ID: 1120052863

View in Genome Browser
Species Human (GRCh38)
Location 14:79888405-79888427
Sequence CAATTACATCAGAATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120052863_1120052867 25 Left 1120052863 14:79888405-79888427 CCTGGGTGATTCTGATGTAATTG No data
Right 1120052867 14:79888453-79888475 TCAGAACTTCTGACTTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120052863 Original CRISPR CAATTACATCAGAATCACCC AGG (reversed) Intergenic
No off target data available for this crispr