ID: 1120036808

View in Genome Browser
Species Human (GRCh38)
Location 14:79707006-79707028
Sequence CTGAGGCTGGTCCCCAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120036806_1120036808 -10 Left 1120036806 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG 0: 1
1: 18
2: 27
3: 28
4: 222
Right 1120036808 14:79707006-79707028 CTGAGGCTGGTCCCCAACATTGG 0: 1
1: 1
2: 2
3: 8
4: 154
1120036799_1120036808 8 Left 1120036799 14:79706975-79706997 CCACCGGACTTCGGGTACCCTAC 0: 3
1: 20
2: 19
3: 10
4: 34
Right 1120036808 14:79707006-79707028 CTGAGGCTGGTCCCCAACATTGG 0: 1
1: 1
2: 2
3: 8
4: 154
1120036805_1120036808 -9 Left 1120036805 14:79706992-79707014 CCCTACGGGTGGTGCTGAGGCTG 0: 1
1: 20
2: 22
3: 23
4: 145
Right 1120036808 14:79707006-79707028 CTGAGGCTGGTCCCCAACATTGG 0: 1
1: 1
2: 2
3: 8
4: 154
1120036801_1120036808 5 Left 1120036801 14:79706978-79707000 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 1120036808 14:79707006-79707028 CTGAGGCTGGTCCCCAACATTGG 0: 1
1: 1
2: 2
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120036808 Original CRISPR CTGAGGCTGGTCCCCAACAT TGG Intronic
900120219 1:1045649-1045671 CAGAGCCTGGTCCCCAACCCTGG - Intronic
900938167 1:5780222-5780244 CTGCGGCTGGCCCCCAACTCTGG - Intergenic
902781098 1:18705565-18705587 CTGAGGTTTATCCCCAACACAGG + Intronic
902978938 1:20109430-20109452 CTGAGGCTTGTACCCACCAATGG + Intergenic
903961233 1:27059069-27059091 CTGAGGCTGAGCCCCAGCCTGGG - Intergenic
906151901 1:43592385-43592407 CACAGGTTGTTCCCCAACATGGG - Intronic
907383994 1:54113953-54113975 CTGAGGCTGGGCCCCCAAAGAGG + Intergenic
910445535 1:87295897-87295919 CTGAGCCTGGGCGTCAACATGGG + Intergenic
912547491 1:110461329-110461351 CTGAAGCAGGTCCCCAACCTCGG - Intergenic
912716360 1:111986824-111986846 CTGAGGCTGGTGCTCAGCACAGG + Intronic
912959085 1:114179401-114179423 CTGTGGCTCTTCCCCAATATTGG - Intergenic
915660692 1:157402845-157402867 GTGAGGGTGGTCCTCAACTTGGG + Intergenic
917792836 1:178510621-178510643 CTGAGCCTGGACCTCATCATGGG + Intergenic
919883169 1:201914308-201914330 CTCAAGCTGGTCCTCAGCATTGG - Intronic
920785427 1:209036309-209036331 CTGAAGTTGATCCCCAACCTAGG + Intergenic
1066464811 10:35642004-35642026 CCGAGGCGGGTCCCCAACTCCGG - Exonic
1067476728 10:46572377-46572399 CTGTGGCTGGCCCTCACCATGGG - Intergenic
1067618009 10:47769403-47769425 CTGTGGCTGGCCCTCACCATGGG + Intergenic
1067745047 10:48929321-48929343 CTGAGGCTGGTACCAGGCATGGG + Intronic
1067848006 10:49738284-49738306 CCAAGGCTGGACCCCACCATGGG + Intronic
1073256238 10:102153120-102153142 CAGAGCCTGGTCCCAAACCTAGG - Intronic
1073624148 10:105079148-105079170 CTGAGGGTGGAGCCCAGCATCGG + Intronic
1076916223 10:133424165-133424187 CTGGGCCTGGTCCCCACCTTTGG + Intronic
1076936331 10:133568960-133568982 CTGGGCCTGGTCCCCACCTTTGG + Intronic
1077995091 11:7446056-7446078 CTGGGGCTGGTTCCCAGCTTGGG - Intronic
1080684584 11:34504598-34504620 CTGAGTCTGGACTCCTACATGGG + Intronic
1085983719 11:81757935-81757957 GGGAGGCTGTTCCCCAACAGTGG - Intergenic
1088194448 11:107259552-107259574 CTGAGGCTGGGCCCCCTCACAGG + Intergenic
1091263939 11:134255615-134255637 CTGAGGGTAATACCCAACATAGG + Intronic
1092564977 12:9655350-9655372 CTGAGGCAGGTCGGCTACATAGG + Intergenic
1095977247 12:47948193-47948215 TTGAGGCTGGTCTCGAACACTGG + Intergenic
1102057252 12:109905909-109905931 CTCAGGCTGGTCTCAAACCTGGG + Intronic
1104111118 12:125705547-125705569 CTCAAGATGGTGCCCAACATGGG + Intergenic
1111956000 13:94759184-94759206 TTGAGGCTGGTCCTCAAAGTAGG - Intergenic
1113728838 13:112625319-112625341 CTGAGGCCCGTCACCAACAGTGG + Intergenic
1113950087 13:114066892-114066914 CTGAGGATGGGCCCCCACCTGGG + Intronic
1113950234 13:114067262-114067284 CTGAGGATGGGCCCCCACCTGGG + Intronic
1120036808 14:79707006-79707028 CTGAGGCTGGTCCCCAACATTGG + Intronic
1120604318 14:86554174-86554196 ATGAGGATGGTCCCCAAATTTGG + Intergenic
1122722874 14:103731988-103732010 CAGAGACCAGTCCCCAACATGGG + Intronic
1123068188 14:105628557-105628579 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123072195 14:105647336-105647358 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123092202 14:105746853-105746875 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123097776 14:105774554-105774576 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123410788 15:20057125-20057147 CTGAGGAGGGACCCAAACATGGG - Intergenic
1123520118 15:21063831-21063853 CTGAGGAGGGACCCAAACATGGG - Intergenic
1127369979 15:58330509-58330531 CTGATGCTGCTCCCCAGCTTTGG + Intronic
1127453509 15:59138388-59138410 ATGAGACTGGGCCCCAACAGGGG + Intronic
1129094043 15:73183621-73183643 CTGAGGCTGGACCAGAACAATGG + Intronic
1129224200 15:74157202-74157224 CTGAGGCCGGTCCCCATCCCCGG + Intergenic
1129515829 15:76156864-76156886 CTGAGGCTGGGCAGCAGCATCGG - Intronic
1129956124 15:79638275-79638297 GTTAGGCTGGTCCCCCACTTCGG + Intergenic
1132983062 16:2749161-2749183 CTGAGGCTGGTCCTCAGCGCAGG - Intergenic
1133041189 16:3060444-3060466 CTGAGGCTGGACAGCAACTTAGG - Exonic
1133275763 16:4637653-4637675 CTGAGGCTGGAGCCGAACAGAGG - Intronic
1134638653 16:15811615-15811637 CTGAGGCTGCTCCCCAGTAGAGG - Intronic
1136537568 16:30909312-30909334 CTCAGGCTGGTCTCGAACTTGGG - Intergenic
1143682579 17:8488340-8488362 CTGTGTCTGGTCCTCATCATTGG - Intronic
1144022933 17:11252801-11252823 CTGAGGCTGCTCCAGAACTTGGG + Intronic
1146287925 17:31586862-31586884 CTGAGACTGGGCCCCAAAACTGG - Intergenic
1146924368 17:36733931-36733953 CTGAGGCTAGTCTGAAACATGGG + Intergenic
1147934796 17:44005322-44005344 CTGAAGAAGGCCCCCAACATGGG + Intronic
1150945787 17:69744041-69744063 CTTAGGTTGTTCCCCAATATTGG + Intergenic
1151355609 17:73556186-73556208 CTGAGGCAGATCACCAAGATGGG + Intronic
1151975642 17:77482364-77482386 CTGAGGCTGGTTTCCGGCATTGG - Intronic
1152733158 17:81983411-81983433 CTGTGGCAGCTCCCCAACAGCGG - Intronic
1153525012 18:5986663-5986685 CTCAGGCAGTTCCCCAATATAGG - Intronic
1153575118 18:6512228-6512250 CTTAGGCTGGTCCTCAAGCTAGG - Intronic
1154299994 18:13184537-13184559 CTGAGGCTGGTGCTCAGCAAGGG + Intergenic
1159795935 18:72843632-72843654 CTGAGGCTGGTTACCAAAAAAGG - Intronic
1160162235 18:76482338-76482360 CTGTAGATGGTCCCCAACTTAGG + Intronic
1161723495 19:5916000-5916022 CTGTGGCTGGACCCCAGCACTGG + Exonic
1161905222 19:7151493-7151515 CTCAGGCTGGTCTCCACCTTTGG + Intronic
1162298983 19:9833331-9833353 CCCAGGCTGGTCCCCAACTCTGG + Intergenic
1162540400 19:11292321-11292343 CAGAGGCTGGTCCACACCTTTGG - Intergenic
1162931157 19:13958469-13958491 CTGTGGCTGGGCCCCAACCCAGG - Intronic
1166215733 19:41333567-41333589 CTGAGGCTGGTGTCGAACTTGGG + Intronic
1166735875 19:45084319-45084341 CCCAGGCTGGTCTCCAACCTGGG - Intronic
1166940239 19:46358625-46358647 CCCAGGCTGGTCCTCAACCTTGG - Intronic
926272807 2:11379239-11379261 CTGAGGCTGGGCCACACCCTGGG + Intergenic
926799209 2:16644424-16644446 CTGAGGCTGGAACACAACAAGGG - Intronic
926853869 2:17230897-17230919 CTAAGGGTGGTTCCCAAGATAGG + Intergenic
928634180 2:33226365-33226387 CTCAGGCTAGGCCCCAACTTTGG - Intronic
929075292 2:38075372-38075394 CTGAGGCTGGTGCCCATGCTGGG + Exonic
930750781 2:54932276-54932298 ATCTGGCTGGTCCCCAACCTTGG + Intronic
931716973 2:65037110-65037132 CTGCGGCTGGTCCCTACCCTGGG + Intergenic
932887111 2:75558545-75558567 CTGAGGCTTTCCCCCAACCTGGG + Intronic
935337151 2:102027016-102027038 CTGAGGCTGGAACACATCATTGG - Intronic
943753809 2:191537465-191537487 CTGAGGCTGGACCTCACCATGGG + Intergenic
946915830 2:224520333-224520355 ATGAGGTGGGTCCCCACCATTGG - Intronic
948199755 2:236121068-236121090 CTGAGGCAGGTTCCCACCAGAGG + Intronic
949036279 2:241817005-241817027 CCGAGGCTTGTCCCCAAGGTTGG - Exonic
1169353408 20:4888524-4888546 CTGAGGCTGGAGCCCGACATGGG - Intronic
1170585039 20:17728166-17728188 CTGAGGCTGAGCCCCAGCCTGGG - Intronic
1170893335 20:20394032-20394054 CTGAGGTTGGTTCCCAGCAGAGG - Intronic
1171159426 20:22908073-22908095 CTCAGGGTGATCCCCAACACTGG - Intergenic
1172345224 20:34192729-34192751 CTGAGGCAGGCCCCAAACTTTGG - Intergenic
1172556632 20:35847832-35847854 CTGAGGGTGGTCTGTAACATTGG + Intronic
1172803726 20:37596624-37596646 CTCAGGCTGGTCGCGAACCTCGG - Intergenic
1174165399 20:48580363-48580385 CTGTGCCTGGTCCCCGACTTTGG - Intergenic
1178437888 21:32575600-32575622 CTGAGGCTCGGCCACCACATAGG + Intergenic
1178685226 21:34705393-34705415 CTGAGGCTGTTCCCCACCTTGGG - Intronic
1178869895 21:36364601-36364623 CTGAGGCTGCACCCCAGCCTGGG + Intronic
1179629858 21:42669635-42669657 CTGAGGCTGGAACCCAGCAATGG + Intronic
1179892601 21:44344515-44344537 CTGGAGCTGGTCCCCAGCAGTGG + Intergenic
1181752510 22:24998819-24998841 CTGCAGATAGTCCCCAACATAGG - Intronic
1182223722 22:28779036-28779058 CTCAGGCTGGTCTCAAACACTGG + Intronic
1183368084 22:37417672-37417694 CTGAGGCTGGGCCACATCACAGG + Intronic
954320435 3:49828995-49829017 CTCAGGCTGGTCCCGAAAGTGGG + Exonic
954656662 3:52198157-52198179 CTGAGGCTGCTCCCGGACAAGGG + Exonic
961907986 3:130282373-130282395 CTGAGGCTGGTCCCTAAGCAAGG + Intergenic
962229315 3:133647234-133647256 CAGAGGCTGGTCCTCAAAGTAGG + Intronic
963343138 3:144061933-144061955 CTGAGGTTTGTCCCCATCAATGG + Intergenic
964281794 3:155075729-155075751 CTCAGGCTGGTCTCAAACTTGGG + Intronic
964410633 3:156393998-156394020 CAGAGTCAGGTCCCCAACACAGG - Intronic
968640092 4:1710047-1710069 TCGAGGCTGGTCCCCAACAATGG + Intronic
969678060 4:8625858-8625880 CTGAAGATGGTACCCAGCATGGG - Intergenic
969679015 4:8631495-8631517 CTGAAGATGGTACCCAGCATGGG - Intergenic
969679971 4:8637152-8637174 CTGAAGATGGTACCCAGCATGGG - Intergenic
971291256 4:25342356-25342378 TTGAGGCTGTTCTCCAACCTTGG - Intronic
971330033 4:25674540-25674562 CTCACGCTGGGCTCCAACATCGG + Exonic
972389252 4:38597558-38597580 GTGATGCTGGGCCCCAAAATTGG - Intergenic
985958719 5:3283642-3283664 CTCAGGGTGGACGCCAACATAGG - Intergenic
989100307 5:37817046-37817068 CTGAGGCTGGACCTCACCCTTGG - Intronic
993878859 5:93340315-93340337 CTGGGGCTGGTTCCCAATAAAGG - Intergenic
995585608 5:113644992-113645014 CTCAGGCTGGTCTCCAACCTTGG + Intergenic
996565220 5:124872889-124872911 CTCTGGCTGCTTCCCAACATGGG - Intergenic
998403929 5:141863103-141863125 CTCAGGCTGGCCCCCAACACGGG + Intronic
998433700 5:142088756-142088778 TTGAGGCTGGTCCCCAACATTGG - Intergenic
1002187218 5:177459947-177459969 CTGTGGCGGGACCCCAGCATGGG + Intronic
1005499959 6:26421157-26421179 CCAAGGCTGGTCCCCAAGGTTGG - Intergenic
1006223250 6:32513367-32513389 TTGAGGCTGGTCCCCAACAGGGG + Intergenic
1007372106 6:41432619-41432641 CCGAGGCTGGTCCCCCAAAGTGG - Intergenic
1007592640 6:43031986-43032008 CCCAGGCTGGTCCCCAACTGAGG - Intronic
1009292942 6:61906808-61906830 CTTAGGCTGATTCCAAACATTGG + Intronic
1013560453 6:111298407-111298429 CTGGGGCTAGTCCTCAGCATTGG - Intergenic
1014253042 6:119134441-119134463 CTCAGGCTGGTCTCAAACTTCGG - Intronic
1015511265 6:134040285-134040307 CTCAGGCTGGTCTCGAACTTCGG + Intronic
1016530871 6:145057115-145057137 GTGAGGCTGCTCTGCAACATGGG + Intergenic
1025041380 7:55648925-55648947 ATGATGCTTGTCCCCAATATAGG - Intergenic
1036957981 8:13211494-13211516 CTGAGGCTAAGCCCCAACTTTGG + Intronic
1037834384 8:22207545-22207567 CTGAGCCTGGTCTCCAAGACTGG + Intronic
1038700778 8:29847538-29847560 GTGTGGCTGGTCCCCAAGGTGGG + Intergenic
1038862892 8:31406818-31406840 CTCAGGCAGTTCCCCAACCTCGG - Intergenic
1039085573 8:33776544-33776566 CTCAGGCTGGTCTCCAACTCTGG + Intergenic
1042792477 8:72623855-72623877 CTGAGGCTGGCCCCAAAGACAGG + Intronic
1043283839 8:78504207-78504229 CTCAGGCTGGTCTCAAACTTCGG + Intergenic
1045125965 8:99089376-99089398 CTGAGGCTTGTCCTTAACCTTGG - Intronic
1047020813 8:120773307-120773329 CTCAGGCTGGTCCCAAACTCTGG - Intronic
1049730781 8:144177088-144177110 CTGAGGCTTGTGACCTACATTGG + Intronic
1053418263 9:37960530-37960552 CAGGGTCTGGTCCCCATCATTGG - Intronic
1055659875 9:78492054-78492076 CTATGGCTGTCCCCCAACATAGG - Intergenic
1057130741 9:92652908-92652930 TTGAGGCTGGTCACCACCGTGGG - Intronic
1061194766 9:129101816-129101838 TTGAGGCTGGTCCCCAACAGGGG + Intronic
1061782726 9:133005253-133005275 CAGATGCTGGTCCCCAACCCTGG - Intergenic
1186461498 X:9751966-9751988 CTGGGGCTGGCCCCCAGCAGGGG - Intronic
1186988750 X:15045010-15045032 CTAAGGCTGGGCCCCAACCCGGG - Intergenic
1189310010 X:40012380-40012402 CTGGGGCTGGACCCCAACCCTGG - Intergenic
1189431882 X:40954341-40954363 CCCAGGCTGGTCTCCAACACTGG - Intergenic
1195295210 X:103469868-103469890 TTGAGGCTGGTCCTCAACAGAGG - Intergenic
1197739368 X:129877509-129877531 CTGAGACTGTTCCCACACATTGG + Intergenic
1199298431 X:146185749-146185771 CTGAGACTTGTGCCCACCATTGG - Intergenic
1200210750 X:154345698-154345720 CTGTGCCTGGCCCCCAACAAAGG - Intergenic
1200220102 X:154386394-154386416 CTGTGCCTGGCCCCCAACAAAGG + Intergenic
1200687571 Y:6270548-6270570 CTGAGGCTCCTCTCCAACCTAGG - Intergenic
1201047700 Y:9904161-9904183 CTGAGGCTCCTCTCCAACCTAGG + Intergenic