ID: 1120042988

View in Genome Browser
Species Human (GRCh38)
Location 14:79774565-79774587
Sequence ATTCATTAACGGTCTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120042988_1120042990 29 Left 1120042988 14:79774565-79774587 CCATAATCAGACCGTTAATGAAT 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1120042990 14:79774617-79774639 AAGCATATCCAGTCTCTCCATGG 0: 1
1: 1
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120042988 Original CRISPR ATTCATTAACGGTCTGATTA TGG (reversed) Intronic
902065958 1:13687795-13687817 AATCAATAACATTCTGATTAAGG - Intergenic
908577254 1:65473612-65473634 ATTCATTAGCTGTCAGATTCGGG + Intronic
911867200 1:103044085-103044107 TTTCATTAATCTTCTGATTATGG - Intronic
916274886 1:162983049-162983071 ATTCATTGATGGTCCGAATATGG - Intergenic
917572656 1:176284934-176284956 ACTCATTATTGGTCTGTTTAGGG + Intergenic
917621233 1:176798404-176798426 ATTGAATAACTGACTGATTAGGG + Intronic
1062876412 10:946390-946412 ATTCTTAAATTGTCTGATTAGGG + Intergenic
1068053276 10:51979671-51979693 GTTCATTATTGGTCTGATCAGGG + Intronic
1068075668 10:52249924-52249946 ATTCAACAACGATCTCATTAAGG + Intronic
1068218598 10:54014231-54014253 ATTCATTATTGGTCTGTTTAGGG - Intronic
1068325528 10:55481014-55481036 ACTCATTATTGGTCTGATCAGGG + Intronic
1070804071 10:79260394-79260416 ATTCATAAACGGTCAGGTCAGGG + Intronic
1071611441 10:87035083-87035105 ATTCATTATTGGTCTGTTCAGGG + Intergenic
1085856063 11:80177572-80177594 AGTCATTATTGGTCTGTTTAGGG + Intergenic
1086293137 11:85334109-85334131 ATTCATTATTGGTCTGTTCAGGG + Intronic
1086577357 11:88354756-88354778 ATTCATTACAGGTCAAATTAGGG + Intergenic
1088442144 11:109882596-109882618 ATTCATTAACACTTTCATTATGG - Intergenic
1089794395 11:120968502-120968524 ATTCATTCACTGTCTCATCAGGG - Intronic
1094011771 12:25817200-25817222 ATTCATTTACAGTCAGATCAGGG - Intergenic
1094408137 12:30140699-30140721 ATTCCTTAATGTTCTGAATAAGG + Intergenic
1095784500 12:46094627-46094649 ATTCATTGAGAGTCTTATTATGG - Intergenic
1098056282 12:66509280-66509302 ATTCACTAACAGTTTGGTTAAGG + Intronic
1098508090 12:71278373-71278395 ATTCATAAACAGTGTGTTTAGGG - Intronic
1104127144 12:125858609-125858631 ATTCATTAATTGTCTGACTTGGG + Intergenic
1107230754 13:38107247-38107269 AGTCATTATTGGTCTGTTTAGGG - Intergenic
1109361766 13:61302608-61302630 ATTCATTATTGGTCTGTTCAGGG - Intergenic
1109625933 13:64974393-64974415 ACTCATTATTGGTCTGTTTAGGG + Intergenic
1111338349 13:86850881-86850903 GTTCATTATTGGTCTGTTTAGGG - Intergenic
1113540549 13:111104667-111104689 ACTCATTATTGGTCTGTTTAAGG - Intergenic
1114922887 14:27357217-27357239 AGTCATTAATGGTGTTATTAAGG + Intergenic
1115839977 14:37459479-37459501 ACTCATTACAGGTCTGATCAGGG - Intronic
1120042988 14:79774565-79774587 ATTCATTAACGGTCTGATTATGG - Intronic
1120512788 14:85435634-85435656 ATTTATTAACTGTATCATTATGG - Intergenic
1128372165 15:67048469-67048491 ATTAATTAACGGCTGGATTAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134889095 16:17822906-17822928 ACTCATTATCGGTGTGGTTATGG + Intergenic
1134889122 16:17823156-17823178 ATTCATTATCAGTATGGTTATGG + Intergenic
1149037340 17:52149557-52149579 ATCCTTTAAAGGTCTGTTTAAGG + Intronic
1152049910 17:77965455-77965477 ATTTATTAAGGCTCTGATTTGGG - Intergenic
1152364713 17:79848995-79849017 GCTCATTAGCAGTCTGATTAGGG + Intergenic
1154153968 18:11929406-11929428 ATTCCTTAACGGTCTCAGAAGGG - Intergenic
1156003316 18:32410626-32410648 ATTAATTAACTATATGATTATGG + Intronic
1156784064 18:40888838-40888860 ATTCATTAATAATTTGATTATGG + Intergenic
1159723482 18:71923039-71923061 ATTCATTATTGGTCTATTTAGGG - Intergenic
928194595 2:29206131-29206153 ATTCATGAAAGGTCTGTTTAAGG - Intronic
931921481 2:67021242-67021264 ATTCATTATTGGTCTGTTCAGGG - Intergenic
935021005 2:99231704-99231726 ACTCATTATCGGTCTGTTCAGGG - Intronic
936761199 2:115785513-115785535 AATCATTATCGGTCTGTTCAGGG + Intronic
937688873 2:124731108-124731130 ATTCATTAGAGGTCTGAGCAAGG - Intronic
939202648 2:139057870-139057892 ATTCATTAATGTTCTAGTTAAGG + Intergenic
940456659 2:153910116-153910138 ATTCATTATTGGTCTGTTCATGG + Intronic
945613216 2:212032075-212032097 TTTCATTAATGGTCTGAATCTGG - Intronic
946272820 2:218608403-218608425 ATTCATTAACAGTTTGTTGAGGG + Intronic
947261220 2:228224626-228224648 ACTCATTAACTGTGTGATTTTGG + Intergenic
947505639 2:230706391-230706413 TTTCATAGATGGTCTGATTAAGG + Intergenic
1176325902 21:5500817-5500839 ATGGATTAACGTTCTTATTATGG + Intergenic
1176401855 21:6320134-6320156 ATGGATTAACGTTCTTATTATGG - Intergenic
1176435302 21:6668970-6668992 ATGGATTAACGTTCTTATTATGG + Intergenic
1176459564 21:6996040-6996062 ATGGATTAACGTTCTTATTATGG + Intergenic
952590744 3:34951013-34951035 ATTCATTATCGGTCTGTTCAGGG - Intergenic
959246994 3:103883473-103883495 ATTCACTTACTGTCTGATTTTGG + Intergenic
959517432 3:107285136-107285158 ATTCCTTAACTGACTGGTTAGGG - Intergenic
960371229 3:116842860-116842882 ATTTATTAAGGGTGTGATTAAGG - Intronic
960748084 3:120911873-120911895 TTTCAGTAACGGTCTAATTTTGG - Intronic
963925699 3:150948682-150948704 AATCATTATCGGTCTATTTAGGG + Intronic
965130038 3:164686228-164686250 TTTCTTTAACCGTCTGTTTATGG + Intergenic
965165075 3:165187673-165187695 ATTGATTAATGATCTGAGTATGG + Exonic
966000247 3:174940692-174940714 GCTCATTATCGGTCTGATCAGGG + Intronic
966145141 3:176803091-176803113 ACTCATTATTGGTCTGTTTAGGG - Intergenic
971082098 4:23224983-23225005 ATTCATTAAATGTTTGATAAAGG + Intergenic
972363672 4:38352700-38352722 ACTCAATATCGGTCTGTTTAGGG - Intergenic
977118316 4:93062027-93062049 ATTTATAAGAGGTCTGATTAAGG + Intronic
980032785 4:127849641-127849663 ATTCATTACTGGTCTGGTTCAGG - Intergenic
981198293 4:141945906-141945928 ATTCATTATGGGTCTGTTCAGGG + Intergenic
983303786 4:165960276-165960298 ATTCATTATTGGTCTGTTCAGGG - Intronic
984482619 4:180325277-180325299 ACTCATTATTGGTCTGTTTAGGG - Intergenic
985376470 4:189345005-189345027 ATTCATTAATTGTGTCATTAAGG - Intergenic
986845993 5:11754170-11754192 ATTCATTTCAGGTCTGATTTTGG + Intronic
987866439 5:23545869-23545891 ACTCAATAACGGTCTGCTCAGGG + Intergenic
988625383 5:32869550-32869572 ATTCACTAACAGTCTCATGAAGG + Intergenic
991602704 5:68369470-68369492 ATTTTTTAAATGTCTGATTATGG + Intergenic
991984368 5:72268645-72268667 ATTCATTAACTGTTTGATTTTGG + Intronic
991995063 5:72378654-72378676 ATTCATTAAAGGTGTCATAAAGG + Intergenic
993515208 5:88824277-88824299 GTTCATTAACTCTCTGATTTAGG - Intronic
996214763 5:120853120-120853142 ATTTATTAAGGCTCTGATTTAGG + Intergenic
996469208 5:123840329-123840351 ATTCATTATTGGTCTGTTCAGGG - Intergenic
997711627 5:136009354-136009376 GTTCATTCATGTTCTGATTATGG + Intergenic
998550240 5:143070319-143070341 CTTCATTAACAATCTGGTTAGGG - Intronic
998827659 5:146120390-146120412 TTTCATTAAACGCCTGATTATGG + Exonic
999567111 5:152876687-152876709 ACTCATTATTGGTCTGATTAGGG - Intergenic
1009312622 6:62173400-62173422 ACTCATTATTGGTCTGTTTAGGG - Intronic
1011131811 6:84059616-84059638 ATTCATTAAAGGTTAGGTTAAGG + Intronic
1012018530 6:93885207-93885229 ATCCACTAACTTTCTGATTATGG - Intergenic
1014925482 6:127266005-127266027 TTTCATTAACTGTTTGATTCAGG - Intergenic
1018273988 6:162110599-162110621 ATTCTTCAACGGTCTTTTTAAGG - Intronic
1019157353 6:170048310-170048332 CTTCATTAACAGTCTGAGTTTGG + Intergenic
1022011723 7:26313748-26313770 TTTCATTACCAGTCTGATGACGG - Intronic
1023082804 7:36541444-36541466 ATTCAATAAATGTCTGATTGAGG - Intronic
1023132915 7:37021085-37021107 ATTCCTTAACAGTTTGATTTTGG + Intronic
1023777828 7:43626182-43626204 GTCCCTTCACGGTCTGATTAGGG + Exonic
1029912841 7:104173598-104173620 ATTCATTCAGGATCTCATTAAGG + Intronic
1031489128 7:122366279-122366301 ATATATTAACGTTCTGATTTAGG - Intronic
1031772570 7:125863128-125863150 ATTCATTATTGGTCTGTTCAGGG + Intergenic
1034428031 7:151024705-151024727 ATTCATTCAAGGTCTGAAGATGG - Intergenic
1038615651 8:29091579-29091601 ATTCATGAACTGTCAGATTTAGG - Intronic
1042585936 8:70338403-70338425 ATTCATTATTGGTCTGTTCAGGG - Intronic
1043087726 8:75856311-75856333 TTTCATCATCTGTCTGATTATGG + Intergenic
1043290460 8:78593763-78593785 ATTCATTAACTATGCGATTATGG + Intronic
1043606125 8:82002614-82002636 ATTCATTAACTACCTGTTTATGG + Intergenic
1043697385 8:83237223-83237245 ATTCATTAAAGGACTACTTAAGG + Intergenic
1050286775 9:4111131-4111153 TTTCATAAATGATCTGATTAAGG - Intronic
1051885996 9:21893712-21893734 ACTCATTAATGGTCTGTTCAGGG - Intronic
1052275144 9:26666940-26666962 ATTCATTTACGGCCTGCTTTAGG + Intergenic
1052543621 9:29844151-29844173 ATTCATTATTGGTCTGTTCAGGG - Intergenic
1055425007 9:76185756-76185778 ATTTATTAACTGTGTGATTTGGG + Intronic
1056204574 9:84307631-84307653 ATTTTTTCACGGTCTGATTTAGG + Intronic
1058198741 9:102011827-102011849 ATTCATTATTGGTCTGTTCAGGG - Intergenic
1187077523 X:15949914-15949936 ATTGATTAAAGGTCAGATTCAGG + Intergenic
1187624668 X:21097184-21097206 GTTCATTATTGGTCTGTTTAGGG + Intergenic
1188275538 X:28196081-28196103 ATTCAATAATGGTTTGATAATGG - Intergenic
1188319276 X:28715644-28715666 ACTCATTATTGGTCTGTTTAGGG - Intronic
1190974100 X:55382888-55382910 ACTCATTATTGGTCTGTTTATGG - Intergenic
1191020624 X:55856579-55856601 ATTCATTACTGGTCTGTTCAGGG + Intergenic
1193672862 X:84410844-84410866 ATTCATTATTGGTTTGTTTAGGG + Intronic
1194784066 X:98060349-98060371 ATTGATTAAAAGTTTGATTATGG - Intergenic
1196386386 X:115157881-115157903 ATTCATTAGCATTGTGATTACGG + Intronic
1197048634 X:122030927-122030949 ATTCATTAGCTGTGTGACTATGG + Intergenic