ID: 1120033449

View in Genome Browser
Species Human (GRCh38)
Location 14:79668689-79668711
Sequence CTGTTGGTGTGTAAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120033443_1120033449 9 Left 1120033443 14:79668657-79668679 CCTATTGACATTTGGGGCTGGAC 0: 1
1: 3
2: 10
3: 39
4: 124
Right 1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120033449 Original CRISPR CTGTTGGTGTGTAAGGAAGG GGG Intronic
900143566 1:1148604-1148626 CTGATGGTGTGGAAGGAATGAGG + Intergenic
901081729 1:6587556-6587578 CTGTTTGTGTGTGAGGAGTGTGG + Exonic
901453057 1:9347874-9347896 CTGTGGGTGTGTGTTGAAGGGGG - Intronic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
901973053 1:12923160-12923182 CTGTTGGGGGGTAGGGATGGTGG + Intronic
902012128 1:13278603-13278625 CTGTTGGGGGGTAGGGATGGTGG - Intergenic
902547650 1:17199917-17199939 GTGTTGGTGGGTAAGGAGAGGGG - Intergenic
903171821 1:21559020-21559042 CAGTGCGTGTGTGAGGAAGGAGG + Intronic
904047237 1:27616014-27616036 ATGTTGGTGCCCAAGGAAGGGGG + Intronic
904812945 1:33175589-33175611 CAGTTGGCGTGTTGGGAAGGAGG + Intronic
906417144 1:45629249-45629271 CTCTTGGTCTTTAAGGAAGCAGG - Intronic
906861470 1:49364854-49364876 CAGATGGTGAGTAATGAAGGAGG + Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
908445133 1:64192415-64192437 CTGGTGGAGTGTAAGGGAAGTGG + Intergenic
908943328 1:69463477-69463499 CTGTTGGTGGGTAGGGTTGGGGG - Intergenic
909996841 1:82290290-82290312 CTGTAGGTGTGTCAGTGAGGAGG - Intergenic
911170362 1:94764934-94764956 CTGTCTGTGTGTGAGGGAGGTGG - Intergenic
912795960 1:112693851-112693873 CTGCTGGTATGAAAGGAAAGAGG + Intronic
912854397 1:113154218-113154240 CTGTAGGAGGGAAAGGAAGGAGG + Intergenic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
914863560 1:151406387-151406409 TTGTTAGTGGGGAAGGAAGGAGG + Exonic
917723600 1:177809602-177809624 CTGATGGTGAGTAAGGGAGAAGG - Intergenic
919125917 1:193393730-193393752 CTGCTGGAGTGAAAGGGAGGAGG + Intergenic
921455825 1:215370343-215370365 CTGTTGGGGTGTGAGCAGGGGGG - Intergenic
923274217 1:232382926-232382948 CAGTGGGTGTGTGAGGAGGGAGG + Intergenic
1063830819 10:9950609-9950631 CTGTTGGTGGGTAGGGTTGGGGG - Intergenic
1066471123 10:35699291-35699313 CTGTTGGAGGGCAAGGCAGGAGG - Intergenic
1066507922 10:36064926-36064948 ATGTTTGTGTGTAAGGGAGAAGG - Intergenic
1068776194 10:60870970-60870992 CTTTTGTTGTGAAAGGAAGGAGG - Exonic
1069960564 10:72076660-72076682 CTGTAGGAGTCTAAGGCAGGAGG - Intronic
1071334499 10:84589864-84589886 CTGTGCGGGTGTAGGGAAGGTGG + Intergenic
1071458634 10:85870632-85870654 GTGGTGCTGTGGAAGGAAGGTGG + Intronic
1074685713 10:115960752-115960774 CTGTGTGTGTGTGAGGGAGGAGG - Intergenic
1076474662 10:130743808-130743830 CTGTTGGTGTCTGGGGAAGCTGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1078263238 11:9731701-9731723 CTGTTTGTGTGAAAAGAAGGTGG + Intronic
1081569136 11:44278781-44278803 CTGCTGGTGAGCAAGGGAGGAGG - Intronic
1081903249 11:46647852-46647874 CTTTTGGAGTGTGAGGCAGGAGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1084706355 11:70818351-70818373 CTGTTCATGTGTGAGGAACGGGG - Intronic
1085011069 11:73142122-73142144 CCGGGGGTGTGTGAGGAAGGAGG + Exonic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1085849375 11:80101888-80101910 ATGTTGATGTGTAAGGTGGGAGG - Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1087079315 11:94154579-94154601 CTGATGGTGTGTCTGGAAGCAGG - Intronic
1087705743 11:101489981-101490003 CTGTTGGTGTGTATGGAAACTGG + Intronic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1089498173 11:118918222-118918244 TTGTTGCTAAGTAAGGAAGGGGG + Intronic
1089943381 11:122442205-122442227 CTGTGGGTGTGGAAAGAATGGGG - Intergenic
1090175442 11:124644919-124644941 CAGTTGGTCTGTAAGGAAAGAGG - Intronic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1091999370 12:5019868-5019890 CTGTTGGTGAGTTAGCAGGGAGG + Intergenic
1094137182 12:27140185-27140207 CTGGAGGTGTGCAAGGAAGGCGG + Intergenic
1094706282 12:32917089-32917111 CAGTTGTTGTGTCAGGAAGAAGG + Intergenic
1095975372 12:47937491-47937513 GTGTTGGTGTGTTAGGAAAGGGG - Intronic
1096596243 12:52697583-52697605 GTGTTTGTGTGTAAGGGTGGGGG - Intronic
1097022310 12:56029012-56029034 CTGGTGGTGTGGGAGGAAGGAGG - Intronic
1097080894 12:56430022-56430044 CTGTTGGTGGGTAAGAAGTGGGG - Intronic
1098541255 12:71660867-71660889 CTTTGGGAGTCTAAGGAAGGAGG + Intronic
1102089744 12:110175975-110175997 GGATTGGTGTGTAAAGAAGGAGG - Intronic
1102724596 12:115049901-115049923 TTGTTGGTGAGAAAGCAAGGTGG + Intergenic
1103695424 12:122811574-122811596 CTTTTGGAGGCTAAGGAAGGGGG + Intronic
1104568177 12:129903580-129903602 CTGTTGGGGTCGAAGGAGGGAGG - Exonic
1106051637 13:26195779-26195801 GTGTGGGTGTGTAAGAAGGGAGG - Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108494728 13:51013903-51013925 CTGTTGGGCTGTAATGCAGGAGG - Intergenic
1110204210 13:72892775-72892797 GTGTGTGTGTGTAAGGCAGGAGG - Intronic
1110685320 13:78365885-78365907 CTTTTGTTGTGTAATTAAGGTGG - Intergenic
1110732917 13:78901381-78901403 TTGTGTATGTGTAAGGAAGGGGG - Intergenic
1111266032 13:85814709-85814731 CTGTTGGGGTGGGAGGAAAGAGG - Intergenic
1111369350 13:87296417-87296439 CTGTTGGTGTGATATGAAGGTGG - Intergenic
1113467985 13:110525442-110525464 CTGTTGGTGGGATAGAAAGGTGG - Intronic
1115172684 14:30527470-30527492 CTGGTGGAGTGTAAGGGAGATGG - Intergenic
1115857642 14:37648159-37648181 CAGTTGGTGTTTAATGAAAGTGG + Intronic
1116502468 14:45636996-45637018 ATGATGGTGTGAAAGGATGGAGG - Intergenic
1117483328 14:56170159-56170181 CAGTTGCTTTGGAAGGAAGGCGG + Intronic
1119406879 14:74404595-74404617 CAGTTGGGGAGTAGGGAAGGAGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1120462865 14:84819490-84819512 CTGTTGGTGGGTGAGGAGTGAGG + Intergenic
1120984478 14:90321964-90321986 CTGTTGGTCTATAGGGGAGGAGG - Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1122512473 14:102280727-102280749 CTTTTGGTGTGTGAGGAATCTGG + Intronic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1124155966 15:27225632-27225654 CTGGTGGTGGGTAGGGAAGCAGG - Intronic
1124412620 15:29449002-29449024 GTGTTTGTTTCTAAGGAAGGAGG - Intronic
1124575402 15:30903693-30903715 CTGCGGGTGGGAAAGGAAGGAGG + Intergenic
1125403058 15:39324864-39324886 CTTGTGGTATGTAAGAAAGGTGG - Intergenic
1126736947 15:51739683-51739705 CTTTGGGAGTCTAAGGAAGGAGG + Intronic
1128969289 15:72092900-72092922 GTGTGTGTGTGTAAGTAAGGTGG - Intronic
1130219723 15:82009354-82009376 CTCTTGGTGTGTCAGGAGAGAGG - Intergenic
1131294896 15:91139183-91139205 ATGGTGGTGTGAAGGGAAGGAGG + Intronic
1131636274 15:94236131-94236153 ATGTTGGTGATTATGGAAGGTGG + Intronic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1133674427 16:8057222-8057244 CTTTTGGTGTTTTAGGAAGAGGG - Intergenic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1136186248 16:28590560-28590582 CTGTTGGGGAGTGAGGATGGGGG - Intronic
1138139353 16:54554445-54554467 CTTTTGTTGTGTGAGCAAGGAGG + Intergenic
1140123395 16:72101834-72101856 CTGGTGTTGTGAGAGGAAGGAGG + Intronic
1142122253 16:88392709-88392731 CTGGTGGTGAGCAAGGAAGTGGG - Intergenic
1143983386 17:10890296-10890318 CTGTTGGTGAATCAGGAAGGGGG + Intergenic
1146388221 17:32396675-32396697 CTGTTGCTTTGTAAGAAAGTGGG + Intergenic
1146478131 17:33179632-33179654 CTGTGGGGTTGTAAGGAGGGTGG - Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1151275035 17:73027915-73027937 TTGTTGGGGTGAAAGGAAGTGGG - Intronic
1152294912 17:79461451-79461473 CTGTTGGAGTTCAAAGAAGGCGG - Intronic
1152522909 17:80870505-80870527 GTGTACGTGTGTGAGGAAGGGGG - Intronic
1153408850 18:4770857-4770879 CTCTTGTTGTGTACAGAAGGTGG + Intergenic
1155339348 18:24798372-24798394 ATGTTGGTTTGAAAGGCAGGTGG - Intergenic
1157692902 18:49698346-49698368 GTGTCTGTGAGTAAGGAAGGAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1160729016 19:632346-632368 CTGGTGGTGTGGGAGGGAGGTGG - Intronic
1160954662 19:1685075-1685097 CTGATGGTGCTTAAGGCAGGCGG + Intergenic
1164563426 19:29309541-29309563 CTGTGGGTTTGTAACGATGGGGG - Intergenic
1165609893 19:37142305-37142327 GAGTTTGTGTGTAAGGCAGGTGG - Intronic
1165675092 19:37715646-37715668 CTGCTGGGGAGTAAGGAAAGGGG - Intronic
1166021611 19:40036095-40036117 CTGTTTGAATGTAAGGAATGTGG - Exonic
1166025083 19:40075678-40075700 CTGTTTGAATGTAAGGAATGTGG - Exonic
1166742464 19:45122669-45122691 CCGTTGGGGTGTGAGGAAGAGGG + Intronic
1167454772 19:49592270-49592292 TTGTGTGTGTGTAAGGGAGGGGG + Intronic
1167535270 19:50046544-50046566 CCGTTGGTGTGTAACGAATGCGG + Exonic
1168421440 19:56206671-56206693 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168424021 19:56224272-56224294 CTGATGGAATGTAGGGAAGGAGG - Intronic
1168426695 19:56244800-56244822 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168448228 19:56441733-56441755 CTATTTGAGTGTAAGGAATGTGG - Exonic
927247382 2:20968406-20968428 ATTTTGGTGTGTGAGGAGGGAGG + Intergenic
928267796 2:29826613-29826635 TTCTTGGTGTGCAAGGAATGAGG + Intronic
928615210 2:33031561-33031583 CTAATGGCGAGTAAGGAAGGGGG + Intronic
928927258 2:36592704-36592726 CTTTTGGAGGGTAAGGCAGGAGG + Intronic
931930502 2:67128229-67128251 CTGTTTGTGTGTGAAGGAGGGGG + Intergenic
932835385 2:75031142-75031164 ATGCTGGTGTGGAAGGAAGAGGG - Intergenic
933715399 2:85355991-85356013 CTTTGGGTGACTAAGGAAGGAGG - Intronic
934578445 2:95418260-95418282 GTGTGTGTGTGTAAGGAAAGAGG + Intergenic
934951354 2:98577812-98577834 CTTTTGGTATGTGAGGTAGGGGG - Intronic
935608592 2:104996907-104996929 CTCTTTGTGTTTCAGGAAGGGGG - Intergenic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
939692923 2:145288154-145288176 CTGTTGGAGTCTAAGGAAAGTGG - Intergenic
939968118 2:148630705-148630727 CTGTTGGTGTGAACGTAAAGCGG + Intergenic
940823564 2:158385018-158385040 CTGATGGTGAGCAAGGAAGTGGG - Intronic
944242689 2:197500633-197500655 CTGCCGGTGTGTAAGGCAGGGGG + Intronic
945460882 2:210106859-210106881 CTGTTGGAGTGTGAGGAGAGTGG + Intronic
945623162 2:212167933-212167955 CTGTTGGGGTGTGGGGAATGAGG + Intronic
945718300 2:213385583-213385605 CTGTTGGCCAGTAAGGAGGGTGG + Intronic
945923415 2:215779229-215779251 CTGTTTGTGTAAAATGAAGGGGG + Intergenic
946030807 2:216703311-216703333 TTGTTGGTGAATGAGGAAGGAGG + Intergenic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
948831488 2:240600533-240600555 CTGTGGGTGAGTCAGGAGGGTGG - Intronic
948883322 2:240871205-240871227 CTGATGGTGTGCATGGGAGGAGG - Intronic
1173123010 20:40311057-40311079 ACGTAGGTGTGTATGGAAGGTGG + Intergenic
1173289485 20:41701909-41701931 ATGCTTGTGTGAAAGGAAGGAGG + Intergenic
1174389632 20:50210195-50210217 CTGTGGGAGAGTAAGGCAGGAGG - Intergenic
1174674737 20:52342843-52342865 TTGTTGTTGTGTCAGTAAGGAGG - Intergenic
1175407590 20:58745003-58745025 GAGTTGGTCTGTGAGGAAGGGGG + Intergenic
1176285019 21:5014791-5014813 TTGTGGGTGTGCAAGGGAGGTGG - Intergenic
1176372409 21:6070177-6070199 CTGATTGTGTGTAAGGGATGTGG + Intergenic
1176736550 21:10553409-10553431 CTGTTGGTGTCTAAACAAAGAGG + Intronic
1176983390 21:15408601-15408623 TTGTTGGAGAGTAAGGAAGATGG + Intergenic
1177285325 21:19041599-19041621 CTCTTGGAGTGAGAGGAAGGAGG - Intergenic
1178481078 21:32979550-32979572 CTGATGGTGTCTAAGGCTGGAGG - Intergenic
1179030915 21:37718895-37718917 CTGGTAGTGTGTTTGGAAGGTGG + Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179132620 21:38652185-38652207 CTGCTGGTGTGTTTGGAGGGTGG - Intronic
1179751109 21:43468362-43468384 CTGATTGTGTGTAAGGGATGTGG - Intergenic
1179872162 21:44248684-44248706 TTGTGGGTGTGCAAGGGAGGTGG + Intronic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1182148161 22:28010295-28010317 CTGTAGGGGTGCTAGGAAGGGGG - Intronic
1182332709 22:29562149-29562171 TTGTTGCTATTTAAGGAAGGTGG - Intronic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1185027929 22:48426158-48426180 CAGGAAGTGTGTAAGGAAGGTGG - Intergenic
950827105 3:15835234-15835256 CTGTTTGTGTATATGGAATGAGG - Intronic
952356735 3:32591784-32591806 CTGGTGGTTTGTTAGAAAGGTGG - Intergenic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953070667 3:39516296-39516318 CAGTGGGTGTGTGAAGAAGGAGG + Intronic
953232998 3:41081064-41081086 GTGTTGGTCTGTATGGAAGATGG + Intergenic
955407542 3:58634930-58634952 CTTTGGGAGGGTAAGGAAGGAGG + Intronic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958513929 3:95088135-95088157 CTGAGGGTGAGAAAGGAAGGAGG - Intergenic
960018803 3:112925430-112925452 CTGGTGGTGAGGAAGGAGGGAGG + Intronic
961594443 3:128005927-128005949 CTGTTGCTGGGTCAGGAAGCAGG + Intergenic
963078073 3:141366734-141366756 CTGTGGGTGTGTTATCAAGGAGG + Intronic
963080529 3:141389126-141389148 CTATAGGTGTGTTAGGAAGATGG + Intronic
964138570 3:153371558-153371580 TTGTTGGTGTCTGGGGAAGGGGG + Intergenic
964730686 3:159861255-159861277 ATCTTGGTGTGTAAGGGATGGGG + Intronic
964880306 3:161416486-161416508 CTGTTCTTGTGGTAGGAAGGAGG + Intergenic
967109930 3:186284241-186284263 CTGTTGATGTGCAAGGAAGGAGG - Intronic
967180425 3:186898397-186898419 CTGCTGGGGTGTAAGGAAGATGG - Intergenic
967882659 3:194312963-194312985 CTGCTGGTGGGAAGGGAAGGAGG - Intergenic
970465179 4:16315307-16315329 CTGATGGAGTGTCAGGAAGAAGG - Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
974775850 4:66479380-66479402 CTGTTTGTGTGAAAGAAAGAAGG - Intergenic
974885723 4:67814635-67814657 TTGTTTAGGTGTAAGGAAGGGGG - Intergenic
975903530 4:79181790-79181812 AAGTTGGTGTGTAAGGGATGTGG + Intergenic
976044963 4:80935126-80935148 CTGTTGGTTGGTTAGGAACGTGG + Intronic
979275255 4:118808202-118808224 CTTTTGGTGGCTAAGGTAGGAGG - Intronic
979505883 4:121496402-121496424 CTGTTGGTGTGTTAGACATGGGG + Intergenic
980015320 4:127643605-127643627 CAGTTGGTGTCTCAGGAAGGAGG - Exonic
982485916 4:155965589-155965611 ATGTTGGTGTATAAGGGTGGAGG - Intergenic
983768570 4:171519116-171519138 TTGTTGTGGTGTGAGGAAGGAGG - Intergenic
984120724 4:175738841-175738863 CAGATGGTGTGTAGGGAGGGTGG - Intronic
984151063 4:176131184-176131206 ATGTTTGTGTGTGTGGAAGGAGG + Intronic
986547892 5:8918691-8918713 CTGCTGGGGTGTGAGGAGGGGGG + Intergenic
986636497 5:9827240-9827262 CTGGAGGTGGGTAAGAAAGGAGG - Intergenic
987373561 5:17215542-17215564 CTGGTGGTGTGTGTGGAGGGTGG + Intronic
987671348 5:21014018-21014040 GAGTTTGTGAGTAAGGAAGGGGG - Intergenic
987816441 5:22906941-22906963 GTGTTGGTGTATAAGGTGGGAGG + Intergenic
988638742 5:33017475-33017497 ATACTGATGTGTAAGGAAGGAGG - Intergenic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
991982062 5:72242587-72242609 CTTTTGGTGGGTAAAGTAGGAGG + Intronic
996619867 5:125487443-125487465 CAGATGTTGTGAAAGGAAGGAGG - Intergenic
997612337 5:135223988-135224010 CTGTTGGGGTGAAAGAAAGGGGG - Intronic
1002480093 5:179495161-179495183 CTGTTTGTGTGTGGGGGAGGTGG + Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1004613825 6:17270822-17270844 GTGTGTGTGTGTAAGGAAAGTGG + Intergenic
1005079947 6:21946782-21946804 TGGTTTGTGTGTAAGGAAGCAGG + Intergenic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1007232364 6:40357244-40357266 CTCTTCGTGAGTGAGGAAGGTGG - Intergenic
1008781729 6:55114582-55114604 CTGTTTTTGTGCAAGGTAGGTGG - Intronic
1011627845 6:89297933-89297955 CTGTTGCTGTGCAAGAAAAGTGG + Intronic
1012126289 6:95432688-95432710 CTGCTGGTGAGAAAGTAAGGTGG - Intergenic
1012376150 6:98563912-98563934 CTGTTGGTGTTTGAGGAATCAGG - Intergenic
1016934709 6:149441126-149441148 GGGCTGGTGTGCAAGGAAGGAGG - Intergenic
1017567491 6:155703352-155703374 CTCTTGCTGTGTAACCAAGGAGG + Intergenic
1018249002 6:161849537-161849559 CTATGGGAGTGTGAGGAAGGTGG - Intronic
1019046430 6:169151714-169151736 CTGTTGGGGGGTATGGAAGGAGG + Intergenic
1019408211 7:895023-895045 CTGTTGGTGGGTGTGGAGGGTGG + Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1023927528 7:44680789-44680811 CTGTTGGTCAGGAAGCAAGGAGG + Intronic
1028549442 7:92042306-92042328 CTGCATGTGTGTAAGGTAGGTGG + Intronic
1029092413 7:98058425-98058447 CTGGTGCTGTGGGAGGAAGGTGG + Intergenic
1031587001 7:123543371-123543393 ATGATGGTGTGTCAGAAAGGAGG - Intronic
1031930722 7:127683128-127683150 CTGTTGGCGAGTAAGACAGGTGG + Intronic
1034398843 7:150848165-150848187 CAGGTGGTGTGTCTGGAAGGAGG - Intronic
1035591906 8:822712-822734 CTGGTGGTGTGTGGGGAAGCAGG + Intergenic
1035765489 8:2101585-2101607 ATGTTGGTGTGAATGGAAGGAGG - Intronic
1036510482 8:9395295-9395317 GTGTTGTTGTGTGAAGAAGGAGG - Intergenic
1037736636 8:21572151-21572173 CTATTGGTGTCTAAAGTAGGGGG + Intergenic
1041314441 8:56546608-56546630 CTGCTGGTGTGTTATGGAGGAGG + Intergenic
1042721394 8:71830510-71830532 CTGCTGGGGTGAAAGGAAGCTGG - Intronic
1044384094 8:91566957-91566979 ATGATGTTGTTTAAGGAAGGTGG + Intergenic
1045820234 8:106328747-106328769 GTGTTGGTCTGAAAGGATGGTGG - Intronic
1046032938 8:108805158-108805180 CTGCTGGTGTCTAATGCAGGAGG - Intergenic
1046108821 8:109696821-109696843 CGGTTGCTGTGTAAGCAAGGTGG + Intergenic
1046328166 8:112677247-112677269 CTGTGTGTGTGTAAGCATGGGGG + Intronic
1047070223 8:121334801-121334823 TTTTTGGTGGGTAAGGAAGATGG - Intergenic
1047689890 8:127341201-127341223 CTGATGGTGACTAAGGAGGGAGG + Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1050195046 9:3074115-3074137 CTTTTGGTGTGTAAGAATGGAGG + Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051739354 9:20236415-20236437 GTGTTGGTTTGAAAGGGAGGAGG + Intergenic
1052087280 9:24283336-24283358 CTGTTGTGGTGTAGGGGAGGGGG + Intergenic
1052272570 9:26641726-26641748 CTGTTGGTACTTTAGGAAGGAGG + Intergenic
1052643460 9:31200460-31200482 TTGCTGGTGTGTATGGAATGAGG - Intergenic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1054928260 9:70610211-70610233 CTTTTGGTGGGTAAGGAGTGAGG - Intronic
1056282472 9:85055331-85055353 CATGTGGTGTGTTAGGAAGGTGG + Intergenic
1057169179 9:92950621-92950643 CTGATGGTGGGGAAAGAAGGGGG + Intronic
1057483838 9:95466552-95466574 CTGTGTGTGGGTGAGGAAGGGGG + Intronic
1058343083 9:103921524-103921546 CTGTTTGTGGCTAAGGCAGGTGG - Intergenic
1058714703 9:107713378-107713400 CTGTTGGGTTGTAATGATGGCGG + Intergenic
1060456349 9:123802374-123802396 GTGTTGGTGTGGTAGGGAGGAGG - Intronic
1061748179 9:132755308-132755330 CTCTTGGTGTGCAGGGTAGGGGG - Intronic
1062087032 9:134654259-134654281 CTGTAGGTGTGTAGGGCTGGAGG + Intronic
1190064073 X:47228683-47228705 CTGTTGGTGGGTAAGCAGGTAGG - Intronic
1191034962 X:56014990-56015012 CTGTTGGGGAGTATGGCAGGAGG + Intergenic
1196138760 X:112237927-112237949 CTGTTCCAGTGTTAGGAAGGTGG + Intergenic
1198435149 X:136609811-136609833 GTGTTGGTGGGGCAGGAAGGTGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200256087 X:154584271-154584293 CTATTTGTGTGTCTGGAAGGGGG - Intergenic
1200261682 X:154620132-154620154 CTATTTGTGTGTCTGGAAGGGGG + Intergenic