ID: 1120046511

View in Genome Browser
Species Human (GRCh38)
Location 14:79813539-79813561
Sequence ATAGATATACAAATCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120046511 Original CRISPR ATAGATATACAAATCAAACA AGG Intronic
903482481 1:23664049-23664071 ATATATATATAAATGTAACAAGG - Intergenic
904297867 1:29533652-29533674 ATATATATATATATAAAACATGG - Intergenic
904390499 1:30182470-30182492 ATCAATATACAAAGCAAAAAGGG - Intergenic
905152875 1:35945918-35945940 TCAGATATACAAAATAAACATGG - Intronic
905622917 1:39464368-39464390 TTGGATATACTAATGAAACATGG - Intronic
906044209 1:42815863-42815885 ACAGATAAACAAAACAAAGAGGG + Intronic
906774203 1:48513770-48513792 ATCGATTTGCAAATCAAAGAAGG - Intergenic
907099482 1:51815734-51815756 ATTTATAGAAAAATCAAACAAGG + Intronic
907150893 1:52286387-52286409 ATAGATATACAACACACATATGG - Intronic
907557239 1:55354884-55354906 ATAGCAAGACAAATCAGACATGG - Intergenic
908568505 1:65383939-65383961 AAATATATACAAATCAAATTGGG + Intronic
908740848 1:67325971-67325993 AAAGATGTACAAAGCAAGCATGG - Intronic
908903049 1:68978368-68978390 ATAAAAAGACAAATTAAACATGG - Intergenic
908993329 1:70121755-70121777 GTAAATACACAAATAAAACAGGG - Intronic
909349982 1:74640302-74640324 ATATATATTCAAATCAAACCTGG + Intronic
909353544 1:74681303-74681325 ATATTCATACAAAGCAAACAAGG + Intergenic
909426004 1:75525844-75525866 ATAGCTATACAAAGTAAATATGG + Intronic
910061634 1:83100532-83100554 ATAGTTAGACAAATGCAACAAGG - Intergenic
910239869 1:85074797-85074819 ACAGAAATACACATAAAACAAGG - Intronic
910854489 1:91682061-91682083 ATAGATATACACATTCAATAAGG - Exonic
911111501 1:94192483-94192505 ATAAATATACAAAAGAAACCAGG - Intronic
911546803 1:99226939-99226961 ATTCATATAAATATCAAACAAGG - Intergenic
911868055 1:103053136-103053158 ATAGAAATCCAAATTAAACAGGG + Intronic
913004396 1:114614683-114614705 ATAGACATACAAATAAATTAAGG + Intronic
913548154 1:119890484-119890506 ATATATATATAAAGCAAACATGG + Intergenic
914783581 1:150808014-150808036 GTATATATATAAATCATACAAGG + Intronic
914885462 1:151580975-151580997 ATAGAAAAACAAATCAGTCATGG + Exonic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
916301514 1:163280485-163280507 TTAGCTATAGAAATCAAAAAAGG + Intronic
916356083 1:163910149-163910171 AAAGACAACCAAATCAAACATGG + Intergenic
916387095 1:164286963-164286985 ATGAATGTACAAATAAAACATGG - Intergenic
916723819 1:167505322-167505344 CTAGATATACTAATAATACATGG + Intronic
916971411 1:170021739-170021761 ATAGAAATACAAATTAATAACGG - Intronic
917371367 1:174297783-174297805 ACATATATAAAAATGAAACAAGG + Intronic
917643105 1:177002471-177002493 ATAGCTAAACAAATAAAACCAGG + Intronic
917799186 1:178554569-178554591 ATCGATTTGCAAATCAAAGAAGG - Intergenic
917818423 1:178735176-178735198 ATAGCTATACTCAGCAAACATGG + Intronic
918571266 1:185996187-185996209 ACAGAAAGACAAATCAAACAAGG + Intronic
918598692 1:186325725-186325747 AGAGATATTCAATTCAAAAAAGG + Intronic
918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG + Intergenic
918668636 1:187184309-187184331 ATAGATATGCAAATAAAAGAAGG - Intergenic
918717511 1:187808486-187808508 ATAGAAATACCAATCTAGCAAGG - Intergenic
918957694 1:191231673-191231695 ATAGATAAACAAATTAAAGGAGG + Intergenic
919365309 1:196652340-196652362 TTAGATATACCATTCAAATAAGG - Intronic
919585086 1:199427582-199427604 ATGGATCTACAAAACAAATATGG + Intergenic
920428149 1:205895614-205895636 ATCGATTTGCAAATCAAATAAGG + Intergenic
921049027 1:211497966-211497988 ATAGAAATGCACATAAAACAAGG + Intergenic
921159241 1:212461480-212461502 ATAGAAATACACATAAAACAAGG - Intergenic
922113157 1:222582710-222582732 ATAAATGGACAAATAAAACATGG + Intronic
922508345 1:226140680-226140702 ATAAATATACAACTCACAGAAGG + Intergenic
923388670 1:233491510-233491532 ATAGCTACAAAAATAAAACACGG - Intergenic
923577341 1:235171451-235171473 AAAGAAATGCAAATCAAATAAGG - Intronic
923821745 1:237450925-237450947 ATAAATATAGAAAAGAAACAAGG - Intronic
923864328 1:237922794-237922816 ATACATATATAAATCATACCTGG - Intergenic
924084130 1:240431395-240431417 ATATATATATATATAAAACATGG - Intronic
1063229719 10:4052625-4052647 ATATATATATATATTAAACAGGG + Intergenic
1063239330 10:4152126-4152148 CAAAATATACAAATCCAACATGG - Intergenic
1063790893 10:9445939-9445961 ATATATTTATAAATCAAACAAGG - Intergenic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1064279223 10:13935965-13935987 TTAGTTATACAAATCTACCATGG - Intronic
1065231036 10:23598779-23598801 ATAGATAAACAAAGCATCCAGGG - Intergenic
1065292859 10:24248258-24248280 AAACATATTCAAAGCAAACATGG - Intronic
1065397518 10:25255583-25255605 ACAGACAAACAAATAAAACAGGG - Intronic
1065615244 10:27514612-27514634 ATAGATATGGAAATCAGAAAAGG + Intronic
1065648507 10:27863080-27863102 ACAGAAATACACATAAAACAAGG - Intronic
1066088560 10:31995296-31995318 ATATATATACAAACAAAATATGG + Intergenic
1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG + Intergenic
1066801571 10:39198259-39198281 ATCGATTTGCAAATCAAAGAAGG - Intergenic
1066990290 10:42506593-42506615 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1067991418 10:51217213-51217235 ATAGATATAAAAATTACACCTGG + Intronic
1068027639 10:51667674-51667696 ATAGAAATATAAATAACACATGG - Intronic
1068166244 10:53336119-53336141 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1068177893 10:53485650-53485672 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1068340983 10:55702320-55702342 AAAAATAAACAAATTAAACATGG + Intergenic
1068559002 10:58491796-58491818 ATACATTGACAAATCAAACAAGG + Intergenic
1069165463 10:65152693-65152715 TTAGATATAAAAATCAAGGATGG + Intergenic
1069275374 10:66585204-66585226 ATAGATATCCAAATATAAGAAGG - Intronic
1072351261 10:94559797-94559819 ACAGAAACACAAATAAAACAGGG + Intronic
1073699406 10:105908719-105908741 AGAGATAGACAATCCAAACATGG + Intergenic
1073851939 10:107631782-107631804 ACAGATATAAAAAGTAAACATGG - Intergenic
1073877872 10:107946755-107946777 AGAGAAATACAAATAAAAGAGGG + Intergenic
1073895207 10:108148186-108148208 ATAGACAGACAAATAAAATATGG + Intergenic
1074342501 10:112646953-112646975 AAAGAAATAAAAATAAAACATGG - Intronic
1074752860 10:116603567-116603589 GTTAATCTACAAATCAAACAAGG - Intronic
1076134888 10:128038808-128038830 ATATATATACATATAAAAAATGG + Intronic
1076211621 10:128651148-128651170 ATATATATACACATACAACATGG + Intergenic
1077920004 11:6634532-6634554 ACAGAAACACACATCAAACAAGG - Intronic
1079311222 11:19367671-19367693 ATGGACATACAACTCAAGCAAGG - Intronic
1079824707 11:25176122-25176144 ATAGAGATACAAATAAAACTGGG - Intergenic
1080233560 11:30044668-30044690 ATAGATATACATATCCAAAATGG + Intergenic
1080363275 11:31542157-31542179 TGAGATATACAAAACAAAGAAGG + Intronic
1080413509 11:32048549-32048571 GTGGCTAAACAAATCAAACATGG - Intronic
1080459961 11:32445672-32445694 ATAAATATATAAATAAAAGAAGG + Intergenic
1080856804 11:36118874-36118896 ATAGAAACAGAAATCAAACTGGG - Intronic
1080943563 11:36946526-36946548 ATACAACTACACATCAAACAAGG + Intergenic
1082189227 11:49222409-49222431 ATATATATATATATAAAACAAGG + Intergenic
1082301709 11:50513899-50513921 ATTGATTTGCAAATCAAAGAAGG + Intergenic
1082629274 11:55521658-55521680 TTACATATACAAATAAAACAAGG - Intergenic
1085064238 11:73477957-73477979 ATAGATAGATAGATAAAACAAGG + Intronic
1085279134 11:75318979-75319001 ATTGTTATGAAAATCAAACAAGG - Intronic
1085604082 11:77881824-77881846 ATATATAAACAATTAAAACAGGG + Intronic
1085848142 11:80089229-80089251 ATATATATACAAATCAACTCTGG - Intergenic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1086922428 11:92602405-92602427 ATAGATGTAAAAATTAAATAAGG - Intronic
1087569970 11:99913957-99913979 AGAGATATTAAAATCAAGCATGG + Intronic
1087751277 11:102010321-102010343 ATAAATCTCCAAATCAAACAGGG + Intergenic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1088003085 11:104906380-104906402 AAAAATATACAAATTAAAAATGG + Intergenic
1088162966 11:106895857-106895879 ATAGATTCACAAATCAAGCCGGG + Intronic
1088648034 11:111932847-111932869 ATAAATATACACATAACACATGG - Intronic
1090513807 11:127403052-127403074 TAAGATATACAAATAAAACTTGG - Intergenic
1090677918 11:129021116-129021138 ACAGTTATATAATTCAAACAGGG + Intronic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1092064196 12:5576175-5576197 ATACTTATACACATCAAAGATGG - Intronic
1092191191 12:6522254-6522276 ATAGATATATCAATAAAATATGG - Intronic
1092315493 12:7409196-7409218 ATATATTTACAAATGACACATGG - Intronic
1092593845 12:9977707-9977729 ATAGATATATAAGTGAGACAGGG - Intronic
1093269718 12:17045049-17045071 ACAGAAATACACATGAAACAAGG + Intergenic
1093417639 12:18938356-18938378 ATTCAAATACAAATCTAACACGG - Intergenic
1093576796 12:20740492-20740514 ATATATATAAAAGTGAAACAAGG - Intronic
1094253317 12:28392481-28392503 TTACAGATACAAATCTAACACGG - Intronic
1094270994 12:28614316-28614338 ATAGATACACATTTAAAACATGG + Intergenic
1095531036 12:43186811-43186833 ATAGATATAAGCATCAAAAAGGG - Intergenic
1095798443 12:46246482-46246504 ATAGATAAACAAAGCAGCCAAGG + Intronic
1096175651 12:49516199-49516221 ATATATATATAAATCAGGCATGG + Intronic
1097917945 12:65039832-65039854 ACAGCTGTAGAAATCAAACATGG - Intergenic
1098932186 12:76431738-76431760 CTAAATATATAAAGCAAACATGG + Intronic
1099553829 12:84083364-84083386 ATAAAGATTAAAATCAAACAGGG + Intergenic
1099617119 12:84950232-84950254 AGAGAAATACAAATCAAAATTGG + Intergenic
1099749314 12:86751656-86751678 ATAGAAATACAAATTACAGATGG + Intronic
1100979477 12:100153533-100153555 ATAGATTTACAAGTCTAAGAGGG - Intergenic
1101031701 12:100667169-100667191 ATAAATAAATAAATAAAACAAGG - Intergenic
1101307847 12:103547552-103547574 ATAGAAAAACAAATTAGACATGG + Intergenic
1101478131 12:105070895-105070917 AAATATTTACAAATAAAACATGG + Intronic
1101888849 12:108693172-108693194 ATACATGTACAAATCAAATAAGG + Intronic
1102757367 12:115353711-115353733 ATAGATAGATAAAACAAACATGG + Intergenic
1103791308 12:123473531-123473553 ATATATATATAAGTAAAACATGG + Intronic
1104753546 12:131254890-131254912 ATAGATATAGATATAAAATAAGG - Intergenic
1105063979 12:133180963-133180985 ATAAAGATACAAGTCGAACAAGG - Intronic
1105579495 13:21681180-21681202 ACAGCTGTTCAAATCAAACATGG - Intronic
1106939082 13:34756603-34756625 ATAAATACACAAAGCAAAAATGG + Intergenic
1107282860 13:38756341-38756363 ATAGAAACACACATAAAACAAGG - Intronic
1107564315 13:41586414-41586436 ATACAAATACAAATAAGACATGG - Intronic
1108165696 13:47690700-47690722 ATTGACACACAAAACAAACAGGG - Intergenic
1108177468 13:47807971-47807993 CTAGATCTCCAAATCCAACAGGG - Intergenic
1108617851 13:52152139-52152161 ATATTTATACAAACCAAATAAGG - Intronic
1109380617 13:61554806-61554828 ATTGAAATACATTTCAAACATGG - Intergenic
1110443063 13:75546968-75546990 ACAGAAATACACATAAAACAAGG - Intronic
1110973974 13:81806132-81806154 ATAGGTATATAAAACAAAGATGG - Intergenic
1111175101 13:84584439-84584461 AAAGATACCCAAATGAAACAAGG + Intergenic
1111433124 13:88170077-88170099 ATATATAAACAAAAGAAACAGGG - Intergenic
1111993830 13:95143024-95143046 CTAGCTATATAAATAAAACAAGG + Intronic
1112486299 13:99823069-99823091 ATAAGTATACAAATCAAACATGG - Intronic
1112495744 13:99902965-99902987 TTAGAAATACAAGTCAAAGACGG - Intergenic
1112714362 13:102166769-102166791 ATAGAAACACATATTAAACAAGG + Intronic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1113979188 13:114258663-114258685 ATAGAAACACACATAAAACAAGG + Intronic
1114786077 14:25600625-25600647 ATAAATAAAAAAATCAAATAGGG - Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1116032888 14:39593995-39594017 ATAAAAACACAAATAAAACAAGG - Intergenic
1116305565 14:43250432-43250454 TTATGTATAAAAATCAAACAAGG - Intergenic
1116451847 14:45075650-45075672 ATAGATACATAAATAAAATACGG - Intergenic
1116741848 14:48765580-48765602 CAAGATTTGCAAATCAAACAAGG + Intergenic
1116929969 14:50680852-50680874 CAACATACACAAATCAAACATGG - Intergenic
1117124243 14:52604091-52604113 ATAGATAATCAAATTAAAAATGG - Intronic
1117902996 14:60554677-60554699 ATGAATAGACAAATAAAACATGG + Intergenic
1118298768 14:64595318-64595340 AGAGATCTGCAAATAAAACAAGG - Intergenic
1118424500 14:65644772-65644794 ATAGAAACACACATAAAACAAGG - Intronic
1118556140 14:67024891-67024913 ACAGATTTACAAAACAAAAATGG - Intronic
1118754642 14:68831284-68831306 AAAGAAATACAAATCAAGCCTGG - Intergenic
1119906327 14:78305419-78305441 ACACATAAACAAATCAAAAAGGG - Intronic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120337547 14:83176372-83176394 TTAGAAATACAACTCAAAGAAGG + Intergenic
1120816595 14:88866267-88866289 AAAGATAAAAATATCAAACAGGG + Intronic
1121062609 14:90929206-90929228 ATACATATACACATAAAACTTGG + Intronic
1122026220 14:98879329-98879351 ATATATAAACAAATCCATCATGG - Intergenic
1123773342 15:23551991-23552013 TTAGATACACAAATAAAAAAAGG - Intergenic
1123912485 15:24982187-24982209 ATATCTATACAAATAAAAAAGGG - Intergenic
1123923948 15:25090411-25090433 ATGGATATACAAGTTCAACATGG - Intergenic
1124442175 15:29694567-29694589 AAAGATATACCATACAAACAGGG + Intergenic
1124798085 15:32802213-32802235 AAAAAGATACAAATCAGACAGGG - Intronic
1125087342 15:35745664-35745686 ATACATAGCCAAATGAAACACGG - Intergenic
1125243939 15:37612076-37612098 ATGTATATACAAATTTAACATGG + Intergenic
1126046119 15:44642017-44642039 ATAGTTATATACATTAAACATGG + Intronic
1126077716 15:44929247-44929269 ATAGATATAGATATAAAAAAGGG + Intergenic
1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG + Intronic
1126426963 15:48538090-48538112 ATTGCTATACAAATGTAACATGG + Intronic
1126998093 15:54468467-54468489 ATAGACATCCAAAACAAAAATGG - Intronic
1127789057 15:62382061-62382083 ACAAATAGACAAATGAAACATGG - Intergenic
1127816106 15:62610376-62610398 ATAGAAACACACATAAAACAAGG - Intronic
1128048139 15:64637987-64638009 ATATATATATATATAAAACAAGG - Intronic
1128102696 15:65016695-65016717 ATAAATATTAAAATAAAACATGG + Intronic
1128487032 15:68102916-68102938 AAAGAAATAAAAATCAAAGAAGG - Intronic
1128604280 15:69025159-69025181 ATAGAAACACACATAAAACAAGG - Intronic
1128910042 15:71505499-71505521 GTAGACAGCCAAATCAAACAGGG + Intronic
1129311101 15:74709882-74709904 ATACATATTCAAACCATACATGG + Intergenic
1129633798 15:77292271-77292293 ACAGAAATACAGATAAAACAAGG - Intronic
1130358660 15:83159611-83159633 ATAGATATACAGATCAAGGAAGG + Intronic
1131206796 15:90456085-90456107 GTACATAAACAAATCAATCATGG - Intronic
1131492572 15:92875724-92875746 ATAAATAAACAAATAAAATACGG - Intergenic
1131682221 15:94736097-94736119 ACAGATGTACAAGTGAAACACGG + Intergenic
1131875221 15:96798782-96798804 ATTGCTATACAGATGAAACATGG + Intergenic
1132100907 15:99022615-99022637 ATAAATAAACAAATAAAAGAAGG - Intergenic
1132282170 15:100629179-100629201 AAAGATATACACAAAAAACACGG - Intronic
1133940381 16:10304484-10304506 ATACATAAATAAATAAAACATGG - Intergenic
1134194150 16:12145853-12145875 ATAGAAATACTAATCCTACAAGG - Intronic
1135626990 16:24004326-24004348 ACATATATAAAAATGAAACATGG + Intronic
1137253382 16:46756551-46756573 ATAAATACACAAATCAACAAAGG - Intronic
1137518133 16:49168104-49168126 AAAGATATATGAATGAAACATGG + Intergenic
1137793723 16:51196922-51196944 AAACATAAACAAATAAAACAAGG - Intergenic
1139119301 16:63996428-63996450 AGATATATAGAAATCAAACTGGG - Intergenic
1140216825 16:73015438-73015460 ATAAATATCCAAATTAACCAAGG + Intronic
1140967649 16:79982874-79982896 ATAGATACACAAATAAAATATGG - Intergenic
1143285715 17:5787747-5787769 ATACATAAACAAACCTAACAAGG - Intronic
1146501472 17:33368561-33368583 TTAGATAATCAAAACAAACAAGG + Intronic
1149088347 17:52748283-52748305 ATACATATACATATGCAACAGGG + Intergenic
1150617137 17:66781108-66781130 AAAAATATAAAAATAAAACACGG + Intronic
1150735644 17:67735243-67735265 ATTCATATACAAATAAATCAAGG + Intronic
1154013853 18:10598732-10598754 ACAGAAACACAAATAAAACAAGG - Intergenic
1154153097 18:11922427-11922449 ACAGAAACACAAATAAAACAAGG - Intergenic
1154205387 18:12331847-12331869 ATATATATATATATAAAACAAGG + Intronic
1155833783 18:30552523-30552545 ATAGATAAACAAATCATATGGGG - Intergenic
1156154951 18:34290713-34290735 CAAGATTTAAAAATCAAACAAGG + Intergenic
1156940228 18:42758505-42758527 ATAAAAATAAAAATAAAACAAGG - Intronic
1157003801 18:43558844-43558866 ATAGAGATACTAATCAGAGAAGG - Intergenic
1158057599 18:53300585-53300607 ATAGAAACACACATAAAACAAGG + Intronic
1158163581 18:54513982-54514004 AAAGACATACAAATCAAAAGTGG + Intergenic
1158330575 18:56357987-56358009 ACAGAGATACAAATAACACAAGG - Intergenic
1158362506 18:56690839-56690861 CTAGACATAGAAATAAAACAGGG + Intronic
1159070795 18:63621776-63621798 GTGGAGCTACAAATCAAACAGGG - Intergenic
1159345916 18:67203097-67203119 ATAGATATGGAAGTCAAACAAGG + Intergenic
1159478620 18:68958396-68958418 AAACATATGCAAATCAATCAAGG - Intronic
1159824635 18:73191766-73191788 ATAGATAAACCATTCAAACTGGG + Intronic
1164141821 19:22475808-22475830 ATAAATATAGCAAACAAACATGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925758516 2:7159396-7159418 ATATACATACAGATGAAACATGG - Intergenic
926957889 2:18321735-18321757 CTAGCTTTAGAAATCAAACATGG + Intronic
927118432 2:19927969-19927991 ATAGATTTGCAAATCAAAGAAGG + Intronic
927436742 2:23073033-23073055 TTAGATTTATACATCAAACATGG - Intergenic
927580129 2:24235997-24236019 ATATATATCCAAAAGAAACATGG + Intronic
928350848 2:30552753-30552775 GTAGTTATACAAATAAATCAGGG - Intronic
928532931 2:32210689-32210711 ATAGATAAACAGATCAAAGCTGG + Intronic
928826086 2:35422917-35422939 ATATATATATATATGAAACATGG - Intergenic
930043322 2:47146421-47146443 ACAGATGTATAAATCAAAAAGGG + Intronic
930521495 2:52472871-52472893 ATAAATATATAAATAAAACAAGG - Intergenic
930544699 2:52751555-52751577 ATATATATACATATAAAACATGG - Intergenic
930760844 2:55034014-55034036 ATAGAAAAACACATAAAACAAGG + Intronic
930790235 2:55318518-55318540 AAAGCTATACAAATGAAATAAGG + Intronic
931148155 2:59542605-59542627 ACATATCTACAATTCAAACATGG - Intergenic
931501471 2:62873146-62873168 ATAGAATTACAAAACACACAAGG + Intronic
931857667 2:66320070-66320092 AAAAATAAACAAATGAAACAAGG + Intergenic
931879287 2:66550411-66550433 TTAAAAATTCAAATCAAACATGG - Intronic
932062371 2:68516795-68516817 ATATATATACAAATACACCATGG - Intronic
932193012 2:69757227-69757249 ATATATATATAAAACAAAAATGG - Intronic
932739432 2:74280441-74280463 AGAGATATAAAAATGGAACATGG - Intronic
932919586 2:75895559-75895581 ACAGATACAGCAATCAAACAAGG + Intergenic
933843671 2:86308009-86308031 ATAAATATAGAAACTAAACAGGG + Intronic
935027783 2:99293734-99293756 TTAGATCTACAATTCACACAAGG + Intronic
935377393 2:102413474-102413496 ACATATATAAAAATGAAACAAGG - Intergenic
936990764 2:118363462-118363484 ATAAATAAATAAATAAAACATGG - Intergenic
937693955 2:124787197-124787219 ATAGTTATTCAAATCCACCATGG + Intronic
939031338 2:137078467-137078489 ATAGATATAAAAAGAAAAAATGG - Intronic
939219514 2:139283353-139283375 ATACATAAATAAATAAAACAAGG + Intergenic
940569899 2:155417893-155417915 ATAAATAAATAAATAAAACATGG - Intergenic
940828791 2:158444205-158444227 ATATATATATACAGCAAACATGG + Intronic
941025920 2:160456053-160456075 AAAGAAATACAGATCAAACAGGG + Intronic
941112967 2:161437474-161437496 ATAATTATACAAATAAAACTTGG - Intronic
941354937 2:164478986-164479008 ATAGATGTCCAGATCAAATAGGG - Intergenic
941560504 2:167037704-167037726 ATAAATAAATAAATAAAACAGGG + Intronic
941937769 2:170999747-170999769 ATAAAAATAAAAATCATACATGG - Intronic
942281654 2:174370391-174370413 ATAAATCTGCAATTCAAACATGG + Intronic
942608931 2:177721425-177721447 AAAGATATACAAATAATATAAGG + Intronic
943018950 2:182549882-182549904 ATTGATATACAAATGAAATCAGG + Intergenic
943167718 2:184351539-184351561 ATAGAAATACAAAAGAAACAAGG + Intergenic
943193421 2:184710881-184710903 ATAAATGGACAAATAAAACATGG - Intronic
943792408 2:191948345-191948367 AGGGAAATACAAATAAAACATGG - Intergenic
944079664 2:195772477-195772499 ATAAATATAAAAAACAAAAATGG - Intronic
945007256 2:205421988-205422010 ATCAATAGACAAGTCAAACAAGG + Intronic
945100956 2:206261805-206261827 ATAAATAAATAAATAAAACATGG + Intergenic
945574205 2:211509354-211509376 ATAAATAAACAAATAAAACTGGG + Intronic
946782736 2:223207731-223207753 ATAAATATACAAATGAGAAAAGG + Intergenic
946804429 2:223456767-223456789 ATATATCTACAAGTCAACCACGG - Intergenic
947035301 2:225846674-225846696 ACAGAAATAAAAACCAAACATGG - Intergenic
948014776 2:234679211-234679233 ATAGAAACACACATAAAACAAGG - Intergenic
948117770 2:235506229-235506251 ATAAATAAATAAATAAAACAGGG - Intronic
1169036167 20:2454185-2454207 AAACATATACAATTAAAACAAGG + Intergenic
1169403977 20:5308151-5308173 ATCGATTTGCAAATCAAATAAGG + Intronic
1170769997 20:19324335-19324357 AAAAATATTCAAATCAAAAATGG - Intronic
1171366984 20:24631723-24631745 ATATATATATAAATCAAGAAAGG - Intronic
1172076415 20:32301364-32301386 ATAAATAAATAAATAAAACATGG - Intronic
1172989148 20:39019390-39019412 ACAGATAAACAAACAAAACATGG - Intronic
1173067403 20:39726601-39726623 ATTGATTTGCAAATCAAATAAGG + Intergenic
1177358139 21:20034837-20034859 TTAGAGATACAATTTAAACATGG + Intergenic
1177415736 21:20791333-20791355 ATATATATACATTTCAAAGAGGG - Intergenic
1177599599 21:23293100-23293122 ATAGATACAGCACTCAAACATGG - Intergenic
1177912735 21:27052630-27052652 ATATATATGAAAAACAAACAAGG + Intergenic
1178869990 21:36365535-36365557 ATGCATATATAAATCAAAGAGGG + Intronic
1179120245 21:38538350-38538372 AAAGTCATAAAAATCAAACATGG + Intronic
1183657732 22:39198923-39198945 AGAGACATACAGATCAAAAAGGG + Intergenic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1184055049 22:42041052-42041074 TTAAATATATAAATCAAATATGG - Intronic
1184753795 22:46504574-46504596 AGAGACATGCAAATCAAAAAAGG + Intronic
1184771174 22:46597464-46597486 ATAGATAGATAAATGAAACCAGG - Intronic
1185115199 22:48930335-48930357 ATACATATACATATCACAGAGGG - Intergenic
949739786 3:7218423-7218445 TTAGAAATAAAAATAAAACATGG - Intronic
949752051 3:7364186-7364208 ATATATATATACATCTAACAAGG - Intronic
949845302 3:8363745-8363767 ATATCTATCCAAATCAATCATGG + Intergenic
950897507 3:16467074-16467096 AGAGATACACAAAACAAAAAGGG + Intronic
951087909 3:18536543-18536565 ATAGAAACACACATAAAACAAGG + Intergenic
951142241 3:19176914-19176936 ATAGAAATACACATAAAACAAGG - Intronic
951178393 3:19629137-19629159 AAAGAAAAACAAATCAGACACGG + Intergenic
951200303 3:19868965-19868987 AAAGATATACAGACTAAACAGGG - Intergenic
951232116 3:20191368-20191390 ATAAATATCCAAATTCAACAGGG + Intergenic
951966663 3:28393956-28393978 AAAGATATCCAAATAAAAAAAGG + Intronic
952327741 3:32336097-32336119 AATGAAATAAAAATCAAACAAGG - Intronic
952493599 3:33896001-33896023 ATAGATAAACACATCACATATGG - Intergenic
953229083 3:41047779-41047801 ACAGATAAACAAATCAAGTAAGG - Intergenic
953474928 3:43196965-43196987 ATCCATACACAAATCAAGCATGG - Intergenic
954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG + Intronic
954589775 3:51773306-51773328 ATAGATAGAAAACTCAAAGATGG - Intergenic
955689103 3:61573123-61573145 ACAGAAATTCAAATCAACCAGGG - Intronic
956890361 3:73607321-73607343 TTATATATACAAATAAAATATGG + Intronic
957143601 3:76393840-76393862 ATACATATACAAATAAAACCTGG - Intronic
957378149 3:79387595-79387617 ATAGATATACAAAAGTAACCGGG - Intronic
957381549 3:79436334-79436356 AAAAAAATACAAATCAAACATGG - Intronic
957795317 3:84997683-84997705 ATTCATATATAAAACAAACATGG - Intronic
957965377 3:87315878-87315900 ATAGAAATACACATAAAACATGG + Intergenic
957968954 3:87358890-87358912 ACAGAAATACAAATAAAACAAGG - Intergenic
958050858 3:88343558-88343580 ATTGGTATAGGAATCAAACAGGG + Intergenic
959601768 3:108194940-108194962 ACAGATAGACAAAGCAAAAATGG + Intronic
959797462 3:110448067-110448089 ATATATATATAAAACAAATAGGG - Intergenic
960570585 3:119181775-119181797 CTAGAAAGACAAATAAAACAGGG + Intronic
961933327 3:130556317-130556339 CCTGATATATAAATCAAACAAGG - Intergenic
962132098 3:132691686-132691708 ATATATATATAAATCAACCATGG + Intronic
962903878 3:139784387-139784409 ATTGATATAAAAATTAAATAAGG + Intergenic
963393551 3:144702037-144702059 ATATATATACACATCAATTATGG + Intergenic
964092946 3:152897327-152897349 ATATATATATATATAAAACAAGG + Intergenic
964121223 3:153185645-153185667 ATATATATATAAATAAAACCTGG - Intergenic
964369901 3:155989229-155989251 AGAAATGTACAAATAAAACATGG + Intergenic
964436644 3:156660136-156660158 ATAGATAATAAAAACAAACAGGG - Intergenic
964911888 3:161792721-161792743 ATAGAAATAGATAACAAACATGG + Intergenic
965107514 3:164376444-164376466 ATAAATGTACTTATCAAACAAGG - Intergenic
965152677 3:165000699-165000721 AAAGATATAAAGTTCAAACACGG + Intronic
965741233 3:171876565-171876587 TTAGATATATAAATCTATCAAGG - Intronic
965907729 3:173729889-173729911 ATAGATATGCAAATGTAAAATGG - Intronic
966396735 3:179511294-179511316 ATAGATGAACAAAACACACATGG - Intergenic
966450531 3:180055175-180055197 ATACATATACATATGAGACAAGG + Intergenic
967191996 3:186992491-186992513 ATAAATAAATAAATAAAACATGG + Intronic
967880821 3:194300001-194300023 AAATATATACAAATCAAAGAAGG - Intergenic
968329185 3:197850132-197850154 TTAAATCTACAAATCACACAAGG - Intronic
968623817 4:1617155-1617177 TTATATTTACAAATCAAGCAAGG + Intergenic
969320719 4:6410836-6410858 ATAAATAAATAAATAAAACAGGG - Intronic
970186755 4:13463278-13463300 AAATATATGCAAATAAAACATGG + Intronic
970951696 4:21764482-21764504 ATTTATATAAAAATGAAACAAGG + Intronic
971136157 4:23871046-23871068 ATTGAAAGACAAATTAAACAGGG + Intronic
971158897 4:24113166-24113188 AGAGATAAATAAATCAGACATGG - Intergenic
971462365 4:26914486-26914508 ACAGATATACAAATAAACAATGG - Intronic
971527751 4:27642828-27642850 ATTGAAATACAAATTAAAAATGG - Intergenic
972289174 4:37675548-37675570 CTAGTTAGACAAAACAAACATGG + Intronic
972804868 4:42519070-42519092 ATAAATATATAAATAACACAGGG - Intronic
972885867 4:43486712-43486734 ATAGATTTAAAAATAAAACCAGG - Intergenic
973056674 4:45668055-45668077 ATAAATATATAAACCAAACATGG - Intergenic
973097149 4:46216287-46216309 ATAAATAAATAAATAAAACATGG + Intergenic
973760638 4:54111957-54111979 ATAGAGACACACATAAAACAAGG - Intronic
974613632 4:64250984-64251006 ATAAATCCACAAAGCAAACAAGG + Intergenic
974659587 4:64869620-64869642 ATGTATTTAAAAATCAAACATGG - Intergenic
974702400 4:65468693-65468715 ATATATATATATATAAAACAAGG + Intronic
974710184 4:65581851-65581873 AAAGAATTACAAATAAAACATGG - Intronic
974805530 4:66875219-66875241 ATAGAAATACATATAAAACAAGG - Intergenic
974823334 4:67096085-67096107 ACAGAGATATAGATCAAACAAGG - Intergenic
975571361 4:75821504-75821526 ATAGATACATAAACAAAACAAGG + Intergenic
975828070 4:78340561-78340583 ATATAAAGACAAATCAAATATGG + Intronic
976161884 4:82210534-82210556 ATATATATACAAATAATAAACGG + Intergenic
977100624 4:92808952-92808974 ACAAATTTACAAATCAAATAGGG + Intronic
977731253 4:100355014-100355036 ATAGACATATAAATCCAACTTGG + Intergenic
979114810 4:116810023-116810045 ATAGATAAAGAAGTCCAACATGG + Intergenic
979943441 4:126793156-126793178 AGAGATATACATATAAAATAGGG + Intergenic
980772536 4:137395485-137395507 ATATATATATACATAAAACAAGG + Intergenic
981130700 4:141155538-141155560 ATAAGTATACATATTAAACAGGG + Intronic
981159694 4:141483334-141483356 ATAAATATACAAAACATACAAGG - Intergenic
981223639 4:142266192-142266214 ATAGAACTACAAAACAAACAAGG + Intronic
981811894 4:148784798-148784820 ATAGAAAAACAAATCTTACATGG - Intergenic
982015735 4:151151901-151151923 ATAGATATATAAATTTGACATGG + Intronic
982493596 4:156061900-156061922 ATAAATAAACAAATCAAACATGG + Intergenic
982672129 4:158333590-158333612 ATAGATTTAAAAATCATACCAGG + Intronic
982965695 4:161903898-161903920 ACAGTTATACAATTGAAACAAGG - Intronic
982989873 4:162259135-162259157 AAAGACATCCAAATGAAACAAGG + Intergenic
983782729 4:171692234-171692256 ATAGATATACAAATAAATAAAGG + Intergenic
983796690 4:171872952-171872974 ATAGATACACAAATGAATTATGG + Intronic
983830093 4:172315549-172315571 AAATATATAAAAATCAACCAGGG - Intronic
983890719 4:173026963-173026985 ATAGATATACAGATATATCAGGG - Intronic
984596370 4:181673165-181673187 ATAGGTATACGCATAAAACAGGG - Intergenic
985124020 4:186673340-186673362 ATAGACAGAAAAATAAAACAGGG - Intronic
985302200 4:188502731-188502753 CTTGGTATACATATCAAACAAGG + Intergenic
985945174 5:3176898-3176920 ATCGATATTCAATCCAAACAAGG + Intergenic
986096890 5:4566038-4566060 ATAAATATCCACATCAAAAAAGG + Intergenic
986313200 5:6570017-6570039 ATATATATATAAAGGAAACAGGG + Intergenic
987435796 5:17892714-17892736 ATATATAGACAAAGAAAACAGGG + Intergenic
988253271 5:28787888-28787910 ATAAAATTAGAAATCAAACATGG + Intergenic
988337451 5:29924734-29924756 TTAGATATACAAATTAAATAAGG - Intergenic
989261886 5:39427744-39427766 AGAGATGTTAAAATCAAACAAGG + Intronic
990056016 5:51579389-51579411 ATATATATACATATTAAACAAGG + Intergenic
990113621 5:52360340-52360362 AGAGTGATACAAAGCAAACAGGG - Intergenic
990326715 5:54684273-54684295 ATAAAAATAAAAATAAAACAGGG + Intergenic
991170931 5:63625144-63625166 CAACATTTACAAATCAAACATGG + Intergenic
992333720 5:75743566-75743588 ACAGATACACAAAATAAACATGG - Intergenic
993017870 5:82556398-82556420 AAATATATATAAAGCAAACATGG - Intergenic
993417849 5:87657736-87657758 AAAAATATATAAATCAGACATGG + Intergenic
993417976 5:87659041-87659063 AAAAATATATAAATCAGACATGG + Intergenic
993613342 5:90081180-90081202 ACAGATATATAAATCAATAATGG - Intergenic
993851291 5:93013368-93013390 AGAAATAAAGAAATCAAACAAGG - Intergenic
994106079 5:95950865-95950887 ATATATATATAAATAAAACTTGG - Intronic
995077899 5:108009254-108009276 ATATATATATATATAAAACAGGG - Intronic
995850364 5:116538695-116538717 TTAAATATACAAATAATACATGG + Intronic
997058707 5:130476231-130476253 AAAGAAAAACAAATCAGACATGG - Intergenic
997221876 5:132174718-132174740 ATAGATATACAGAAATAACATGG + Intergenic
997312676 5:132901597-132901619 ATATATATAAAAATGTAACAGGG - Intronic
997451481 5:133987199-133987221 AAAAATATAAAAATCAACCAGGG + Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
998993757 5:147848014-147848036 AAAAATATACAACTGAAACAGGG + Intergenic
998997411 5:147880778-147880800 ATACATAGACAAATAAGACAAGG - Intronic
999110259 5:149113926-149113948 AAACAGATACAAATCAAATAAGG + Intergenic
999123412 5:149227836-149227858 ATAAATAAACAAAAGAAACATGG - Intronic
1000453217 5:161416498-161416520 TTATATAAAGAAATCAAACAAGG - Intronic
1000508379 5:162150157-162150179 ATATATATATAAAACACACAAGG - Intronic
1000608214 5:163347115-163347137 ATAGATATTCAAATATAAAAAGG + Intergenic
1002113207 5:176935480-176935502 GGATATATACAAATCAAATATGG - Intronic
1003730396 6:8816133-8816155 ATAGATATAAAAAGCACACTAGG - Intergenic
1004064555 6:12230344-12230366 ACAGAAATACACATAAAACAAGG - Intergenic
1004102841 6:12632304-12632326 ATAGAGATAAAAATGAAAGAAGG - Intergenic
1004303386 6:14478352-14478374 ATAGATACAGAATTCAAACATGG - Intergenic
1004733035 6:18376998-18377020 ATACATATATATATAAAACAAGG - Intergenic
1004784777 6:18955691-18955713 AAAAATATACAAATCATAAAAGG + Intergenic
1004969741 6:20896643-20896665 ATGAGTTTACAAATCAAACATGG - Intronic
1005881577 6:30066512-30066534 TCAGATTTACAAATCAGACATGG + Intergenic
1006701908 6:35981668-35981690 ATATATAAATAAATAAAACAGGG + Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008253596 6:49270554-49270576 ATTGAAATACAACACAAACACGG - Intergenic
1008255380 6:49293516-49293538 ATAGATATAAGAAACAAAGATGG - Intergenic
1008353618 6:50524126-50524148 GCAGAAATACAAATAAAACAAGG + Intergenic
1008824436 6:55676248-55676270 AAAGATAAACAAAAAAAACAAGG + Intergenic
1008853164 6:56049323-56049345 ATAATTATAGAAATAAAACATGG + Intergenic
1009323770 6:62324147-62324169 ATAGATTAAGAATTCAAACATGG - Intergenic
1009397460 6:63215981-63216003 ATAGATATGTAAATAAAAAATGG + Intergenic
1009487059 6:64237922-64237944 ATAGTAAAACAAATCATACAAGG + Intronic
1010261994 6:73827950-73827972 AAAGATCTACAAATGGAACATGG - Exonic
1010370626 6:75103076-75103098 AAGGATATATAAATCAAGCAAGG + Intronic
1010819294 6:80394941-80394963 AGAGATATGCCAAACAAACAGGG - Intergenic
1011326592 6:86155299-86155321 AAAGATTTACAACTCAAAAATGG + Intergenic
1011462691 6:87621734-87621756 ATAGATATAAACATTAAAAAAGG - Intronic
1011492770 6:87909743-87909765 ATAGAAAGAAAAATCAATCAAGG - Intergenic
1011839623 6:91480305-91480327 ATAAATGTACAAATAAGACAGGG - Intergenic
1011928936 6:92685474-92685496 AAAGATATACCAATCATACTAGG + Intergenic
1012357316 6:98331555-98331577 ATAAATATACAAATAAAAGATGG + Intergenic
1012493414 6:99808314-99808336 ATAAATACATAAATAAAACATGG - Intergenic
1014225721 6:118844431-118844453 ATAGATATACAATTGTAACTAGG + Intronic
1014528668 6:122532905-122532927 AGAGATATGCAAATCAAAACAGG - Intronic
1015595476 6:134862124-134862146 ACAGATACACACATAAAACAAGG - Intergenic
1015656427 6:135524352-135524374 ATATATATATATATCAAAAAAGG - Intergenic
1016374744 6:143408993-143409015 ATAGATAGACAAAATCAACAGGG + Intergenic
1016507444 6:144798666-144798688 ATAGATTTCCAAATTAAACTGGG - Intronic
1017635362 6:156437835-156437857 AGAGCTACACAAAGCAAACAGGG + Intergenic
1017806446 6:157950474-157950496 ATAGGTAACCAAAGCAAACATGG + Intergenic
1017815601 6:158014367-158014389 ATAGAAAAACACATAAAACAAGG + Intronic
1018594463 6:165463634-165463656 ATCGATTTGCAAATCAAAGAAGG + Intronic
1019668733 7:2266680-2266702 ATAAAAATACAAAACAAAAAAGG - Intronic
1019945568 7:4326180-4326202 ATAAATAGACAAATAAAATATGG - Intergenic
1020342541 7:7127679-7127701 ATAGAAAGCCAAATCAAAAAAGG - Intergenic
1020518306 7:9153862-9153884 ATAAATTTAGAATTCAAACAAGG + Intergenic
1020611833 7:10407523-10407545 ATAAATATAGAATACAAACAAGG - Intergenic
1020632422 7:10655379-10655401 ACAAAAATACAGATCAAACATGG + Intergenic
1020768745 7:12359610-12359632 TTGGGTCTACAAATCAAACAAGG + Exonic
1020921331 7:14268364-14268386 ATAAATAAATAAATAAAACATGG + Intronic
1021406595 7:20275132-20275154 AGAGATATTCACATCAAATATGG - Intergenic
1022088455 7:27091584-27091606 ATACATTTACAAAGGAAACAAGG - Intergenic
1022138875 7:27475006-27475028 ATAAATATACAAAGAAAAAAAGG + Intergenic
1023009366 7:35912087-35912109 ATCGATTTGCAAATCAAAGAAGG + Intergenic
1024065198 7:45726774-45726796 ATCGATTTGCAAATCAAAGAAGG - Intergenic
1024108158 7:46114940-46114962 AAAGGCATACAAATCAAAAAAGG - Intergenic
1024125782 7:46293318-46293340 ATAGTTAAACAACTGAAACAAGG - Intergenic
1024173893 7:46818773-46818795 ATATATATAAACATCAATCATGG + Intergenic
1024753132 7:52493242-52493264 AGAGAAATGCAAATTAAACACGG - Intergenic
1024779033 7:52824380-52824402 ACAGAAATACAAATATAACATGG + Intergenic
1024916495 7:54505814-54505836 ATAGAAACACACATAAAACAAGG - Intergenic
1024949525 7:54844870-54844892 ATAAATATACAAATCATATGGGG - Intergenic
1024954866 7:54906834-54906856 ACAGAAACACACATCAAACAGGG - Intergenic
1025772321 7:64523392-64523414 ATAGATATACAAAAGAAAATAGG + Intronic
1027401580 7:77814311-77814333 ATAGAAACACATATGAAACAAGG - Intronic
1027705140 7:81522036-81522058 ATATATATATAAATTAAATAGGG - Intergenic
1027742351 7:82025934-82025956 CTAAATATATAAAGCAAACATGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028705151 7:93834331-93834353 ATATATATATATATAAAACAAGG + Intronic
1028833661 7:95351003-95351025 AGAGATGTAAAAATGAAACAAGG - Intergenic
1029003452 7:97181550-97181572 ATAGATGTACAATTCCAACAAGG + Exonic
1029047901 7:97650488-97650510 AGAGAAATACATATAAAACAAGG + Intergenic
1029587082 7:101481458-101481480 ATATATATATAATTGAAACAGGG + Intronic
1030232705 7:107224794-107224816 GTAGAAATACAAATCACCCAGGG + Intronic
1030346939 7:108444623-108444645 AGAGATCTACAAACCAAAAATGG - Intronic
1030605960 7:111639436-111639458 ATAGATATACAATTTACACAAGG + Intergenic
1030709568 7:112734278-112734300 ACAAATATACAAAACAAACCAGG - Intergenic
1030992605 7:116318457-116318479 GTATCTATACAAATAAAACATGG - Intronic
1031045840 7:116886569-116886591 GTAGATATAAAAATAAATCAAGG + Intronic
1031454806 7:121965850-121965872 ATTGATATACACATTAAACTTGG - Intronic
1032445385 7:131978110-131978132 ATAGATATAAAGATAAGACATGG - Intergenic
1032604687 7:133337031-133337053 ATACATTTAAAAATAAAACATGG - Intronic
1032753969 7:134870607-134870629 ACAGAAATATAAATTAAACAAGG - Intronic
1032954058 7:136950320-136950342 ATAGAGATACAAATCATAATGGG + Intronic
1033289899 7:140074779-140074801 ATAGAAAAACACATAAAACAAGG - Intergenic
1033633212 7:143181864-143181886 ATGGATAAACAAATCAAATGAGG + Intergenic
1034114266 7:148569203-148569225 AAATATATAAAAATCAAACTGGG + Intergenic
1034888861 7:154821708-154821730 ATATATATACAGAAAAAACATGG + Intronic
1034889383 7:154826578-154826600 CTAGAGCTACAAATCAAACATGG + Intronic
1036800990 8:11791704-11791726 TTAGATGTACGAATCAAACTTGG - Intergenic
1037090218 8:14906113-14906135 AGAGATAAATAAATTAAACATGG + Intronic
1037334864 8:17782096-17782118 ACAGATATACTACTCATACATGG + Intronic
1037350309 8:17946896-17946918 AAAGATATACAAAACATAAAAGG - Intronic
1040528456 8:48245034-48245056 ATTGATTTGCAAATCAAAGAAGG - Intergenic
1040758456 8:50808874-50808896 ATATATATCAAAATGAAACAAGG - Intergenic
1042454398 8:68983801-68983823 ATATATATACAAATGGAAGAAGG + Intergenic
1042555683 8:70032409-70032431 ATACATATACTAATCTATCAAGG + Intergenic
1042568418 8:70136042-70136064 TTAGAGATACATTTCAAACAGGG + Intronic
1042934502 8:74045285-74045307 ATAAATATAAAAACCATACAGGG + Intergenic
1043117767 8:76281065-76281087 ATAAGTATACAAATCTCACAAGG - Intergenic
1043653646 8:82633156-82633178 TCAGATATGAAAATCAAACATGG - Intergenic
1043860818 8:85314727-85314749 ATTAATATACAAATAAAACAAGG - Intergenic
1044355337 8:91215914-91215936 ATAGAAATACAAATTTAAAAGGG + Intronic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1044689649 8:94864111-94864133 GTAGATATATAAAGCAAACATGG + Intronic
1044894100 8:96870360-96870382 ATTGATATACAGATTAAATACGG + Intronic
1045729913 8:105225788-105225810 CTAGAGATAAAAATAAAACAAGG + Intronic
1045944012 8:107774657-107774679 ATAAATATACAAAGTAAAAAGGG + Intergenic
1046006605 8:108493752-108493774 TTCAATATACAAAACAAACATGG - Intergenic
1046071549 8:109261254-109261276 ATAGACATAAAAATTACACAAGG + Intronic
1046501538 8:115084277-115084299 ATACATATACAAATGAAACGTGG - Intergenic
1046591273 8:116210030-116210052 ATAGATGGACAAAGCACACATGG + Intergenic
1046747994 8:117896692-117896714 AAAAATATTAAAATCAAACAAGG + Intronic
1047563384 8:126013450-126013472 ATAGATTTGCAAATCAGAGAAGG + Intergenic
1047634591 8:126746658-126746680 ATAGATAAACTAATTAAAAATGG + Intergenic
1049123470 8:140762686-140762708 ATAAATATACAAATAAAAACTGG + Intronic
1050214604 9:3308650-3308672 ATAAATAGAAAAATCAAACCTGG + Intronic
1050264482 9:3875593-3875615 AAAGATATACAAACCAAAAGCGG + Intronic
1050669055 9:7975607-7975629 AAAAATAAACAAAACAAACATGG - Intergenic
1052147338 9:25066230-25066252 AGAGGTATACAAATTAAACGAGG - Intergenic
1052194089 9:25691339-25691361 AGAGATAAACAAACCAAATATGG - Intergenic
1052531477 9:29690106-29690128 ATAAATTTAGAAATCAATCAAGG + Intergenic
1054988910 9:71298219-71298241 AAAGATTTCCAGATCAAACAAGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055789608 9:79909774-79909796 ATATAAATACGAATAAAACAGGG + Intergenic
1056608178 9:88104631-88104653 ATAAATAAACAAATAATACATGG + Intergenic
1056725591 9:89112369-89112391 AGAGATATACATCACAAACATGG + Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1056925637 9:90832056-90832078 ATAGAAATACACATAAAACAAGG + Intronic
1057113356 9:92496494-92496516 ATAGACATGCAAGTCACACATGG + Intronic
1058429878 9:104908665-104908687 ATAAATATATAAATAAAACTGGG + Intronic
1058545529 9:106057380-106057402 ATAGATAAATAAATAAGACAAGG - Intergenic
1058977093 9:110135179-110135201 ATATATATATAAATCAGCCAGGG + Intronic
1059810926 9:117854607-117854629 ATAGATATTGAAATCACACAGGG + Intergenic
1060020570 9:120127158-120127180 ATAGATAAATAAATCAACAAAGG + Intergenic
1060833539 9:126736731-126736753 ATATATATATGAATCATACAAGG + Intergenic
1061603031 9:131685272-131685294 ATGGATTTGCAAATCAAAGAAGG + Intronic
1185498440 X:577578-577600 ATAGATATACAGATGATAGATGG + Intergenic
1185953033 X:4457571-4457593 ATAAAAATAAAAATCAACCATGG + Intergenic
1186057217 X:5662623-5662645 ACAGAAATACACATAAAACAAGG - Intergenic
1187484780 X:19693234-19693256 ATACAGAGACAAATCAGACAGGG - Intronic
1187777429 X:22777848-22777870 ATAAATGTACAAATAAAAAATGG - Intergenic
1188170744 X:26921673-26921695 ATAAATATATAAATGGAACATGG - Intergenic
1188523354 X:31062433-31062455 ATAGATATGCAAAACAAATAAGG + Intergenic
1188968010 X:36578968-36578990 ATTGATATACCAAGCAAAAAGGG + Intergenic
1189097219 X:38153364-38153386 AAAGTGGTACAAATCAAACATGG + Intronic
1190542269 X:51489259-51489281 AAATATATATAATTCAAACAAGG - Intergenic
1190631272 X:52389296-52389318 ATATATATATATATAAAACAGGG + Intergenic
1190785373 X:53642710-53642732 AGAGAAATAAAAATAAAACAAGG - Intronic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1193224586 X:78967257-78967279 ATACATTTAAAAATCCAACAAGG + Intergenic
1193255255 X:79341294-79341316 AAGGAGATACAAATTAAACAAGG - Intergenic
1193265259 X:79461448-79461470 ATATAAATACAATTCAAAGAAGG - Intergenic
1193424480 X:81325564-81325586 TTAGATAAACAAATCAGAGAAGG + Intergenic
1193609854 X:83617689-83617711 AGAGAGATACAAAACAAAAATGG - Intergenic
1193683864 X:84553786-84553808 ATTGATATACAAACTTAACATGG - Intergenic
1194074919 X:89379026-89379048 ATATATATATAAATAAAATAAGG + Intergenic
1194276297 X:91887142-91887164 CTAGATATACAATTACAACATGG - Intronic
1194679046 X:96829447-96829469 ATATATATATATATAAAACAAGG + Intronic
1194927883 X:99848536-99848558 ATAAATAAATAAATAAAACAGGG - Intergenic
1195240502 X:102947071-102947093 ATAGATCTACACATGAAATATGG + Intergenic
1195459764 X:105110959-105110981 ATAAAAATAAAAATAAAACATGG + Intronic
1196229404 X:113203506-113203528 ATATATATATATATCAAAAAAGG - Intergenic
1196648112 X:118139958-118139980 ATAAATAAATAAATAAAACATGG + Intergenic
1197178448 X:123509315-123509337 ATAAATACACAAATAACACAAGG + Intergenic
1197314736 X:124951188-124951210 GTAGATATTCCAATTAAACAAGG - Intronic
1197577334 X:128231324-128231346 AAAGATATACAAATAAATAAAGG + Intergenic
1197665641 X:129220560-129220582 ATATACATACATATAAAACAGGG + Intergenic
1199295619 X:146154810-146154832 GTGTATATACAAATCAAATATGG - Intergenic
1200589511 Y:5052528-5052550 AAAGATATATAAAGCAAAAATGG - Intronic
1200664355 Y:6001834-6001856 ATAGAGGGACAAATCAAACAAGG + Intergenic
1200730518 Y:6733197-6733219 ATATATATATAAATAAAATAAGG + Intergenic
1201248148 Y:12027327-12027349 ATAAATAAATAAATAAAACAAGG + Intergenic