ID: 1120036801

View in Genome Browser
Species Human (GRCh38)
Location 14:79706978-79707000
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 4, 1: 14, 2: 17, 3: 8, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120036801_1120036809 13 Left 1120036801 14:79706978-79707000 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 1120036809 14:79707014-79707036 GGTCCCCAACATTGGTCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 62
1120036801_1120036808 5 Left 1120036801 14:79706978-79707000 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 1120036808 14:79707006-79707028 CTGAGGCTGGTCCCCAACATTGG 0: 1
1: 1
2: 2
3: 8
4: 154
1120036801_1120036807 -8 Left 1120036801 14:79706978-79707000 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG 0: 1
1: 17
2: 29
3: 51
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120036801 Original CRISPR CCCGTAGGGTACCCGAAGTC CGG (reversed) Intronic