ID: 1120036807

View in Genome Browser
Species Human (GRCh38)
Location 14:79706993-79707015
Sequence CCTACGGGTGGTGCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 912
Summary {0: 1, 1: 17, 2: 29, 3: 51, 4: 814}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120036801_1120036807 -8 Left 1120036801 14:79706978-79707000 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG 0: 1
1: 17
2: 29
3: 51
4: 814
1120036795_1120036807 20 Left 1120036795 14:79706950-79706972 CCTGTCTATTCTCATTCGTTTGT 0: 1
1: 0
2: 25
3: 35
4: 208
Right 1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG 0: 1
1: 17
2: 29
3: 51
4: 814
1120036799_1120036807 -5 Left 1120036799 14:79706975-79706997 CCACCGGACTTCGGGTACCCTAC 0: 3
1: 20
2: 19
3: 10
4: 34
Right 1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG 0: 1
1: 17
2: 29
3: 51
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120036807 Original CRISPR CCTACGGGTGGTGCTGAGGC TGG Intronic