ID: 1120050246

View in Genome Browser
Species Human (GRCh38)
Location 14:79857594-79857616
Sequence ATAGTGTCCTGGGGGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120050246_1120050251 1 Left 1120050246 14:79857594-79857616 CCTTTGATCCCCCAGGACACTAT 0: 1
1: 0
2: 1
3: 17
4: 96
Right 1120050251 14:79857618-79857640 ATCATCTGCAATCTTAAACATGG 0: 1
1: 0
2: 0
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120050246 Original CRISPR ATAGTGTCCTGGGGGATCAA AGG (reversed) Intronic
900495244 1:2973180-2973202 ACAGTGTCCTGGGGGACTGATGG + Intergenic
908079361 1:60559452-60559474 ATAATGCACTGGGGGATGAAAGG + Intergenic
909154469 1:72054910-72054932 TAATTATCCTGGGGGATCAAAGG + Intronic
909974735 1:82032091-82032113 ATACTGACATGGGGAATCAAAGG + Intergenic
912701886 1:111884167-111884189 ATAGTCTCCTTGGGGATCCTGGG + Intronic
916192309 1:162191516-162191538 AAAGAGTCCTGGGGGAACACAGG - Intronic
917273295 1:173302473-173302495 AGAGTGTCCTAGAGGATCATGGG - Intergenic
918676345 1:187290635-187290657 ATAGGGGCTTGGGGGTTCAATGG - Intergenic
923961507 1:239089446-239089468 ATAGTGTCCTGAGGGCTCTGTGG + Intergenic
1069847974 10:71385802-71385824 AGAGTGGCTTGGGGGATCTAGGG - Intergenic
1075961383 10:126570177-126570199 ATACTGTGCAGGGGAATCAAAGG - Intronic
1081595813 11:44458645-44458667 ACAGTGTCCTCTGTGATCAAAGG - Intergenic
1082198785 11:49337260-49337282 ATAGAGTGCTGGAGGAGCAAGGG + Intergenic
1086071564 11:82805507-82805529 ATCGTCTCCTGGGCTATCAAAGG - Intergenic
1086657027 11:89370839-89370861 ATAGAGTGCTGGAGGAGCAAGGG - Intronic
1087575402 11:99983790-99983812 ATATTGGCCTGGGGGTTCAAAGG + Intronic
1091959844 12:4684412-4684434 ACAGAGTCCTGGGGGGCCAAGGG - Intronic
1099791005 12:87333508-87333530 TTAGTGCCCTCAGGGATCAAAGG - Intergenic
1101229129 12:102721899-102721921 ATACTGTCCTGAGGGCACAAAGG + Intergenic
1102426173 12:112846044-112846066 CTAGTGACCAGGGGGAGCAAGGG + Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1109460019 13:62644286-62644308 ATTGTGTCCTGGGGCAGCAGGGG + Intergenic
1110169904 13:72488073-72488095 ATAGTGACCAGGTGGAACAAGGG + Intergenic
1116029545 14:39554359-39554381 AGAGTGTGCTAGGGGAACAATGG - Intergenic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1123414387 15:20084316-20084338 ATAATGCCATGGGGAATCAATGG - Intergenic
1123523729 15:21091427-21091449 ATAATGCCATGGGGAATCAATGG - Intergenic
1125389897 15:39180989-39181011 ATAGTGTCCTAGGACATGAAGGG + Intergenic
1126465272 15:48955995-48956017 CTAGTGTCCAGGGGCATGAAAGG + Intronic
1126969345 15:54092591-54092613 AGAGTGTTCTTGGGGATTAAGGG - Intronic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1130799485 15:87247047-87247069 AGAGTGTAGTGGGGGATAAAAGG + Intergenic
1131150295 15:90043361-90043383 ATAGGGTCCTGGGTGAGCCAAGG - Intronic
1134650022 16:15901105-15901127 ATAGTGTCCTGGGCCATGAATGG - Intergenic
1138936285 16:61728426-61728448 ATACTATCCTGAGGGATTAATGG + Intronic
1139251699 16:65502620-65502642 ATAGTGTGCTGGGGGAGAAAGGG + Intergenic
1139332278 16:66202551-66202573 AAAGTGACCTGGGGAATTAATGG - Intergenic
1139640835 16:68290381-68290403 AGAGTGTCCTGTGGGGGCAAAGG - Exonic
1141579044 16:84984750-84984772 ATGGTGTCCTGGGGGTTTCAAGG + Intronic
1141723279 16:85768776-85768798 AAACTGTCCTGGGGTATCCAGGG + Intergenic
1142367409 16:89657441-89657463 ATGGGGTCCCGGGGGATCGACGG + Intronic
1153758759 18:8310233-8310255 CAAGAGTCCTAGGGGATCAATGG - Intronic
1155719811 18:28997451-28997473 ATAGTGTCCTTGGACATAAATGG + Intergenic
926078873 2:9967223-9967245 TGACTCTCCTGGGGGATCAAGGG - Intronic
940120538 2:150259825-150259847 ATAGTGGAATGGGAGATCAAGGG + Intergenic
944670705 2:201992226-201992248 ATCGTGGCCTGGGGAATGAATGG + Intergenic
948016194 2:234692736-234692758 ACTGGGTCCTGGGGGGTCAATGG + Intergenic
948277462 2:236720054-236720076 ATAGTGCCCTGGGGTCTCTAAGG + Intergenic
948813293 2:240496779-240496801 ACAGTGCCCTGGGGTATAAATGG + Intronic
948983689 2:241507932-241507954 AGAGTCTCCTGGGGGTTCAGAGG - Intronic
1169960655 20:11156033-11156055 ACAGTGGCTTGGGGAATCAAGGG + Intergenic
1174432540 20:50480919-50480941 ACAGTGGCCTGGAGGAGCAAAGG + Intergenic
1174796835 20:53529309-53529331 ACAGTGGCCTGGAGGACCAAAGG - Intergenic
1180534779 22:16387633-16387655 AGAGTGTCCTGGGGGAGGCAGGG + Intergenic
1181450015 22:23013549-23013571 ATAAGGTCCTGGGGAACCAAAGG - Intergenic
1182545726 22:31075251-31075273 ATAATGCCATGGGGAATCAATGG + Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
955390539 3:58519394-58519416 AGAGTGCCTTGGGGGTTCAAAGG + Intronic
957243429 3:77688239-77688261 ATAGTGACTTGGGAGATCTAAGG + Intergenic
960331902 3:116370182-116370204 ATAGTGTTTTGGGGAATAAAAGG + Intronic
960938445 3:122917815-122917837 ATATTTTCCTCTGGGATCAATGG + Intronic
961057341 3:123800145-123800167 ATGGAGTCCTGGGGGAGCCAGGG + Intronic
961865011 3:129947438-129947460 ATAGTCTCCTGGGGGTTGACTGG - Intergenic
962062187 3:131941033-131941055 ATAGTGTCTTGGAGGATCATAGG - Intronic
965941070 3:174182426-174182448 ATAGTGTCCTGGGGGTAAAGTGG - Intronic
968283480 3:197494499-197494521 ATAGTGTCAGGAGGGATTAATGG + Intergenic
974245323 4:59307831-59307853 ATTGTCTCTTGGGGAATCAAAGG - Intergenic
975243773 4:72094404-72094426 ATAGTCTCCTGGGAGCTCCATGG - Intronic
975289593 4:72661322-72661344 TTAGTGTTCTGTGGGATCTATGG + Intergenic
980153381 4:129076405-129076427 ATAGTCTGCTGGGGGAAAAAAGG - Intronic
981838220 4:149080189-149080211 TTAGTGTGCTGAGAGATCAAAGG - Intergenic
985561875 5:592121-592143 ATAATCTCCTGGGGGCTCTAGGG - Intergenic
996753904 5:126916374-126916396 ATAGTGTTCAGGAGGATGAATGG - Intronic
997286006 5:132679058-132679080 AAGGTGTCCTGGGAGATCAGAGG - Intronic
997533113 5:134594804-134594826 AGACTATCCTGGGGGATCACTGG + Intergenic
997834567 5:137181859-137181881 GCAGTCTCCTGGGGGATGAAAGG - Intronic
1003276578 6:4658989-4659011 AAGGAGTCCTGGGGGATCCAGGG + Intergenic
1005501110 6:26430006-26430028 ACACTGTCCTGGAGGATAAAGGG - Intergenic
1005505663 6:26467154-26467176 ACACTGTCCTGGAGGATAAAGGG - Intronic
1006440371 6:34050070-34050092 ATAGGGTCATGGGGGAGCAACGG - Intronic
1009967708 6:70594501-70594523 ATAGAGTCCTGAGGCATCACAGG - Intergenic
1012647226 6:101700847-101700869 ATAGAGCCCAGGGGGCTCAAAGG + Intronic
1015296806 6:131604186-131604208 ATAGAGTCTTTGGGCATCAAAGG - Exonic
1016216291 6:141607852-141607874 ATAATCTCTTGGGGGATCTAGGG - Intergenic
1017407518 6:154136103-154136125 AGAGAGTCCTGGGTGATCACAGG + Intronic
1019935811 7:4256855-4256877 AAAATGTCCTGGGGGATAAAAGG - Intronic
1022829867 7:34055148-34055170 GTAGAGTCCTGGGGGCCCAAAGG - Exonic
1029956622 7:104647048-104647070 AGACTGTCCTGGGGTATCCAAGG - Intronic
1035932329 8:3793795-3793817 TTAGTGCCCTGGGGCATAAAAGG - Intronic
1036273548 8:7330604-7330626 AAAGTGTCCTGGGGGAAGAAAGG - Intergenic
1036274113 8:7335346-7335368 AAAGTGTCCTGGGGGAAGAAAGG - Intergenic
1036274685 8:7340066-7340088 AAAGTGTCCTGGGTGAAGAAAGG - Intergenic
1036346668 8:7970280-7970302 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036347236 8:7975002-7975024 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036347799 8:7979748-7979770 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036841991 8:12131034-12131056 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036842552 8:12135788-12135810 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036843119 8:12140517-12140539 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036863822 8:12377284-12377306 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036864446 8:12382328-12382350 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1037706305 8:21317812-21317834 ATAGTGTGCTGGGGAAACTAAGG + Intergenic
1038606940 8:29016424-29016446 ATAGTGTATTGGGGGATAAAGGG + Intronic
1038943278 8:32329494-32329516 ATAATGTGATGGGGGATAAAAGG + Intronic
1041632571 8:60104441-60104463 ATAGTGTCCTGGAAGAGAAAGGG + Intergenic
1044653677 8:94525022-94525044 ATTGTGTACTGGGAAATCAATGG - Intronic
1045243527 8:100422930-100422952 ACAGTGTCCTAGGGGATAACTGG + Intergenic
1045799317 8:106083500-106083522 ATACTTTCCTGGGGGCTTAATGG - Intergenic
1047555967 8:125930687-125930709 ACAGTCTCCTTGGTGATCAAGGG - Intergenic
1047778221 8:128091032-128091054 AGACTTTCCTGGGGGATTAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1060948638 9:127586521-127586543 ACAGTGTCCTGGTGGCTCAGAGG + Intergenic
1188156664 X:26749424-26749446 AGAGTATCTTGGGGGATCATGGG - Intergenic
1193256803 X:79358025-79358047 ATAGTCTCCTGGGGAGTAAAAGG - Intergenic
1196557741 X:117110067-117110089 AAAGTGTCCTTGGGGATCACTGG + Intergenic