ID: 1120036809

View in Genome Browser
Species Human (GRCh38)
Location 14:79707014-79707036
Sequence GGTCCCCAACATTGGTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120036806_1120036809 -2 Left 1120036806 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG 0: 1
1: 18
2: 27
3: 28
4: 222
Right 1120036809 14:79707014-79707036 GGTCCCCAACATTGGTCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 62
1120036805_1120036809 -1 Left 1120036805 14:79706992-79707014 CCCTACGGGTGGTGCTGAGGCTG 0: 1
1: 20
2: 22
3: 23
4: 145
Right 1120036809 14:79707014-79707036 GGTCCCCAACATTGGTCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 62
1120036799_1120036809 16 Left 1120036799 14:79706975-79706997 CCACCGGACTTCGGGTACCCTAC 0: 3
1: 20
2: 19
3: 10
4: 34
Right 1120036809 14:79707014-79707036 GGTCCCCAACATTGGTCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 62
1120036801_1120036809 13 Left 1120036801 14:79706978-79707000 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 1120036809 14:79707014-79707036 GGTCCCCAACATTGGTCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120036809 Original CRISPR GGTCCCCAACATTGGTCTAA TGG Intronic
907746983 1:57223347-57223369 GGTCCACAACTTTGGTCCAGGGG + Intronic
909596122 1:77408021-77408043 GGTCCCCAACAATGGTGGACTGG - Intronic
915057797 1:153151510-153151532 GGGCCCCAACATGACTCTAATGG - Intergenic
920077442 1:203347679-203347701 GGTCCCCAACAATGCTCTGGAGG - Exonic
921798293 1:219372999-219373021 GTGCCCCAACATTGTCCTAAAGG + Intergenic
923511572 1:234658070-234658092 GGACCCCAGCATGGCTCTAAGGG + Intergenic
1070499632 10:77060130-77060152 GCTCCCCCAAATTGGTCTATAGG + Intronic
1071182681 10:83005329-83005351 GGTTCCCAACATTGGTCTTTTGG + Intergenic
1078193293 11:9111496-9111518 GGTCACAGACATTGGTCTAAAGG + Intronic
1081723166 11:45304748-45304770 GGGCCCCAACATTGCTCCAAGGG + Intergenic
1085538243 11:77240551-77240573 GCTCCACAACATTGGTCTCTGGG + Intronic
1088342219 11:108781297-108781319 GGTCCCCATCAATGGTGTACTGG - Intronic
1090473833 11:127002980-127003002 GGCCCCCAACACTGGCCTCATGG + Intronic
1099336755 12:81370377-81370399 GGTCTCAAATATTGGTCTAACGG + Intronic
1116060391 14:39917085-39917107 GGTCCTCTAAATTGGTCTTAAGG - Intergenic
1119121802 14:72086274-72086296 TGTGCCCTCCATTGGTCTAAAGG + Intronic
1119496894 14:75087443-75087465 GGTCTCCCACCTTGGCCTAATGG - Intronic
1120036809 14:79707014-79707036 GGTCCCCAACATTGGTCTAATGG + Intronic
1121963918 14:98287045-98287067 GTTCCCCAACATTTGTGTATTGG - Intergenic
1128186737 15:65648979-65649001 GTTCCCAAACACTGGTCTAAAGG + Intronic
1130067126 15:80614092-80614114 GGTCCCCATCTTTGGTCACAAGG - Intergenic
1130262042 15:82362880-82362902 TGTCCCCCACACTGGTCAAAGGG - Intergenic
1130279190 15:82506127-82506149 TGTCCCCCACACTGGTCAAAGGG + Intergenic
1134145666 16:11759446-11759468 GGTCACTGACATTGGTCCAAGGG - Intronic
1139927270 16:70496553-70496575 GGTCTCCTACAGTGGTCTTAAGG - Intronic
1141691012 16:85596111-85596133 GGTCCCTACATTTGGTCTAAAGG + Intergenic
1151197633 17:72443150-72443172 GGTGCCCAACTTTGGGGTAAAGG + Intergenic
1155387095 18:25290308-25290330 ACTCCCCAAAATTGATCTAAGGG + Intronic
1159117735 18:64135062-64135084 GGTTCCCCACAGTGGTCAAAAGG - Intergenic
1160571472 18:79820142-79820164 TGTCCCCATCATTTGGCTAATGG + Intergenic
1168574513 19:57498954-57498976 AGGACCCAACATTGGTGTAAAGG - Intronic
925987785 2:9230302-9230324 GGTCCCCAACACTGGTCCTCTGG - Intronic
934488441 2:94738823-94738845 GGGCCCCAGCATAGGTCTGAGGG - Intergenic
939757108 2:146128162-146128184 GGTGCCCAACAGTGGTCGATTGG - Intergenic
940747910 2:157590987-157591009 TGTGCCAGACATTGGTCTAAGGG - Intronic
947316185 2:228861797-228861819 GGTCACCACCATTGAACTAATGG - Intronic
947745458 2:232504945-232504967 GGTCCCAAAGATGGGTCTGAGGG + Intergenic
1178817951 21:35948860-35948882 GGTAACCAACATTGGTTTAATGG + Intronic
1183444983 22:37847678-37847700 GGTCCCCAACAATGTCCTCATGG - Intronic
954944356 3:54406296-54406318 GGTGCCCATCAGTGGACTAATGG + Intronic
956405282 3:68922332-68922354 GTGCTCCAGCATTGGTCTAAAGG + Intronic
961313106 3:126016343-126016365 GGTCCCCCACCTTGGCCTCAAGG - Intronic
964516338 3:157512776-157512798 GGTCCCCAAGCTTGGTCCCAAGG - Intronic
967056089 3:185829529-185829551 GGTCCCCAACCTTGGTGCCATGG - Intergenic
968837032 4:2972579-2972601 GGTCCCCTGGCTTGGTCTAAGGG - Intronic
973938018 4:55870444-55870466 GGTCCCTAACATTGATTTAGAGG + Intronic
977310850 4:95385097-95385119 GGTGCCCATAATTGTTCTAATGG - Intronic
979004849 4:115281027-115281049 AGTCACCAACAATGGTCCAAGGG - Intergenic
985384266 4:189429006-189429028 GGTAATCAACATTTGTCTAAGGG + Intergenic
987360511 5:17102397-17102419 GGTACCCAGCATTGTTCTAAGGG + Intronic
992416456 5:76556671-76556693 GGTACTTAACATTGCTCTAAAGG - Intronic
999364020 5:151009668-151009690 GGTCCCCAGGATAGGTCTATGGG - Intergenic
1000545973 5:162602865-162602887 GCTCACCAACATTTGTGTAATGG - Intergenic
1017628310 6:156370555-156370577 GGTCCCCCGCATTGCTCTCATGG + Intergenic
1018873157 6:167798048-167798070 GGTCCCCAACAATGTCCTGAGGG + Intergenic
1026024547 7:66734073-66734095 ATTGTCCAACATTGGTCTAACGG + Intronic
1026305164 7:69134246-69134268 GGGACCCAACATTGGTTCAAAGG + Intergenic
1026801929 7:73405480-73405502 GGTGCCCACCATTGGTGTCAGGG - Intergenic
1026889243 7:73972612-73972634 AGTGTCCAACACTGGTCTAACGG + Intergenic
1028770548 7:94615501-94615523 GCTGCCCAATATTGGTCTGATGG - Intronic
1029865502 7:103623609-103623631 GTTTCCCAAGATTGGTCTGAAGG + Intronic
1036537542 8:9664919-9664941 GTTACCCAACAATGGACTAATGG - Intronic
1047577009 8:126167464-126167486 GGACTCCAACATTGGACAAATGG - Intergenic
1047695944 8:127403812-127403834 GGTCCCAAACCTAGGACTAAGGG - Intergenic
1051119970 9:13742181-13742203 GGCCCCAAACATGGCTCTAATGG + Intergenic
1053669346 9:40345542-40345564 GGGCCCCAGCATAGGTCTGAGGG + Intergenic
1054515270 9:66030749-66030771 GGGCCCCAGCATAGGTCTGAGGG - Intergenic
1186909145 X:14143103-14143125 AGTCCTCAACATTGGCCAAAGGG - Intergenic
1190167396 X:48084550-48084572 GGCCTCAAACATTGGGCTAAGGG - Intergenic
1198125631 X:133640904-133640926 GGTCCCCACCCTTGCACTAAGGG - Intronic