACCTGCTCAAGCCCACATGG + Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1154119420 18:11639299-11639321 GGGAACTGCTCAAGGGCACCAGG + Intergenic
1156168999 18:34459143-34459165 GGAATCTGCTGAAGATTACATGG - Intergenic
1156370861 18:36470124-36470146 AGGACCTGCTCCAGAGGACAAGG - Intronic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1157298218 18:46461183-46461205 GGGACTTGCTCAAGGTCATTGGG - Exonic
1157643053 18:49237146-49237168 GGTAACTTCCCAAGATCACACGG + Intronic
1157740958 18:50092384-50092406 GGGACAGGCCCAAGGTCACATGG + Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158876539 18:61739495-61739517 GGGATGTGCTCAAAGTCACACGG - Intergenic
1159441722 18:68489016-68489038 AGGACCTGCTAAAAATCACCTGG + Intergenic
1159884147 18:73888237-73888259 GGGACTTGCCAAACATCACAAGG - Intergenic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160308083 18:77759891-77759913 CAGAGCTGCTCAACATCACATGG + Intergenic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1160587754 18:79922088-79922110 GGGGCATGATCAAGAACACATGG - Intronic
1161322010 19:3645705-3645727 GGTGCCTGCTCAAGGCCACATGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161850639 19:6736492-6736514 GGGACTTGTACAAGATCACATGG + Intronic
1161952567 19:7475981-7476003 GGGGACTGCTCAGGGTCACACGG - Intergenic
1163703047 19:18796035-18796057 GGCACCTGCCAAAGGTCACACGG - Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164836671 19:31359424-31359446 GTGACCTGCTCAGGCTCACTGGG - Intergenic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166608939 19:44171596-44171618 GGAACGTGCTCAAGTTCACATGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
925169449 2:1742074-1742096 GGGACTTGCTAAAAATCACGCGG + Intronic
925556811 2:5140076-5140098 AGGACCTGCCTAAGAGCACAAGG - Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926383070 2:12310369-12310391 CTGACATGCACAAGATCACATGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927177741 2:20422254-20422276 GGGACCTGCTCAGGCTCGCCTGG + Intergenic
927431301 2:23028385-23028407 GGGGCCTGCGCCAGATCAAAGGG + Intergenic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928113822 2:28530980-28531002 GTGACCTGTGCAAGTTCACACGG + Intronic
928279826 2:29935854-29935876 GAGACCTGCTCAACATCATCAGG - Intergenic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
928611180 2:32993809-32993831 GGAACCAGCTCAGGGTCACATGG + Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931919380 2:66996607-66996629 GTGACATGGCCAAGATCACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933773842 2:85760018-85760040 TGGACCTGCCTAAGGTCACATGG + Intronic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
937379645 2:121365172-121365194 TGGAGCTGCTCAAGATCACGCGG - Exonic
937806168 2:126148181-126148203 AGGAACTGCCCAAGATCAAAAGG + Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939498227 2:142949137-142949159 TGGAGCTGCCCAAGACCACATGG - Intronic
939517325 2:143185435-143185457 GGGACCAGGTCATAATCACATGG + Intronic
939919688 2:148094045-148094067 GAGACATGCCCATGATCACATGG + Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
941653731 2:168121219-168121241 AGGACCTGCCCAAAGTCACATGG - Intronic
943537038 2:189165652-189165674 GGAACTTGTTCAAGGTCACAAGG + Intronic
944483745 2:200182169-200182191 GGGAGCTCCCCAAGAGCACAGGG - Intergenic
945109784 2:206351163-206351185 GTTACCTTCTCAAGATCATAGGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945503459 2:210607673-210607695 GTGATGTGCTCAAAATCACACGG - Intronic
945922213 2:215766595-215766617 GTGATCTGCTCAAGATCTCTTGG - Intergenic
945959073 2:216113451-216113473 GGGACTTGTTCAACATCAGAAGG - Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
1168891431 20:1297373-1297395 ATGATCTGCTCAAGGTCACACGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1170485694 20:16813652-16813674 GAGAACTGCTCAAGATCCAACGG - Intergenic
1170486422 20:16821090-16821112 GGGATTTGTTCAAGGTCACATGG + Intergenic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172391215 20:34566692-34566714 GGGCCCTGCAAAAGGTCACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172770852 20:37381868-37381890 GAGACCTGCTGAAGAGCTCAAGG - Intronic
1172822881 20:37753973-37753995 GGGGCTTGCACAAGATTACATGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179579456 21:42331639-42331661 GGCAGCTGCTCAAGAACCCAAGG + Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1179894128 21:44351857-44351879 GGAACCTGCACAAGACCCCAGGG + Intronic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181601127 22:23952430-23952452 GGGACTTGCACAAGGCCACAGGG + Intergenic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1181935546 22:26435870-26435892 GTGACCTGCTCAAAGTCTCACGG - Intronic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182554548 22:31122270-31122292 GGAACTTGCTCAAGGTCACCTGG - Intergenic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183520896 22:38295478-38295500 GGGGCCTGCTCATGGGCACAGGG + Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183604328 22:38859915-38859937 GGCAGGTGCTCAAGATGACAAGG + Intergenic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
1184558486 22:45247120-45247142 GAGTCATGCTCAAAATCACACGG + Intergenic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
1185150037 22:49159137-49159159 GGGACCAGCTCAGGATCTCGGGG + Intergenic
1185150058 22:49159196-49159218 GGGAGCAGCTCAGGATCTCAGGG + Intergenic
1185262961 22:49880407-49880429 GGGACATGCTCGAGACCACCGGG + Intronic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949197112 3:1324843-1324865 GTAACCTGTTCAAGATGACATGG - Intronic
949448508 3:4161705-4161727 TGGACCTGCCCTAGATCAGAGGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950191114 3:10976801-10976823 GGGATTTGTTCAAGGTCACATGG - Intergenic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
951012919 3:17701266-17701288 GGGACCTGAACGAGATCACTTGG + Intronic
952108224 3:30093055-30093077 GGAACATGCTTAAGAACACACGG + Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953363422 3:42321497-42321519 AGGATCTGCTCAAGCACACATGG - Intergenic
953574432 3:44101636-44101658 GGGACCTTCTCAGGATCAGAGGG + Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
954441175 3:50522971-50522993 GGGGCCTGCTCAAGTTGAGATGG + Intergenic
955187696 3:56730925-56730947 GGTACTTGCCCAAGATCAAAGGG - Intronic
957699195 3:83687301-83687323 TGGACATGCTCTAGATCAGAGGG - Intergenic
959085465 3:101847901-101847923 GCCACCAGCTCCAGATCACAAGG - Intronic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
962286764 3:134092930-134092952 GGGGGCTTCCCAAGATCACACGG + Intronic
963371254 3:144403399-144403421 GAGACCTGCCCTAGATCTCAGGG + Intergenic
964014637 3:151929985-151930007 GGGTCCTGTTCAAGGTAACATGG - Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966060986 3:175755302-175755324 GCGACCTGCTAATGATCCCAAGG + Exonic
966738827 3:183212803-183212825 GGGACCTGCTCAAGCTGGAAAGG - Intronic
967317439 3:188162626-188162648 AGAACTTGTTCAAGATCACAGGG - Intronic
967674806 3:192284270-192284292 GTGACATGCTGATGATCACAGGG + Intronic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
969161815 4:5266736-5266758 GGGAATTGCTAAAGATCACCAGG - Intronic
969213575 4:5706805-5706827 GGGACGTGCTCAAGATGCCAAGG + Intronic
969427686 4:7135303-7135325 GGGACTTGTTCAAGCTCACATGG - Intergenic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
971374586 4:26046640-26046662 GGGAACTGGCCAAGAACACAGGG + Intergenic
971748724 4:30618874-30618896 GGGATTTGCTCAAGGTTACATGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972287219 4:37660711-37660733 TGCACTTGCTCAAGGTCACATGG + Intronic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
975469342 4:74747315-74747337 GGCACCTGCTGAAGATCCGAAGG + Intronic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
977640013 4:99346893-99346915 AGGACTTGCACAAGGTCACAGGG - Intronic
978680275 4:111372392-111372414 AGCACTTGCTTAAGATCACATGG + Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982986662 4:162217317-162217339 GGGGAGCGCTCAAGATCACAAGG + Intergenic
983104690 4:163672116-163672138 AATACATGCTCAAGATCACATGG - Intronic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
983799825 4:171913294-171913316 TGGACCTGATCAAGACAACATGG + Intronic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985129580 4:186726463-186726485 GGGACATGCTGAAGATCCCGGGG - Intronic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
986679187 5:10218002-10218024 GTGACCTGCACCAGTTCACATGG - Intergenic
987131806 5:14867304-14867326 GGTACTTGTTCAAGATGACACGG - Intronic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990488120 5:56278918-56278940 GAGACCTCCTGAAGGTCACATGG - Intergenic
995138586 5:108707090-108707112 TGAACGTGCTCAAGGTCACAGGG - Intergenic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996788055 5:127262353-127262375 GGGACTTGCACAAGATTAAAGGG - Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997623880 5:135318767-135318789 GGGACCTGCCCAAGTTCATATGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
997690242 5:135823245-135823267 GGGGCTTGCTCAGGATCAAAGGG + Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
997815121 5:137009769-137009791 TAGACCTGCCCAAGGTCACAGGG - Intronic
998164206 5:139833269-139833291 GTGACATGCCCACGATCACAAGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999267052 5:150273267-150273289 CAGAGCTGCTCAAGCTCACAGGG + Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1000036191 5:157449926-157449948 GCAAACTGCTCAAGGTCACAAGG + Intronic
1000815230 5:165912907-165912929 GGAACTTGCTCAAGGTCAAAGGG - Intergenic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001007407 5:168065384-168065406 GGGACGTGCTCAAGGTCCCCTGG - Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001694680 5:173661128-173661150 GCGACTTGCTCAAGATCATGTGG + Intergenic
1001798497 5:174522883-174522905 TGGACCAGCCCAAGGTCACATGG + Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002069293 5:176669909-176669931 GTGGCCTGCTGAATATCACATGG + Intergenic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1004087989 6:12470849-12470871 GGGATTTGCTCAGGATCACTCGG - Intergenic
1005918824 6:30380216-30380238 GGGAACTCCTCAAGACCCCAAGG + Intergenic
1006314571 6:33282660-33282682 GGGATGGGCTGAAGATCACAAGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006574128 6:35031509-35031531 GGGTTCTGGTCAAGAGCACAAGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007307193 6:40916308-40916330 GGGACCTGCTGCTGGTCACACGG - Intergenic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1009763757 6:68040920-68040942 GGCACCTCCTCTGGATCACAAGG + Intergenic
1010300051 6:74249509-74249531 GGGACTGGCTCAAGTTCACATGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1013281746 6:108644194-108644216 GAAACCTGCCCAAGACCACATGG - Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022702089 7:32771146-32771168 GGGAACTGCTCAAGTTCATGGGG - Intergenic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032695802 7:134335069-134335091 AGAACCTGCTCATTATCACAAGG - Intergenic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034540547 7:151755332-151755354 GGGACATGCTCAGCATCTCAGGG + Intronic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1035648850 8:1248841-1248863 GGGACCTGCACACGGTCACCAGG + Intergenic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1036547414 8:9785285-9785307 AGGAACTTCTCAAGGTCACATGG - Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038394957 8:27239881-27239903 GGGACCTGCTGATCATCTCAGGG - Intronic
1040906308 8:52472816-52472838 AGAACTTGCTCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1042545362 8:69946571-69946593 AGAGCCTGCTCAAGGTCACATGG - Intergenic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046644029 8:116765752-116765774 GGGAGTTGCCCAAGATCAAACGG + Intronic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1047730662 8:127725299-127725321 GGGACTTGCTTAAACTCACACGG - Intergenic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048155310 8:131942467-131942489 GGGACTTGCCCAAGATCATCTGG - Intronic
1048255735 8:132903789-132903811 GGGACCAGCCCAAGGTCACCTGG - Intronic
1048358700 8:133675690-133675712 GGGACCTGGCCAAGAGCACGTGG - Intergenic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048871334 8:138801900-138801922 GAAACCTGCCCAAGGTCACACGG + Intronic
1048887269 8:138918454-138918476 AGGACCTGTGCTAGATCACAAGG - Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1050442192 9:5676532-5676554 GTAACCTGCTCAAGAATACATGG + Intronic
1051780797 9:20686435-20686457 TGGACCTGATCAAGATTGCAAGG + Intronic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1052220074 9:26010107-26010129 GTTACCTGCTCAAAATCAAAGGG - Intergenic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1055511897 9:77003343-77003365 GGTGCCAGCTCAAGCTCACATGG + Intergenic
1055892905 9:81142176-81142198 GGGAGCTGCTAATGAACACAGGG + Intergenic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056236060 9:84595860-84595882 TGGACTTGCTCAAGATAACATGG - Intergenic
1056391554 9:86145969-86145991 GGGAGCTGCTGAAGAACAGAAGG + Intergenic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1056886515 9:90448689-90448711 GGGAGCTGCTCATGACCACTGGG - Intergenic
1057691781 9:97292340-97292362 GTGACCTTCCCAAGACCACATGG - Intergenic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059659389 9:116386547-116386569 GGGACTTGCCCAAGTTCACTTGG + Intronic
1059717161 9:116923934-116923956 GGGCCCTGCTCCACAGCACATGG - Intronic
1059963366 9:119589364-119589386 GGGATCTACTCAAGGTTACAGGG - Intergenic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061211392 9:129195431-129195453 GGCACTTGCTCAGGGTCACACGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061818237 9:133208594-133208616 TTGGCCTGCTCCAGATCACAGGG - Exonic
1062021835 9:134323231-134323253 GTGACCAGCTCAGGACCACAGGG + Intronic
1062197322 9:135281519-135281541 GGGACCTGCTCAGGGACACCAGG - Intergenic
1062242219 9:135546764-135546786 TTGGCCTGCTCCAGATCACAGGG + Exonic
1186546343 X:10453841-10453863 GGTATATGCTGAAGATCACAGGG - Intronic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188789059 X:34386023-34386045 TGGACCTGATTAAGATGACAAGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189462553 X:41253965-41253987 GAGATCTGTTCAAGGTCACAGGG + Intergenic
1191668977 X:63731516-63731538 GGGACCTGTCCAAGATCATTTGG - Intronic
1191707444 X:64108930-64108952 GGGAACTGAACAAGAACACATGG - Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1195086531 X:101418641-101418663 GGGACCGGCCCGAGATCACTCGG - Intronic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1198264492 X:134996782-134996804 GGGAACTGCTAAAAATCACCGGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199297280 X:146173542-146173564 GGAACCTGCTCAAGGCCACTAGG - Intergenic
1199393645 X:147309440-147309462 GGGTCCTGATCAAGACCCCAAGG - Intergenic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1200248865 X:154541707-154541729 GGGATCTGCCCAAGGACACAAGG + Intronic