ID: 1120053289

View in Genome Browser
Species Human (GRCh38)
Location 14:79893422-79893444
Sequence ATTTCTGGGGGGAATTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120053279_1120053289 21 Left 1120053279 14:79893378-79893400 CCTTCACTTGAATATTAGACTCA No data
Right 1120053289 14:79893422-79893444 ATTTCTGGGGGGAATTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120053289 Original CRISPR ATTTCTGGGGGGAATTTTGG GGG Intergenic
No off target data available for this crispr