ID: 1120038900

View in Genome Browser
Species Human (GRCh38)
Location 14:79729886-79729908
Sequence GAGGCACTAATTGGGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120038900 Original CRISPR GAGGCACTAATTGGGCTGAC TGG Intronic
900214911 1:1476207-1476229 TAGGCACGAACTGGGCTGACGGG - Intronic
900222122 1:1514561-1514583 TAGGCACGAACTGGGCTGACGGG - Intronic
901815900 1:11793517-11793539 GAGGCACAAATATGGCTTACTGG + Intronic
907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG + Intronic
907564654 1:55423673-55423695 GAGGCAGGATTTGGGCTGGCAGG + Intergenic
912577642 1:110688425-110688447 TTGGCAGAAATTGGGCTGACTGG - Intergenic
914819466 1:151089570-151089592 GAGGTACAAATTTGACTGACTGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916040717 1:160958922-160958944 AAGGCACTAATTGTGATGAAAGG - Intergenic
916287300 1:163122386-163122408 CAGACACTAATTGGCCTCACTGG + Intronic
1067004515 10:42648149-42648171 GTGGATCTAATTGGGCTGGCAGG + Intergenic
1077443649 11:2580203-2580225 GAGGCAGGAATTGGCCTGAGGGG - Intronic
1078532125 11:12144758-12144780 GAGGAAGTTATTGGTCTGACAGG - Intronic
1084658121 11:70531280-70531302 GAGGCACTCATGGGGCTGGCAGG - Intronic
1084741862 11:71145491-71145513 GAGACGCTAACTGGGCTGAGGGG - Intronic
1087794903 11:102445445-102445467 CAGGAACCAATTGGCCTGACAGG - Intronic
1088653202 11:111976614-111976636 GAGCCACTAAGTGGGCTCCCTGG - Intronic
1089842328 11:121428942-121428964 GAGGCACGCAGTGGGCTGAGTGG + Intergenic
1090801151 11:130173241-130173263 GAGGGAGGAATTGGGCTGCCTGG - Intronic
1090807835 11:130213432-130213454 GGGGCACTAAAGGGGCTGAAGGG - Intergenic
1092052079 12:5478961-5478983 GAAGCTCTGATTGTGCTGACGGG - Intronic
1095042905 12:37463926-37463948 GAATCTCTAACTGGGCTGACTGG - Intergenic
1109757423 13:66778767-66778789 GAGGTACTAATTGGCCAGGCTGG + Intronic
1113301554 13:109027207-109027229 GAGGCACAGATTGGGGTGATAGG - Intronic
1113349506 13:109514304-109514326 GAGGCCCTAAGTCGGCTCACAGG + Intergenic
1114943035 14:27640057-27640079 GAGGCAAGAATTTGGCTCACTGG - Intergenic
1117763303 14:59055675-59055697 GAGGCACTAATTACTCTGATGGG - Intergenic
1118231731 14:63957741-63957763 GAGGCAGTAACTGGGATTACAGG - Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1202941443 14_KI270725v1_random:151529-151551 GAATCTCTAACTGGGCTGACTGG - Intergenic
1124810807 15:32936364-32936386 GAGACACTAGCTGGGCTGATTGG - Intronic
1126292031 15:47091879-47091901 GAATCTCTAACTGGGCTGACAGG + Intergenic
1143525820 17:7471848-7471870 AAGGCACAAATTGGGCTTCCTGG + Intronic
1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG + Exonic
935084232 2:99828670-99828692 GAGGCAGTAATGGGACTGAAAGG + Intronic
936085068 2:109461713-109461735 GAGGCACTATTGTGGCAGACAGG - Intronic
945745113 2:213711159-213711181 GAGGCAATAAGTTGGATGACTGG - Intronic
945752863 2:213810012-213810034 GAAGCCCTAAGGGGGCTGACAGG + Intronic
1169890744 20:10449452-10449474 CAGTGACTAATTGGGCTGTCAGG - Intronic
1170443328 20:16400054-16400076 CAGGCACTCCTTGGACTGACTGG + Intronic
1171537324 20:25906681-25906703 GAATCTCTAACTGGGCTGACTGG - Intergenic
1172110512 20:32541974-32541996 GAGGCTCTACTTGGGCTGGGAGG - Intronic
1173645037 20:44628006-44628028 AAGGCACAAATTGGCCTGCCAGG + Intronic
1176581718 21:8535405-8535427 GAATCTCTAACTGGGCTGACTGG + Intergenic
1176837454 21:13806824-13806846 GAAACACTAATTTCGCTGACTGG - Intergenic
1180264553 22:10512477-10512499 GAATCTCTAACTGGGCTGACTGG + Intergenic
953818984 3:46188080-46188102 GGGGCAGTGAGTGGGCTGACTGG - Intronic
963684829 3:148420199-148420221 GAGGCAAGAATTCGGCTGAAGGG + Intergenic
971764684 4:30815274-30815296 GAGGAAATAATTAGGCTGAGGGG + Intronic
973190097 4:47376711-47376733 GAGGCACAAGCTAGGCTGACAGG + Intronic
977732611 4:100372327-100372349 TAGGCAGTAATTTGGCTAACTGG - Intergenic
982291182 4:153784408-153784430 GAGCCACAAATGGGGCTGACGGG - Intronic
985629564 5:1007656-1007678 GAGGCAGTAATTGGAGTGAAAGG + Intergenic
988819231 5:34864059-34864081 GAGGAACTAATTACGCTGAAAGG - Intronic
992188479 5:74266908-74266930 GTGGCATTGATTGGGCTGCCTGG + Intergenic
993421107 5:87701540-87701562 GAGGCACCAAGATGGCTGACTGG - Intergenic
993437601 5:87916536-87916558 GAGCTACTGATTGGGCTCACTGG - Intergenic
995409817 5:111843720-111843742 GAATCTCTAAATGGGCTGACTGG - Intronic
997823320 5:137085172-137085194 GTGGCACTACTGGGGCTGTCTGG + Intronic
1003935712 6:10973230-10973252 GAGCATCTAATTGGGCTGATAGG + Intronic
1006404304 6:33835246-33835268 GGGGCTCTGATTGGTCTGACTGG + Intergenic
1009568419 6:65346211-65346233 GAGGAACTAAGAAGGCTGACTGG - Intronic
1013042685 6:106451574-106451596 GATTCATTATTTGGGCTGACTGG + Intergenic
1015527047 6:134183955-134183977 GAGACACAAATTGTGCTGCCTGG - Intronic
1017888478 6:158620412-158620434 CAGACACTAATTCAGCTGACTGG - Intronic
1018838963 6:167505615-167505637 GAGGAGCTCATGGGGCTGACAGG - Intergenic
1021405565 7:20263338-20263360 GAGACACTAATTTTGCTGCCAGG - Intergenic
1025288802 7:57693515-57693537 GAATCTCTAATTGGGCTGACTGG - Intergenic
1026599234 7:71761914-71761936 GAATTACTAGTTGGGCTGACTGG - Intergenic
1035736071 8:1888445-1888467 GAGGCACTGAGTGGGGTGAGGGG + Intronic
1048632632 8:136260648-136260670 GAGGCACTAAAAAGGCTGAAGGG - Intergenic
1052267898 9:26595423-26595445 GAATCACTAGCTGGGCTGACTGG - Intergenic
1058772856 9:108254742-108254764 GAGACACTAAATGAGATGACAGG - Intergenic
1203611737 Un_KI270749v1:13442-13464 GAATCTCTAACTGGGCTGACTGG + Intergenic
1190072865 X:47293164-47293186 GGGACACTAATTCAGCTGACTGG - Intergenic
1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG + Intergenic
1194050023 X:89056634-89056656 GAGGCTCTATTTGTGCTGCCTGG + Intergenic
1196173156 X:112611993-112612015 AAGGAACTAATAGGGCTGCCAGG - Intergenic