ID: 1120042228

View in Genome Browser
Species Human (GRCh38)
Location 14:79767202-79767224
Sequence CAGTAGGGCTGGGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 632}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120042228_1120042236 -8 Left 1120042228 14:79767202-79767224 CCTTCTTCCTCCCAGCCCTACTG 0: 1
1: 0
2: 5
3: 68
4: 632
Right 1120042236 14:79767217-79767239 CCCTACTGGGGCCCATTCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1120042228_1120042238 -7 Left 1120042228 14:79767202-79767224 CCTTCTTCCTCCCAGCCCTACTG 0: 1
1: 0
2: 5
3: 68
4: 632
Right 1120042238 14:79767218-79767240 CCTACTGGGGCCCATTCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120042228 Original CRISPR CAGTAGGGCTGGGAGGAAGA AGG (reversed) Intronic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900471997 1:2859602-2859624 AAGGAGGGGTAGGAGGAAGAAGG + Intergenic
900482942 1:2908148-2908170 CAGCAGGGCGGGGAGGGAGCTGG - Intergenic
900862250 1:5242022-5242044 CAGGAGGGGTGAGAGGCAGAAGG + Intergenic
901401126 1:9015677-9015699 CAGCAGGGGTGGGAGGCAGACGG - Intronic
901656126 1:10770705-10770727 GGGTGGGGCTGGGAGGAAGCTGG - Intronic
901833146 1:11906340-11906362 CAGGCGGGCTGGGAAGATGAGGG + Intergenic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902126142 1:14213311-14213333 CGGAGGGGATGGGAGGAAGAGGG - Intergenic
902177285 1:14660116-14660138 CAGTGGGGCTGGGAGGGGAAGGG + Intronic
902452873 1:16509218-16509240 CGTTAGGGAAGGGAGGAAGAAGG + Intergenic
902472931 1:16661897-16661919 CATTAGGGAAGGGAGGAAGAAGG + Intergenic
902485872 1:16745543-16745565 CATTAGGGAAGGGAGGAAGAAGG - Intronic
902499609 1:16900998-16901020 CGTTAGGGAAGGGAGGAAGAAGG - Intronic
902611891 1:17602575-17602597 CAGCAGGGGTGGGGGAAAGAGGG + Intronic
903184370 1:21620871-21620893 CAGGAGGGGAGGGAGAAAGATGG - Intronic
903357200 1:22755478-22755500 CAGAAGGGCAGGGAGGAGGCAGG - Intronic
903455627 1:23484620-23484642 CAGCAGAGGAGGGAGGAAGAGGG - Intergenic
903653106 1:24932897-24932919 CAGCAGGGCTAGGAAGCAGAAGG + Intronic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904319798 1:29689472-29689494 CAGGAGGGCTGGGAGGGCAAAGG - Intergenic
904776061 1:32907395-32907417 TTGTAGAGCTGGGAGGAATAAGG - Intergenic
904971386 1:34421846-34421868 CAGAAGGGCTGACAGGCAGATGG + Intergenic
905124404 1:35707255-35707277 GAGAGGGGCTGGGAGGCAGATGG + Intergenic
905124765 1:35708545-35708567 GAGTAGGGCTGGGAGGAGGGGGG + Intergenic
905650486 1:39653175-39653197 GAGTAGGGGTAGGAGGCAGAGGG + Intergenic
905874086 1:41421377-41421399 CAGCAGGCCTGGGAAGCAGACGG + Intergenic
905966683 1:42104423-42104445 CAGTGGGCGAGGGAGGAAGAGGG - Intergenic
906065256 1:42975919-42975941 CTGTCTGGCTGGGTGGAAGAAGG + Intergenic
906685532 1:47760939-47760961 CAGCAGGACTGGGATGAAGGGGG + Exonic
907114382 1:51956076-51956098 CTGTAAGGCTGGGAGGCAGGAGG + Intronic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907466363 1:54640398-54640420 CAGGAGGCCAGAGAGGAAGAGGG + Intergenic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
907929647 1:58987553-58987575 CAGTCAGGGTGGCAGGAAGACGG + Intergenic
908021316 1:59901385-59901407 CAGTAGGGCTTGGAAGGAGGGGG + Intronic
908116276 1:60943544-60943566 CAGTAAGACTGGGAGGAACCAGG - Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
908823350 1:68111299-68111321 AACTAAGGCTGGGAGAAAGAAGG + Intronic
909032178 1:70555261-70555283 CAGTAGGGATGTGGGGCAGAGGG - Intergenic
909898964 1:81109260-81109282 CTGAAGGGCTGGCAGGCAGAGGG + Intergenic
910266136 1:85339836-85339858 CAGTTGAGCTGGAAGGAGGAGGG - Intronic
912560731 1:110549560-110549582 TGGTGGGGCTGGGAGGAAGGAGG + Intergenic
912760143 1:112359414-112359436 CAGCATGACTGGGAAGAAGATGG + Intergenic
912918508 1:113842216-113842238 AAGTAGGGGTGGGTGGGAGAAGG + Intronic
912942443 1:114056956-114056978 TAGTAGAGCTGAGAGGAAGCTGG + Intergenic
913290629 1:117268538-117268560 CATTAGTGCTAGGAGGTAGAAGG - Intergenic
913303789 1:117401513-117401535 AAGTAGGGCTGGGTGGAAAACGG + Intronic
914004927 1:143724149-143724171 CGTTAGGGAAGGGAGGAAGAAGG + Intergenic
914425151 1:147569168-147569190 AAGAAGGGCAGCGAGGAAGAGGG + Intronic
914747814 1:150512420-150512442 GAGTAGGGCTGGGAGGGTGGCGG - Exonic
915249089 1:154575981-154576003 CAGTAGTGTTGGGTGGAGGATGG + Exonic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916546584 1:165811479-165811501 CAGTGGTCCTGGGAGGAAAAGGG - Intronic
916642630 1:166747338-166747360 CAGCTGGGCTGAGAGGAACATGG + Intergenic
918040903 1:180913192-180913214 CAGCTGGCCTGGGAGGGAGAAGG + Exonic
918511412 1:185317420-185317442 CAGTAGACCAGGGAGGAAGGCGG - Intergenic
919404334 1:197158990-197159012 AAGAAGGGCTAGGAAGAAGAAGG + Exonic
919593922 1:199538175-199538197 CTGTGGGGCAGGGAGCAAGATGG - Intergenic
919651271 1:200151082-200151104 AGGTGGGGCTGGGAGGAAAATGG + Intronic
919682785 1:200453005-200453027 CAGGAGGGCAGGGAGGAGCAAGG - Intergenic
919685688 1:200481626-200481648 CAACAGGGCTGGGAAGATGAAGG + Intergenic
920368780 1:205463896-205463918 CAGGAGGCCAGGGAGGAAGCTGG - Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921527729 1:216238866-216238888 CAGTGGGGCATGGAGGGAGAAGG - Intronic
921842768 1:219846282-219846304 CAGGAGGATTAGGAGGAAGATGG + Intronic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
922477944 1:225919755-225919777 AAGTAGGGATGAGAGGAATAAGG - Intronic
922517865 1:226222191-226222213 GAGAAGGGGTGGAAGGAAGATGG + Intergenic
922675819 1:227548191-227548213 CAGTTGGGCTGTGAGGAAGTGGG + Intergenic
922705528 1:227788348-227788370 TAGTGGGGCTGGGACGAAGTGGG + Intergenic
922729573 1:227942652-227942674 CAGAAGGGCAGGGAGGAAAGGGG - Intronic
922732927 1:227961320-227961342 CACCAGGGCTGGGATGAGGATGG + Intergenic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923672439 1:236052313-236052335 CAGAAGGGCAGGGAGCAAAAAGG + Intronic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063498702 10:6533605-6533627 TATTAGGGCTGGGAGAAGGAAGG - Intronic
1063510735 10:6642843-6642865 CTGGAGGGCTGGGAGGGAGAGGG + Intergenic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1065764548 10:29015645-29015667 CTGTAGGCCTGGGAGGCAGGGGG - Intergenic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066223101 10:33355361-33355383 CAGCATGGCTGGGAGGTAGTGGG - Intergenic
1067079505 10:43205169-43205191 AAGCAGGGCAGGGAGGGAGAGGG + Intronic
1067790992 10:49287708-49287730 AAGCAGTGTTGGGAGGAAGACGG + Intergenic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1068876267 10:61999934-61999956 AAGTGGGGCTGGGAGGATGCTGG + Intronic
1070170665 10:73930353-73930375 CAGTAGGGGTGGAAGGATAAAGG + Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070809239 10:79289293-79289315 GTGAAGGGCTGGGAGGTAGAGGG + Intronic
1071304539 10:84286833-84286855 GAGTAGGGGTGGGAGGAAGGTGG + Intergenic
1071873124 10:89816719-89816741 CAGTAGGACAGGGGAGAAGATGG - Intergenic
1072507166 10:96079755-96079777 GAGTAGGGGTTGGAGGGAGAAGG + Intergenic
1072806698 10:98428016-98428038 GAGAGGGACTGGGAGGAAGATGG + Intronic
1073127978 10:101163918-101163940 CAGTAAAGCTGGGAGAAAAAAGG - Intergenic
1073458864 10:103654030-103654052 GAGCAGGGCTGGGAGAATGAAGG - Intronic
1073632563 10:105163082-105163104 CAGTAGGTGTGGGAGGAGTAGGG - Intronic
1073900025 10:108209405-108209427 CACTAGGGCTAGGAGGTAGGGGG - Intergenic
1076408110 10:130226784-130226806 CAGCAGGGGAGGAAGGAAGATGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076847328 10:133075682-133075704 CAGCAGGGCTGGCAGGAGGCTGG + Intronic
1076849628 10:133086600-133086622 CAAGAGGGCTGGGAAGAAGCGGG - Intronic
1077093588 11:790134-790156 CAGGAGGGCGGGGAGGGGGAGGG + Intergenic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077295646 11:1825183-1825205 CCGTAGGGCAGGGAGGGAGCAGG + Intergenic
1077309421 11:1881826-1881848 CAGGAGGGGAGGGAGGAAGAGGG + Intronic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077914995 11:6605652-6605674 GAGTGGGGCGGGTAGGAAGAGGG - Intronic
1078340137 11:10492791-10492813 CAGTTGTGCTTGGAGGAACAAGG + Intronic
1078795420 11:14587336-14587358 GAGTAGATCTGGGAGAAAGAAGG - Intronic
1079383165 11:19956807-19956829 CAGTAAGGCGGGGATGGAGATGG - Intronic
1079990184 11:27238227-27238249 CAGTGGGGCTGAGAGAATGAGGG - Intergenic
1080397387 11:31902718-31902740 CACTAGGCCTGTGAGGAAGAAGG + Intronic
1081771785 11:45654611-45654633 CAGTCTGGCTTGGAGGATGAGGG - Intronic
1082788447 11:57330628-57330650 CAGTGGGGCTGGGAGAGGGAGGG - Intronic
1083011979 11:59410466-59410488 TAGTAAGGCAGGGAGGAAGGAGG - Intergenic
1083271455 11:61574961-61574983 CATGAGGGGTGGGAGGCAGAAGG - Intronic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083537944 11:63489322-63489344 CAGTAGGGCTGGGATGAAAAGGG - Intronic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1083934482 11:65863196-65863218 CAGCAGAGCTGTGAGGAGGAGGG + Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084392017 11:68883472-68883494 TAGCAGGGCAGGGAGGAAGATGG + Intergenic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1085446146 11:76602567-76602589 CAGGAGGGGAGGAAGGAAGAGGG - Intergenic
1085527292 11:77171888-77171910 CAGTAGGGCAGGGAGGCGCAGGG + Intronic
1085645450 11:78219458-78219480 CAGTTAGGTGGGGAGGAAGAAGG + Intronic
1085798359 11:79564462-79564484 CAGTAGGGCTGGCTGCAGGAAGG + Intergenic
1085931914 11:81094008-81094030 CAAAAGGACTGGGAGCAAGAGGG - Intergenic
1086856111 11:91868060-91868082 CAGCAGGGCTGGGCAGAAGGAGG - Intergenic
1087271517 11:96116626-96116648 CTGCAGGATTGGGAGGAAGAAGG + Intronic
1089214715 11:116828875-116828897 CAGCAGGGATGGCAGGATGAGGG - Intergenic
1089329207 11:117678165-117678187 GAGGAGGGATGAGAGGAAGAGGG - Intronic
1089829163 11:121310141-121310163 GAGGAGGTCTGGGAGAAAGATGG + Intergenic
1090407723 11:126487220-126487242 CAGCAGGGCAGGCAGGAGGAGGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090807201 11:130210003-130210025 AAGTGGAGCTGGGAGGTAGAAGG + Exonic
1091230865 11:133987171-133987193 CAGGAAGGCAGGAAGGAAGAAGG + Intergenic
1091653351 12:2325848-2325870 CCCTAGGCCAGGGAGGAAGAGGG + Intronic
1091664550 12:2409904-2409926 AAGTAGGGCTAGGAGGAAAATGG + Intronic
1091685327 12:2557447-2557469 AAGTGAGGCTGGGAGGCAGATGG - Intronic
1093685103 12:22046285-22046307 GAGAAGGCGTGGGAGGAAGATGG + Exonic
1096228264 12:49882968-49882990 AAATAGGGTAGGGAGGAAGAGGG + Intronic
1096229016 12:49887292-49887314 GAAGAGGGCTGTGAGGAAGATGG + Intronic
1096646503 12:53040576-53040598 CAGTAGGGGAGGGAGGTAGAAGG + Exonic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1097327141 12:58289534-58289556 AAGAAGGGCTGGGAGGCAGTAGG + Intergenic
1097801864 12:63923259-63923281 CTATAAGGCTGGGAGCAAGAGGG - Intronic
1098246978 12:68530014-68530036 CAGTGGGGGAGAGAGGAAGAGGG + Intergenic
1099103966 12:78477937-78477959 AAGTAAGGCAGGGAGTAAGAAGG + Intergenic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1099959584 12:89383883-89383905 CAGTAGGGCTGGGGGCGGGAGGG + Intergenic
1101883606 12:108642485-108642507 CAGGAGGGCTGGGTGGGAGATGG - Intergenic
1101912758 12:108872819-108872841 TAGCAGGGCTTGGAGTAAGATGG + Intronic
1102021400 12:109685949-109685971 CAGCAGCCCTGGGAGCAAGAGGG + Intergenic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102850318 12:116237302-116237324 AAACAGGGATGGGAGGAAGAGGG + Intronic
1103030193 12:117606565-117606587 AAGAAGGGAAGGGAGGAAGAAGG - Intronic
1103030234 12:117606708-117606730 AAGAAGGGAAGGGAGGAAGAAGG - Intronic
1103170417 12:118813960-118813982 CTGCCGGGCTGGGTGGAAGAGGG - Intergenic
1103238949 12:119397864-119397886 AAGTGGGGCAGGGAGGAAGGGGG + Intronic
1103617187 12:122161809-122161831 CAGGAGGGTGGGGGGGAAGAGGG - Intergenic
1103957207 12:124583865-124583887 CTGTAGGCCGGGGAGCAAGAGGG + Intergenic
1104101665 12:125618305-125618327 AAGTAGGGCTGGGTGGAGGAAGG + Intronic
1104252954 12:127113304-127113326 CCAAAGGGCTGGGAGGCAGAAGG + Intergenic
1104439498 12:128783221-128783243 AAGAAGGTCTGGGAGGGAGATGG - Intergenic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104982554 12:132580736-132580758 GATTAGGGCTGGGAGGGAGTCGG + Intronic
1105541766 13:21322040-21322062 CAGTAGGGGTGGGTGTATGAGGG - Intergenic
1105746217 13:23379216-23379238 CAATAAGCCTGGGAGGAAGGTGG - Intronic
1106182495 13:27381237-27381259 CAGCGGGGCTGGGATAAAGAAGG - Intergenic
1106896880 13:34312748-34312770 CAGGATGACTGGGTGGAAGATGG + Intergenic
1108236549 13:48413928-48413950 GGGAAGAGCTGGGAGGAAGAAGG - Intronic
1108515290 13:51195806-51195828 CAGTAGGGGTGGGTGGGAGCAGG + Intergenic
1108663651 13:52608165-52608187 GAGTTAGGCAGGGAGGAAGAAGG + Intergenic
1109280343 13:60348715-60348737 GAGTAGGGCTGGCAGGGACAAGG + Intergenic
1109655643 13:65387330-65387352 TTGGAGGGCTGGGAAGAAGATGG + Intergenic
1109757663 13:66782117-66782139 GAGTGGGGCTGGGAGGAAAGAGG - Intronic
1111769256 13:92575685-92575707 CAGCAGTGCTGAGAGGAATATGG - Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112071183 13:95852241-95852263 CAGTATGGTTGGGATAAAGATGG - Intronic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1113909664 13:113836219-113836241 GAGTAGGAGTGGGAGGAGGAAGG + Intronic
1113933550 13:113981397-113981419 CAGAGAGGCTGGGAGGAAGCAGG + Intronic
1113936625 13:113998288-113998310 GAGGAGGGCTGGGAAGAGGAGGG - Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116366830 14:44077161-44077183 CAGTAGGGGAGGGAGGTACAAGG - Intergenic
1116491218 14:45505805-45505827 CAGAAGGGGTGGGAGGAGGGGGG - Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116769142 14:49106960-49106982 CAGTAGTGGTAGGAGGATGAAGG + Intergenic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1118236894 14:64014002-64014024 TAGAAGGGGTGGGAGGAGGAGGG - Intronic
1118375029 14:65169419-65169441 CAGTAGAGCTGAAATGAAGAAGG + Intergenic
1118920971 14:70149740-70149762 AAGAAGGGCTGGGAGGAGGATGG - Intronic
1119353544 14:73986622-73986644 CATGAGGGCTGGGTGGAAGAAGG - Intronic
1119879991 14:78092374-78092396 CATCAGGGCTGGGAGCAGGAGGG - Intergenic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1121096377 14:91220610-91220632 CCGTGTGGCTGGGAGGCAGATGG + Intronic
1121099211 14:91238533-91238555 CAGGAGGGCTGGCAAGAGGAGGG - Intronic
1121292848 14:92791703-92791725 CATTAGGGCAGGGAGGAGGTGGG + Intergenic
1121406233 14:93720855-93720877 CAGTGGGGATAGGAGGGAGAAGG + Exonic
1121431026 14:93888602-93888624 CTGAAGGGCAAGGAGGAAGAGGG + Intergenic
1121887941 14:97561767-97561789 CTGAAGGGCTGGGATGAGGAAGG + Intergenic
1121949788 14:98161468-98161490 CAATAAGGAGGGGAGGAAGAGGG - Intergenic
1122237821 14:100342479-100342501 CTGCAGGGCTGGGAAGAAGGTGG + Exonic
1122262249 14:100530331-100530353 CAGCAGGCCTGGGAGGAGGGAGG - Intergenic
1122268221 14:100556612-100556634 CTGTAGGGCTGGGGTGAGGATGG - Intronic
1122629347 14:103100189-103100211 CAGGAGAGCTGGGGGCAAGAAGG - Exonic
1122785404 14:104161139-104161161 CAGCAGGGCTGGGAGTTGGAGGG + Intronic
1122889178 14:104724662-104724684 GAGTAGGGGTGGGTGGAAGGAGG - Intronic
1123043121 14:105498701-105498723 CAGCAGTGCTGGGAGCGAGACGG + Exonic
1123144296 14:106112993-106113015 CATCAGGGGTGGGAGGAAGGGGG + Intergenic
1123972251 15:25518553-25518575 CAGAAGGGCTGTTAGAAAGAAGG + Intergenic
1124148876 15:27159079-27159101 GAGGAGGGCGTGGAGGAAGAGGG - Intronic
1124381410 15:29170651-29170673 CAGCAGGGGTGGGAGAGAGAAGG - Intronic
1124545925 15:30626433-30626455 CAGTAAGGTTTGGAGGAAGGGGG + Exonic
1124779445 15:32615822-32615844 CAGTAAGGTTTGGAGGAAGGGGG + Exonic
1125493045 15:40162721-40162743 GAGCAGGTCTGGGAGGAAGTGGG + Intronic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125519647 15:40340694-40340716 AGCTGGGGCTGGGAGGAAGAAGG - Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127532012 15:59852595-59852617 CAGCAGGGCTGGAAGGAACATGG + Intergenic
1127538655 15:59915515-59915537 GAGAAGGGAAGGGAGGAAGAAGG - Intergenic
1127659287 15:61085013-61085035 GAGGAGGGGTGGGAGGAAAATGG - Intronic
1127711102 15:61598946-61598968 GAGAAGGGGTGGGGGGAAGACGG + Intergenic
1127977646 15:64009967-64009989 CAGTTGGGCTGTGGGTAAGAGGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1129276760 15:74450606-74450628 CAAGAGTGCTGGGAGGAAGCAGG - Intronic
1129880563 15:79003753-79003775 CAGTGGGGCTGGGAGGCTGGGGG + Intronic
1130149546 15:81300710-81300732 CAGGAGGGCTGGGAGGTAGGAGG + Intronic
1130272219 15:82457981-82458003 CAGCAGTGCTGGCAGGAGGAGGG + Intergenic
1130464571 15:84185334-84185356 CAGCAGTGCTGGCAGGAGGAGGG + Intergenic
1130488115 15:84409470-84409492 CAGCAGTGCTGGCAGGAGGAGGG - Intergenic
1130499696 15:84488203-84488225 CAGCAGTGCTGGCAGGAGGAGGG - Intergenic
1131067053 15:89441360-89441382 GAGGAGGGAGGGGAGGAAGAGGG + Intergenic
1131175135 15:90204487-90204509 CAGTAGGGAGAGGAGGATGAGGG + Intronic
1132078606 15:98845420-98845442 GAGGAGGGAGGGGAGGAAGAGGG - Intronic
1132143307 15:99412199-99412221 CAGCAGCACTGGGAGGTAGATGG + Intergenic
1132322303 15:100934977-100934999 CAGGAAGGCTGGGAAGAAGAGGG + Intronic
1132599093 16:765990-766012 CAGGAGGTGTGGGAGGAAGAAGG + Intronic
1132700108 16:1218688-1218710 AAGCAGGACAGGGAGGAAGATGG + Intronic
1132895594 16:2228017-2228039 GAGAGGGGCTGGGAGGCAGAGGG - Intronic
1132944854 16:2527257-2527279 GAGCAGGGCTGGGAGGCAGGAGG - Intronic
1133028396 16:2998423-2998445 TAGAAGGGCTGAGAGGCAGAAGG - Intergenic
1133335825 16:5006123-5006145 GAGTGGGGCTGGGAGGTGGAGGG + Intronic
1133739400 16:8640219-8640241 CAGCAGAGCTGGGAGGATGGAGG + Intronic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1134649580 16:15898143-15898165 GAGGAGGGCTGGGAGGAGGAAGG - Intergenic
1135088011 16:19490233-19490255 CAGCAAGGCTGAGAGCAAGAGGG + Intronic
1135177465 16:20243181-20243203 GATGAGGGCTGTGAGGAAGAGGG + Intergenic
1135992995 16:27228877-27228899 CTGTAGGGGAGGGTGGAAGAGGG - Intronic
1136004090 16:27316433-27316455 CAGATGGGGTGGGTGGAAGAGGG - Intronic
1136870664 16:33804569-33804591 CACTAGCGGTGTGAGGAAGAGGG + Intergenic
1136910433 16:34140833-34140855 CGGTGGGGCGGGGAGGCAGAGGG + Intergenic
1137461725 16:48670709-48670731 CAATAAAGATGGGAGGAAGAGGG + Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1138348668 16:56335072-56335094 GAGTGGGGCTGTGAGGAACAGGG + Intronic
1138360954 16:56426454-56426476 GCTTAGGGATGGGAGGAAGAGGG + Intergenic
1138589593 16:57992488-57992510 GGCTAGGGCTGGGAAGAAGAAGG - Intergenic
1139493707 16:67301220-67301242 AGGTAGGGCTGGGAGCACGAAGG + Intronic
1139962028 16:70723690-70723712 CAGCAGGGCTGGTAGGGTGATGG - Intronic
1140451593 16:75075219-75075241 CAGTACTGCTGGCAGGAAAAAGG - Intronic
1140512360 16:75517344-75517366 CCGTTGGGATTGGAGGAAGAGGG - Intergenic
1141006904 16:80360934-80360956 CAGAATGGTTTGGAGGAAGAAGG - Intergenic
1141034259 16:80614218-80614240 CAGCAGACCTGGGAAGAAGAGGG - Intronic
1141308390 16:82888598-82888620 CAGAAAAGCTTGGAGGAAGATGG + Intronic
1141537466 16:84692431-84692453 GCAGAGGGCTGGGAGGAAGAGGG - Intergenic
1141684827 16:85564240-85564262 GAGTGAGGCTGGGAGGAAGGAGG + Intergenic
1142387986 16:89778955-89778977 GAGCAGGGCGGGGAGGAAGTGGG + Exonic
1203101508 16_KI270728v1_random:1311489-1311511 CACTAGCGGTGTGAGGAAGAGGG - Intergenic
1203141760 16_KI270728v1_random:1771611-1771633 CACTGGGGCTGGGATGATGATGG - Intergenic
1143742769 17:8966041-8966063 CAGGAGGGCTGGGCGGAGCAGGG + Intergenic
1144626270 17:16845845-16845867 GAGAAGGGCTGGAAAGAAGAGGG + Intergenic
1144880163 17:18426875-18426897 GAGAAGGGCTGGAAAGAAGAGGG - Intergenic
1144962301 17:19051720-19051742 GAGTGGGGCTGGGTGCAAGAAGG - Intergenic
1144972860 17:19122800-19122822 GAGTGGGGCTGGGTGCAAGAAGG + Intergenic
1145152071 17:20517509-20517531 GAGAAGGGCTGGAAAGAAGAGGG + Intergenic
1145251096 17:21297472-21297494 CAGCAGGGCTGGGAGTGACACGG - Intronic
1145291066 17:21546222-21546244 CAGGAGGGGAGGGAGGAAGCGGG - Intronic
1145969825 17:28950352-28950374 CAGCCTGGATGGGAGGAAGAAGG - Intronic
1146761845 17:35486277-35486299 AAGTTGGGCTGGGAGGAAAGGGG - Intronic
1147322861 17:39656631-39656653 CCGCAGTGCTGGGAGGGAGATGG + Intronic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147760656 17:42795602-42795624 CTGTAGGGCGACGAGGAAGAAGG - Intronic
1148673619 17:49431965-49431987 TGGTAGGGCAGGGAGGAATAGGG + Intronic
1148742033 17:49898406-49898428 CAGCAGGGCTGGGAGGGAAGAGG - Intergenic
1148853636 17:50566920-50566942 CAGTAGATCTCTGAGGAAGAGGG - Intronic
1149158304 17:53660777-53660799 CAGTAGGGCTGGGATCCATAAGG + Intergenic
1149419978 17:56500966-56500988 CAGTAGGGGTGGGAGTAGGCAGG + Intronic
1149596473 17:57867462-57867484 CAGTGGGACTGGGAGGACTAGGG - Intronic
1149634996 17:58159665-58159687 TAGTATGGCTGAGAGGAGGATGG + Intergenic
1150065512 17:62105648-62105670 CACTGGGGCTGGGAAGAAGGAGG - Intergenic
1150390354 17:64786527-64786549 GGGTAGGGCTGGGAGGCAGCTGG + Intergenic
1150649415 17:67000301-67000323 CAGGCTGGCTGGGAGGGAGACGG - Intronic
1150798038 17:68255208-68255230 CAGTAGGTCTGGGAGAAAGGGGG - Intronic
1151197490 17:72441839-72441861 GAGGAAGGCAGGGAGGAAGAAGG + Intergenic
1151422473 17:74007468-74007490 GAGAAGGACTGGGAGGGAGAAGG + Intergenic
1151736165 17:75941653-75941675 GGGTAGGGGTGGGAGGACGAGGG - Exonic
1152243628 17:79173688-79173710 CAGGGGGCCTGGGAGGAAAATGG + Intronic
1153499182 18:5730873-5730895 CAGGAGGGGTTGGAGGAAAAGGG - Intergenic
1153641942 18:7165103-7165125 CTGTAGGGTTGTGAGGAAGAGGG - Intergenic
1154325784 18:13389515-13389537 GAGTAGTTCTGGGAGGAAGAGGG + Intronic
1156003900 18:32417729-32417751 TAGTGGGGGTGGGAGGAAGGTGG + Intronic
1156446274 18:37239419-37239441 CAGTTAGGCTGGCAGGAAGAGGG + Intergenic
1156664308 18:39386698-39386720 CAGGAGTGCTGGAAGTAAGAGGG - Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157412660 18:47476663-47476685 CATTAGAGCTGGGAGGTAGCGGG - Intergenic
1157477787 18:48034504-48034526 GAGGAGGGCTGGGAGGAAGAGGG - Intronic
1157477792 18:48034519-48034541 GAGGAGTGCTGGGAGGAGGAGGG - Intronic
1158162355 18:54499540-54499562 GAGTAGGGATGGGGGGAATAGGG + Intergenic
1158405509 18:57156194-57156216 CAGTGGGGTTGAGAGGAGGAAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158818605 18:61132359-61132381 CAGTAGAGCTGGAAGCTAGATGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159554751 18:69933412-69933434 GACAAGGGCTGGCAGGAAGAGGG - Intronic
1160047414 18:75399920-75399942 CAGGAGGGGTGGGGGTAAGATGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160427770 18:78790173-78790195 GAGCAGGGCTGGGAGCAAGCAGG - Intergenic
1160710226 19:548062-548084 CAGCAGAGCTGGGAGACAGATGG - Intronic
1160712794 19:560404-560426 GAGGAGGGCTAGGGGGAAGAAGG + Intergenic
1160848973 19:1180623-1180645 CAGGAGGGCTGGCAGGGAGGAGG - Intronic
1161392717 19:4029473-4029495 CAGTTGCTGTGGGAGGAAGACGG + Intronic
1162285591 19:9736318-9736340 TAGAAGGGCAGGGAGGAAGGTGG + Intergenic
1162561666 19:11421103-11421125 CAGTATGGGTGGGGGGATGAAGG - Intronic
1163044119 19:14626662-14626684 CAGTAGGGCAATGAGGAAGCAGG + Intronic
1164466193 19:28489466-28489488 CAGAAGTGCTGGGAGGGAAAAGG - Intergenic
1164554320 19:29239234-29239256 AAGTAGAGCTGGGAGGCTGAGGG - Intergenic
1164555147 19:29245678-29245700 CAGCAGGCCTGGGAGGCAGATGG + Intergenic
1164682857 19:30147247-30147269 AGGAAGGGCTGAGAGGAAGAAGG - Intergenic
1166571042 19:43797612-43797634 CAGGAGGACTGGGAGGAGCAGGG + Exonic
1166742464 19:45122669-45122691 CCGTTGGGGTGTGAGGAAGAGGG + Intronic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167607305 19:50488335-50488357 CAGGAGGGGAGAGAGGAAGAGGG + Exonic
1168376309 19:55882881-55882903 TAGTAGGACTGGCAGAAAGAAGG - Intergenic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925071960 2:976809-976831 CAGTAAGGCAGGGAGGGAGACGG - Intronic
925288064 2:2728829-2728851 CGGGAGGGACGGGAGGAAGAAGG - Intergenic
925859287 2:8159539-8159561 CAGCAAGGCTGGGAGGGAGTTGG - Intergenic
926195157 2:10759263-10759285 CAGCAGAGCTGGGAGCAGGAAGG + Intronic
926447762 2:12965194-12965216 GTGAAGGGCTGGGAGGGAGAGGG - Intergenic
926700994 2:15803393-15803415 CAGTTGGGCTGAGAGGAGGATGG + Intergenic
927469998 2:23366825-23366847 GAGAAGGATTGGGAGGAAGAAGG + Intergenic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927783484 2:25956733-25956755 CACCAGGGCTAGGAGGAGGATGG + Intronic
927850854 2:26498406-26498428 CAGGAGGGGTGGGAGGCAGCAGG - Intronic
928135527 2:28684859-28684881 GGGTGGGGCAGGGAGGAAGAAGG - Intergenic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
929011306 2:37447745-37447767 CAACAGGGCAGGGAGGCAGAAGG + Intergenic
929829464 2:45335325-45335347 CAGCAGTGCTGTGAGGCAGAGGG - Intergenic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
929942234 2:46343124-46343146 CAGTAGTGCTGGGAGGGTGGGGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930806737 2:55497901-55497923 CAGCAGAGGAGGGAGGAAGAGGG + Intergenic
930944383 2:57055166-57055188 GTGGAGGGCTGGGAGGAAGGTGG - Intergenic
931813314 2:65876004-65876026 TAGAAGGGGAGGGAGGAAGAGGG - Intergenic
932757219 2:74417233-74417255 CAGGAGGGCTGGGAGTGGGAAGG + Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933494022 2:83025248-83025270 GAGTAGGCTGGGGAGGAAGATGG + Intergenic
933725326 2:85423745-85423767 CAGCAGGCGAGGGAGGAAGAGGG + Intronic
934555923 2:95286963-95286985 AGGTGGGGTTGGGAGGAAGATGG + Intronic
934603352 2:95675804-95675826 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
934603689 2:95678497-95678519 AAGAAAGGCTGGAAGGAAGATGG - Intergenic
934661025 2:96143792-96143814 CAGTGGGGCAGGCAGGCAGAGGG + Exonic
934887498 2:98037795-98037817 CAGAAAGGCTGGGAGGCAGCAGG + Intergenic
935266978 2:101403117-101403139 CAGAAGGGGTGGGAGGAAACGGG + Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936339148 2:111616111-111616133 CAGCATGGCTGGGTAGAAGAAGG + Intergenic
936514535 2:113173639-113173661 CAGAAGCGCAGGGAGGAAGGAGG + Intronic
936536734 2:113318030-113318052 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
936537070 2:113320735-113320757 AAGAAGAGCTGGAAGGAAGATGG - Intergenic
937442200 2:121926155-121926177 CAGATGGGTTGGGAAGAAGAAGG - Intergenic
938124960 2:128664753-128664775 CAGGAGGGCAGTGAGGAAGCTGG + Intergenic
938393161 2:130921017-130921039 GGGTAGGGCAGGGAGGAGGAAGG - Intronic
940458225 2:153929294-153929316 CAGTAGGGCTGGGATAAGGCCGG - Intronic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941207142 2:162588054-162588076 CAGGAGCGATGGGAGGAAGGAGG - Intronic
942772959 2:179545014-179545036 CTGTAGGTTTGGGAGGGAGATGG - Intronic
943340200 2:186671548-186671570 AAGTGGGGTTGGGAGGTAGAAGG - Intronic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
944222604 2:197317420-197317442 GGGTGGGGCTGGGAGGGAGAAGG + Intergenic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
944648269 2:201802345-201802367 GAGAAGGGATGAGAGGAAGATGG - Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
946036246 2:216744692-216744714 CTGAAGTGCTGGGAGGAAAATGG - Intergenic
946471798 2:219967351-219967373 AGGAAGGGCTGGGAGGAAGCAGG - Intergenic
946865002 2:224034790-224034812 CAGGGGGGCTGCGAGGAAGTGGG + Intronic
947337609 2:229103441-229103463 CAGTAGGGCTGTCAGTGAGAGGG - Intronic
948331480 2:237170154-237170176 CAGACTGGCTGGGAGGAACATGG + Intergenic
948499645 2:238382545-238382567 CAGCAGGTCGGGGAGGATGAGGG + Intronic
948647005 2:239411656-239411678 CAGTAGGACAGGGCAGAAGAGGG + Intergenic
949043716 2:241860767-241860789 CAGTGGGACTGAGAGGAGGAGGG - Intergenic
1169077417 20:2769739-2769761 AAGTAGGGCTGGTATAAAGACGG - Intergenic
1169118831 20:3083543-3083565 CAGCAGGGCGAGGAGGAAGGAGG - Intronic
1169202326 20:3717785-3717807 CAGAAGGGCTGGGAACAGGATGG + Intergenic
1169204418 20:3732203-3732225 CAGTAGGGGTGGGAGGAGAGAGG + Intergenic
1169513950 20:6296397-6296419 GAGTGAGGCTGGGAGGAAGACGG - Intergenic
1169762493 20:9111564-9111586 CAGAATGGGTGGGTGGAAGATGG - Intronic
1169874872 20:10286245-10286267 GAGTTGGGGTGGGAGCAAGAAGG + Intronic
1170007004 20:11680541-11680563 CACTAGGGCTGGGATGAGGGTGG - Intergenic
1170501916 20:16982780-16982802 CAGGAAGGGAGGGAGGAAGAAGG - Intergenic
1171152811 20:22842657-22842679 TAGTAGGGCTGGGAGCAAGGTGG + Intergenic
1171394357 20:24821966-24821988 GAGTGGGGATTGGAGGAAGATGG - Intergenic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172106927 20:32522561-32522583 CAGTAGGCCAGGCAGCAAGAAGG + Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172699302 20:36843117-36843139 CGCTGGGGCTGGGAGGAAGGGGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1174105700 20:48160978-48161000 CAGGAGGCCTGGGAGGAGCATGG - Intergenic
1174926859 20:54769927-54769949 CAGAAGCGCAGGGAGGAAAAAGG + Intergenic
1175292973 20:57890636-57890658 CAGCAGACCTGGGAGGTAGAAGG - Intergenic
1175502245 20:59458811-59458833 CACTAGGTCAGGGAGGAGGAAGG - Intergenic
1175925389 20:62468822-62468844 CAGCAGAGCTGGGAGGGAGATGG + Intronic
1176047249 20:63099350-63099372 CAGGAGGGAAGGGAGGAAGAAGG - Intergenic
1176891411 21:14324167-14324189 AAGGAGGGCAGGAAGGAAGAGGG + Intergenic
1177047716 21:16191163-16191185 CAGTAGGAGAGAGAGGAAGATGG - Intergenic
1177660036 21:24070895-24070917 CAGGAGGGGTGGGAGAAGGATGG - Intergenic
1178677016 21:34639525-34639547 CTGTAGTGCTGGGAGTAACATGG - Intergenic
1179040065 21:37795027-37795049 CAGTAAGGCTGGTATGAAGTAGG + Intronic
1179217459 21:39380136-39380158 CAGTAGGGATGGGTGCTAGAAGG + Intergenic
1179725124 21:43337707-43337729 CAGTACAGGTGGCAGGAAGAGGG - Intergenic
1180877534 22:19181683-19181705 CAGCAGTGCTGGGAGAATGAGGG - Intronic
1181695711 22:24591930-24591952 GAGAAGGGAAGGGAGGAAGAAGG + Intronic
1181997999 22:26898097-26898119 CTGTAGGGCCAGGAGCAAGATGG + Intergenic
1182322732 22:29489081-29489103 GAGGAGGGCAAGGAGGAAGAAGG + Exonic
1182395603 22:30033780-30033802 TAGTTGGGTTGGGAGGAAGGGGG + Intergenic
1182469437 22:30539004-30539026 CACTCGGGCTGGGAGGATCAGGG + Intronic
1182546445 22:31079447-31079469 CAGTAGGGCAGGGAGAAAGGAGG + Intronic
1182978398 22:34645201-34645223 CACAAGGGGTGGGAGGCAGACGG + Intergenic
1183045503 22:35216404-35216426 CAGTAGGGTTGGGAGCCAGATGG - Intergenic
1183100411 22:35580391-35580413 CAGTGGAGCTGGGAGGAAAGAGG - Intergenic
1183674643 22:39292521-39292543 GTGTAGGGTTGGGAGGAGGAAGG - Intergenic
1183901595 22:41009887-41009909 CAGCAGGGCAGTGAGGAGGAGGG - Intergenic
1183978686 22:41527444-41527466 CACTAGGGATGGGATGAGGATGG - Exonic
1184130230 22:42513116-42513138 CAGCAGAGCTGGGAGGGGGATGG - Intronic
1184140406 22:42574939-42574961 CAGCAGAGCTGGGAGGGGGATGG - Intergenic
1184247866 22:43244826-43244848 CTGAGGGGCAGGGAGGAAGAAGG - Intronic
1184425360 22:44406041-44406063 CAGGAGGCCTGGGAGAATGAAGG - Intergenic
1184515112 22:44956995-44957017 CAGGAGGGCTGGGACGAGGATGG - Intronic
1184594676 22:45506597-45506619 GGGTAGGGCTGGGAGGATGGGGG + Intronic
1184884387 22:47333414-47333436 CTCTAGGGCACGGAGGAAGAGGG + Intergenic
1184980064 22:48089599-48089621 CAGCAGGGGTGGGAGGCAGGCGG + Intergenic
949167421 3:959192-959214 CAGTATGGGAGGGAGGTAGAAGG - Intergenic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950122596 3:10491579-10491601 CAGTAGGGCTGGCAGCAACAAGG + Intronic
952057377 3:29464230-29464252 CAGTAAGACTGGGAGGTAGGAGG + Intronic
952927888 3:38335145-38335167 CAGTAGGGTAGGGAGGTGGAAGG + Intergenic
953449684 3:42995860-42995882 GAGTGGGGCTGGGATCAAGAGGG - Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954416444 3:50395700-50395722 TAGCAGGGCAGGGAGGAAGGTGG + Intronic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955035925 3:55267733-55267755 CAGGAGGGCTGAGAGGAAAGGGG - Intergenic
955059840 3:55485173-55485195 GAGCAGGGGTGGGAGGGAGAGGG + Intronic
956015915 3:64882390-64882412 CAGAAGGAGTGGGAGGAAGGAGG - Intergenic
956736607 3:72243392-72243414 CAGGTGGGCTGGGAGGAGGAGGG + Intergenic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
958783645 3:98573500-98573522 AAAAAGTGCTGGGAGGAAGAAGG - Intronic
958785670 3:98593882-98593904 GAGTAGGGCTGGGAGGCTGAGGG + Intergenic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960162137 3:114361926-114361948 CAGTAGTGCTGGCAGTCAGAAGG + Intronic
960823920 3:121762495-121762517 CTGGAGGGTTGGGAGGAATAGGG - Intergenic
961045508 3:123705145-123705167 CTGGATGGCTGGGAGGAAGCCGG - Intronic
961141856 3:124562790-124562812 CAGGAGGGCATGGAGGAAGGGGG - Intronic
961317910 3:126052939-126052961 CAGGAAGCCTGGGCGGAAGACGG + Intronic
961486121 3:127217962-127217984 GTGCAGGGCAGGGAGGAAGAGGG - Intergenic
962464893 3:135649035-135649057 CAGTAGTGAGGGGAGGGAGATGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962668664 3:137682670-137682692 CAGTTGGGGTAGGAGGTAGAAGG - Intergenic
962692930 3:137918865-137918887 CACTAGGGTTGGGAGAGAGATGG - Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
962768228 3:138586689-138586711 CAGGTGGGCTGAAAGGAAGAGGG + Intronic
962859747 3:139389008-139389030 AAGAAGGGTTGGGAGGAAGGGGG - Intronic
964768708 3:160202690-160202712 CAGCAGGGCTGGGGTCAAGATGG - Intergenic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966431414 3:179834571-179834593 GAGTAGGGCCGGGAGAGAGAAGG + Intronic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966917776 3:184594384-184594406 CACTGGGGCTGGGAGGGGGAAGG - Intronic
967113629 3:186317638-186317660 CTGTAGGGCAGGGAGGGAGAAGG - Intronic
968704960 4:2073417-2073439 CACTGGGGCTGGGAGGATGGGGG + Intronic
968947357 4:3672252-3672274 CAGGAGGACAGGGAGGCAGAGGG - Intergenic
969309538 4:6345482-6345504 CATTAGGGGTGGCAGGAACAAGG + Intronic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
969392846 4:6902367-6902389 AAGTAGGGATGAGAGGAGGATGG + Intergenic
969425064 4:7119449-7119471 CTGCAGCCCTGGGAGGAAGAGGG - Intergenic
969459887 4:7323525-7323547 CAGGAGGGCTGGGAGGATGTGGG + Intronic
969904696 4:10383186-10383208 TAGTAGAGCTGTGAGAAAGAGGG + Intergenic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
970195565 4:13547551-13547573 GAGGAGGGGAGGGAGGAAGAAGG - Intergenic
970203660 4:13634121-13634143 CAGTAAGGCAGAGAGGACGAAGG + Intergenic
970444584 4:16113028-16113050 CAGTGAGGCTGGGAGGAAACAGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971483027 4:27131177-27131199 CAGTAGGGGAGTGGGGAAGAGGG + Intergenic
971692222 4:29851186-29851208 CATTATGGCTTGGAGGAAGGTGG + Intergenic
971757341 4:30720970-30720992 CAGTGGGGCTGGGAAGAGGTGGG - Exonic
972330782 4:38062870-38062892 TAGGAGGGCTGAGGGGAAGAGGG + Intronic
972336666 4:38113045-38113067 TAGCAAGGCTGGGAGGAAGGTGG + Intronic
973026358 4:45277147-45277169 CATTTGGCCTGGGAGAAAGAGGG + Intergenic
975801037 4:78058980-78059002 CCGGCGGGCTGGGAGGAAGACGG + Intronic
976831057 4:89314424-89314446 CAGTAAGGCTGGGGAAAAGAGGG + Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977982113 4:103336481-103336503 CAGGAAGGCAGGGAGGAGGAAGG - Intergenic
977988057 4:103408653-103408675 CAGTAAGGCTCGAAGAAAGAGGG - Intergenic
978261100 4:106760421-106760443 CAGTAAGGATGGAAAGAAGATGG + Intergenic
978751098 4:112248796-112248818 CAGAATGGCTGGAATGAAGAAGG - Intronic
978964976 4:114729530-114729552 GCGTATGGCTGGCAGGAAGATGG + Intergenic
981529818 4:145741463-145741485 TAGTAGGGATGGTATGAAGATGG + Intronic
983565235 4:169143661-169143683 CAGTAGGACAGGGAGGAACACGG + Intronic
983724990 4:170910150-170910172 AAGTAGGGCTGAGAGGAAAATGG + Intergenic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
983997557 4:174204287-174204309 CAGCAGGCCTGGGAGGATGAAGG - Intergenic
984450407 4:179893673-179893695 ATGTAGGGGTGGGAGGAAAAGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985005060 4:185526120-185526142 GAGCAGGGCATGGAGGAAGATGG + Intronic
985040225 4:185884026-185884048 CAGGAGGTGGGGGAGGAAGAAGG + Intronic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
986173801 5:5334761-5334783 CAGTGCGGCTGGGAGGGAGCTGG - Intergenic
986263237 5:6167358-6167380 CAGCAGGACTGGGCAGAAGAGGG - Intergenic
986645481 5:9912426-9912448 CAGGAGGGTTGGGAAGAATATGG - Intergenic
987053398 5:14167223-14167245 CAGTAACTCTGGGGGGAAGATGG + Intronic
987075661 5:14379830-14379852 CAGAACGGCTGGAAGGCAGATGG - Intronic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
987384144 5:17313203-17313225 AGGTAGGGATGGGAGGAAGTAGG - Intergenic
988284545 5:29194483-29194505 GAGAAGGGGTGGGAGGAAAAGGG - Intergenic
988780867 5:34520868-34520890 CATTAGGGTTGGGGAGAAGAGGG - Intergenic
989144802 5:38238197-38238219 CAGTGGGCCTCTGAGGAAGAAGG + Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
991276333 5:64851387-64851409 CTGGAGGGGTGGGAGGAATAGGG + Intronic
991585023 5:68193279-68193301 GAGGAGGGCTGGGAGGTACAAGG - Intronic
992408297 5:76480328-76480350 AAGTATGGCTGCGAGAAAGAAGG - Intronic
992583436 5:78206506-78206528 CAGTAGGGCAAGGAGGAAGAAGG + Intronic
994750136 5:103727091-103727113 CAGAAGGTCTGGGGTGAAGATGG + Intergenic
995080233 5:108042406-108042428 ATGTAGGGGTGGGAGGAAAATGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997867784 5:137479943-137479965 TGGTAAGCCTGGGAGGAAGAGGG + Intronic
998034410 5:138901996-138902018 CAGGAGGCCTGGGAGGAGGAAGG - Intronic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
999457866 5:151732867-151732889 CAGGAGGGCAGGGAAGCAGAGGG + Intergenic
999901923 5:156094416-156094438 CAGTTGGGATGGGAGGATAAGGG - Intronic
1000111649 5:158113781-158113803 GAGTAGGGCTTTGGGGAAGAAGG - Intergenic
1000957443 5:167559676-167559698 CTGTAGGGGTGGGAGTAAGGGGG + Intronic
1001223474 5:169924073-169924095 CAGCAGGGCAGGGAGGAAGAGGG - Intronic
1001447724 5:171798808-171798830 CAGGCAGGCTGGGAGGAAGTGGG - Intergenic
1002159977 5:177309327-177309349 CAGGAAGGCTGGGAGGAGGCCGG + Intronic
1002317079 5:178350232-178350254 AGGCAGGGCTGGGAGCAAGAAGG - Intronic
1003220092 6:4153492-4153514 CAGCAGTGCTGGGAGAGAGAGGG + Intergenic
1003410389 6:5856753-5856775 CAGTAGGGGTGGGTGTATGAGGG + Intergenic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1004735901 6:18406235-18406257 CAGGAGTGCTGTGGGGAAGAGGG + Intronic
1005504392 6:26457477-26457499 CAGGAGGGCTTGGGGGAAGCTGG - Intergenic
1006439124 6:34042443-34042465 GAGGATGGCTGGGAGGAGGAAGG + Intronic
1006731130 6:36236857-36236879 CTGTAAGGCTGGTTGGAAGAGGG + Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007507325 6:42346116-42346138 CAAGAAGGCTGCGAGGAAGAGGG + Intronic
1010658130 6:78536764-78536786 CAGAAGAGCTTGGAGGCAGAAGG + Intergenic
1011816805 6:91201124-91201146 CATGAGGGCTTGGAGAAAGAAGG - Intergenic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1017021372 6:150142992-150143014 GAGGAGGGCGGGGAGGACGACGG - Intergenic
1017266795 6:152455457-152455479 CAGGAGGGCCTGGAGGAAAAGGG - Exonic
1017821877 6:158054870-158054892 CAGCCTGGCTGGGAGTAAGAAGG + Intronic
1017856393 6:158353132-158353154 CAGGAGGCCTGGGAGGTCGATGG - Intronic
1018825115 6:167403065-167403087 CAGTTGAGCTGGGAGGCTGAAGG - Intergenic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019432688 7:1006834-1006856 CAGCAGGGCTGGGGAGAGGAGGG - Intronic
1019527547 7:1487508-1487530 AAGCAGGGATGGGAGGAGGAGGG - Intronic
1019691106 7:2413213-2413235 CGGAGGGACTGGGAGGAAGAGGG - Intronic
1019716427 7:2541477-2541499 CGCTGGGGCTGCGAGGAAGAGGG + Exonic
1019834844 7:3372548-3372570 CAGGAGGGCAGAGCGGAAGAGGG + Intronic
1020038558 7:4982646-4982668 CAGGAGGTCTGGCAGAAAGAGGG - Intergenic
1020156745 7:5731818-5731840 CAGGAGGTCTGGCAGAAAGAGGG + Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021838880 7:24706377-24706399 CTGTAGGGCAGGGAAGAAGAAGG + Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022762843 7:33375672-33375694 CAGTTGAACTGGGAGGCAGAGGG - Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023590865 7:41779215-41779237 CAGTAGGGATTGCGGGAAGAAGG + Intergenic
1023595755 7:41828188-41828210 CAGAAGGGCTGGGCAGAGGAAGG + Intergenic
1023767927 7:43529264-43529286 CAGGAGGCCTGGGATGAAGGAGG - Intronic
1023981647 7:45073986-45074008 CAGCAGGGCAGGGTGGAAGTTGG - Intronic
1024139898 7:46451746-46451768 CAGCAGGGCAGGGAGTAAGGAGG + Intergenic
1024747612 7:52426724-52426746 CTATAGGGGTGGGAGGGAGAAGG - Intergenic
1025198770 7:56949632-56949654 GAGAAGGGGTGGGAGGAGGAGGG - Intergenic
1025673176 7:63627301-63627323 GAGAAGGGGTGGGAGGAGGAGGG + Intergenic
1027170183 7:75866395-75866417 CAGCAGGGTTGGGAGGGAGTTGG + Intronic
1027223276 7:76227550-76227572 CAGCAAGGCTGGGAGGGAGCAGG - Intronic
1027422697 7:78032893-78032915 CAAGAGGACTGGGAGGTAGAAGG + Intronic
1029425996 7:100494225-100494247 AGGAAGGGATGGGAGGAAGAGGG + Exonic
1029435590 7:100562436-100562458 CGATGGGGCTGGGAGGAACATGG - Intronic
1029436817 7:100568305-100568327 CAGCAGGACTGGGAGGGGGAGGG + Intergenic
1029959029 7:104669926-104669948 CAGTAGGGGAGGGAGGTAGAAGG + Intronic
1032083467 7:128871279-128871301 CAGGAGGCCTGGGAGTGAGAAGG + Intronic
1033262471 7:139855625-139855647 CAGCAGTGCTAGGAGGAAGTGGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033563989 7:142560988-142561010 CAGGACTGCTGGGAGGTAGAAGG - Intergenic
1033564375 7:142564302-142564324 CAGGACTGCTGGGAGGTAGAAGG - Intergenic
1033810874 7:145009441-145009463 CAGTATGCATGGGATGAAGATGG - Intergenic
1034293200 7:149948528-149948550 CTGGAGGGCTGGGATGGAGAGGG - Intergenic
1034812874 7:154148351-154148373 CTGGAGGGCTGGGATGGAGAGGG + Intronic
1034880553 7:154759334-154759356 CAGTAGGGAAGGGAGAAGGAGGG + Intronic
1035051513 7:156001525-156001547 CAGTAGGGTTGGGAGTCAGTAGG + Intergenic
1035270704 7:157718457-157718479 CTGCAGGGTTGGGAGGAGGAAGG - Intronic
1035776133 8:2190191-2190213 CAGAAAGCCTGGGAGGAGGAGGG + Intergenic
1035935307 8:3830694-3830716 CAGCAGGTCTGGGAGGAATTGGG - Intronic
1036760261 8:11503825-11503847 CAGCAGGGGAGGGTGGAAGATGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037636049 8:20701756-20701778 CAGTGGGGCTGGCAGGAGCAGGG + Intergenic
1037874939 8:22539277-22539299 CAATTGGGGTGGGAGGAATATGG - Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038531509 8:28321548-28321570 AAGTAAGGATGGAAGGAAGAAGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038831888 8:31071185-31071207 GAATAGGGCTGGGCGGATGAAGG + Intronic
1039105350 8:33983685-33983707 CCGTAGGGCTGGGTGGATGGGGG - Intergenic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039804208 8:40984793-40984815 CAGTGGATCTGGGAGGAAGTAGG - Intergenic
1040604048 8:48912213-48912235 CAGTGGGGCTGGGAAGCAGCTGG - Intergenic
1040638738 8:49306272-49306294 CAGTATGGCTGGTTGGGAGATGG - Intergenic
1040978136 8:53216477-53216499 CAGTAAATCTGAGAGGAAGAAGG + Intergenic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041600965 8:59716931-59716953 CTGAAGGCCTGGGAAGAAGAAGG - Intergenic
1042862194 8:73326164-73326186 CAGTAGGGGTTGGGGGAACAGGG + Intergenic
1043527573 8:81112655-81112677 CAGTAGGCCTGGGATAATGAGGG + Intergenic
1044269022 8:90218295-90218317 CAGTGGGGCTGAGAGGAGGTTGG - Intergenic
1045870524 8:106921981-106922003 CAGTAGGTCAGGGAGGAAGCTGG - Intergenic
1046526756 8:115390625-115390647 TAACAGGGCTGGGAGGAAGTGGG - Intergenic
1046732998 8:117745919-117745941 TAGTAGGACTGGGAGGGAGTGGG - Intergenic
1047106862 8:121741756-121741778 CAGTAGGGCTATGAAGAAAAAGG - Intergenic
1047868657 8:129057845-129057867 GAATAGGGATGGCAGGAAGAAGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049199785 8:141334434-141334456 CAGTGGGGCTGGGACAGAGAGGG - Intergenic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049508928 8:143018268-143018290 CAGCAGGGCCGGGTGGAAGGAGG + Intronic
1049577473 8:143396401-143396423 CAGTGGGGCTGAGAGGAGGCTGG + Intergenic
1049611506 8:143558249-143558271 CAGGCGGGCTGGCGGGAAGAGGG + Intronic
1049657351 8:143804699-143804721 GCAGAGGGCTGGGAGGAAGAGGG + Exonic
1051032479 9:12698466-12698488 CAGTAAGGAAGGGAGAAAGAAGG - Exonic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1051443940 9:17120352-17120374 CAGTAGGGGTTGGAGAAAGAGGG + Intergenic
1051681471 9:19611784-19611806 TACTAGGGATGGGAAGAAGAAGG + Intronic
1051858039 9:21592076-21592098 CAAGAGGGCTGGGAGGTAGGTGG + Intergenic
1051998008 9:23242707-23242729 CAGTAGGGCCAGGAGGGAGAAGG + Intergenic
1052077321 9:24159223-24159245 GTGGAGGGCTGGGGGGAAGATGG - Intergenic
1052267516 9:26591344-26591366 CAGGAGGGCTCAGAAGAAGATGG - Intergenic
1054864744 9:69988504-69988526 CAATAGTGCTGCTAGGAAGATGG - Intergenic
1056578409 9:87872808-87872830 CCCTGGGGCTGGGAGGAAGGTGG - Intergenic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056691091 9:88809217-88809239 CAGGAGAGCGGGGAGGGAGAGGG - Intergenic
1057147861 9:92770514-92770536 CAGCAGAGGTGGGAGGGAGAGGG + Intergenic
1057710608 9:97439530-97439552 GAGTAGGGCTGGGGTGAGGAAGG - Intronic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1058450448 9:105091458-105091480 CAGTTGGGCAGAGAGAAAGAAGG - Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1060801271 9:126547345-126547367 CAGGAGGGGAGGGAGGAGGAAGG - Intergenic
1060952578 9:127613044-127613066 CAGGAGGGTGGGGAGGAGGAGGG - Intronic
1061085045 9:128393585-128393607 GAGTGGGGGTGGGAGGACGAGGG - Intergenic
1061114894 9:128603831-128603853 CAGTAGGGCAGGGAGCTGGAAGG + Intronic
1061164576 9:128914826-128914848 CAGCAGGGCAGGGAAGAAGCTGG + Intronic
1061233214 9:129326940-129326962 CAGCAGGGCTGGGTGGGAGTGGG + Intergenic
1061263260 9:129491466-129491488 CTGAAGGGCAGGGAGGATGAGGG - Intergenic
1061385912 9:130289320-130289342 CAGTAAGGGCGGGCGGAAGATGG + Intronic
1061655172 9:132083902-132083924 CGGTCAGGCTGGGAGGAAGTGGG - Intergenic
1062003006 9:134226206-134226228 CAGGGGGGCTGGGAGGCAGGGGG + Intergenic
1062532755 9:137009109-137009131 CTGTAGGGCTGGGAGGCTGGGGG - Intronic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1186130724 X:6462600-6462622 CAGTTGGGCAGTGAGGAAGGCGG - Intergenic
1186280913 X:7992104-7992126 CAGTAGAGATTGGAGGAAGAAGG + Intergenic
1186281149 X:7994671-7994693 CAATGGAGCAGGGAGGAAGAAGG + Intergenic
1186873104 X:13791825-13791847 ACGTAGGGCTGGCAGGAACAAGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1189303004 X:39966375-39966397 CAGGAGGCGTGGGAGGAAGAAGG + Intergenic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1190292422 X:49001570-49001592 CATTAGGCCTGGGGTGAAGAAGG - Intronic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190473231 X:50803515-50803537 AGGTAGGCCTGGGAGGAAGAAGG - Intronic
1190739676 X:53280750-53280772 CAGCAGGGCAGGGAGGCTGAGGG + Intronic
1192859247 X:75048285-75048307 GGGTAGGGCTGGGTGGCAGAAGG + Intergenic
1194512787 X:94816151-94816173 CAGAAGGGCGGGGAGGTAGAAGG - Intergenic
1195732835 X:107982716-107982738 CAGTTGCCCTTGGAGGAAGAGGG + Intergenic
1195800555 X:108704360-108704382 TCGTAGGGCTGAGAGGAGGAAGG - Intergenic
1196079810 X:111619302-111619324 CAGTAGGGGAGGGAGGGAGAAGG - Intergenic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1196583959 X:117408638-117408660 CACAAAGGCTGGGATGAAGAGGG + Intergenic
1197776459 X:130121546-130121568 CTGTCGGGACGGGAGGAAGAGGG - Intergenic
1198546558 X:137698374-137698396 CAGTAGGGTAGAGAGGTAGAAGG + Intergenic
1198770009 X:140120463-140120485 GAGTAGTGTTGGGAGGAAGTGGG - Intergenic
1198934778 X:141894914-141894936 CCGAAGGGGTGGGAGGAAGTTGG + Intronic
1199740734 X:150733920-150733942 GAACAGGGCAGGGAGGAAGATGG + Intronic
1201400508 Y:13599461-13599483 TAGTAGAGCTGTGTGGAAGAGGG + Intergenic
1202370651 Y:24193339-24193361 CAGCAGTGCTGGCAGGAGGAGGG - Intergenic
1202375670 Y:24234092-24234114 CAGGAGGGCTGGGATGAAAGAGG + Intergenic
1202495110 Y:25436026-25436048 CAGGAGGGCTGGGATGAAAGAGG - Intergenic
1202500133 Y:25476778-25476800 CAGCAGTGCTGGCAGGAGGAGGG + Intergenic